Irpex lacteus protoplast genetic transformation method

Abstract

The invention relates to the field of genetic transformation, in particular to a protoplast genetic transformation method of white-rot fungi Irriga lactea. According to the invention, the preparation and genetic transformation method of the white-rot fungus Irpex lacteus protoplast is established for the first time, the transformation efficiency is 6-7 transformants / [mu] g DNA, the transformation period is 1-2 weeks, the method has the characteristics of high transformation efficiency, short transformation time period and the like, and powerful support is provided for research work of gene functions and strain improvement of Irpex lacteus in the future.

Description

Technical Field

[0001] The invention relates to the field of genetic transformation, and in particular to a method for genetic transformation of protoplasts of Pseudomonas aeruginosa. Background Art

[0002] As a white-rot fungus with strong lignin degradation ability, Pseudomonas aeruginosa is widely used in the field of biotechnology. Currently, research on this strain mainly focuses on the properties and applications of lignin-degrading enzymes. Research on molecular mechanisms is still in the exploratory stage, and many key technical problems need to be solved urgently, which seriously hinders the basic research and development and utilization of Pseudomonas aeruginosa.

[0003] Efficient and stable genetic transformation systems are crucial for studying functional genes and modifying strains of white-rot fungi. However, due to the genetic and morphological complexity of white-rot fungi, the development of genetic transformation systems has been relatively slow. Most white-rot fungi lack comprehensive genetic transformation systems, and even methods for preparing protoplasts are lacking. To date, neither protoplast preparation methods nor genetic transformation systems have been established for Pseudomonas aeruginosa.

[0004] In recent years, despite reports of establishing genetic transformation systems for the white-rot fungi Phanerochaete chrysosporium, Pleurotus ostreatus, and Ganoderma lucidum, these systems suffer from low transformation efficiency (5 transformants / μg DNA) and long transformation cycles (2–3 weeks). Furthermore, protoplast preparation methods for these strains are not suitable for Psoralea lactis due to the effects of lytic enzymes and osmotic stabilizers on protoplast preparation and regeneration. Therefore, establishing protoplast preparation and genetic transformation methods for Psoralea lactis is of great significance for future research on gene function and strain improvement in Psoralea lactis. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for genetic transformation of protoplasts of Pseudomonas aeruginosa.

[0006] The method for genetic transformation of protoplasts of the lactobacillus strain according to the present invention comprises the following steps:

[0007] Steps for preparing protoplasts of Pseudomonas aeruginosa:

[0008] Inoculate the milky white rake fungus block in PDB medium and culture it at 30℃ for 72 hours;

[0009] Filter the bacterial solution, collect the cells, and then rinse once with 0.5M magnesium sulfate solution;

[0010] Adding filtered sterilized lytic enzyme and pectinase solutions to the washed cells to obtain a cell digestion suspension, wherein the concentrations of the lytic enzyme solution and the pectinase solution are both 3 wt %, and the mass ratio of the cell wet weight to the enzyme dosage is 1:1;

[0011] The above bacterial digestion suspension was placed in a constant temperature shaker, incubated at 30°C, with a rotation speed of 75 rpm, and enzymatically hydrolyzed for 4 hours;

[0012] The residual mycelium was removed by filtration and the protoplast fluid was collected;

[0013] The protoplast solution was centrifuged at 4000 rpm for 10 minutes, the supernatant was discarded, and the protoplasts were washed once with 4 mL of MMC buffer;

[0014] The supernatant was discarded, and the protoplasts were suspended in 0.4 mL of MMC solution: 12.5 mM calcium chloride, 0.5 M mannitol, 25 mM maleic acid buffer, pH 5.5;

[0015] (2) Steps of genetic transformation:

[0016] Take 200 μL of the protoplast suspension prepared above, add 10 μL of a linearized hygR gene expression cassette with a concentration of 3 μg / μL and 50 μL of PEG solution, mix gently, and place on ice for 20 minutes, wherein the hygR gene expression cassette includes a promoter Pgpd and a hygromycin B phosphotransferase gene hygR from upstream to downstream, the nucleotide sequence of the promoter Pgpd is shown in SEQ ID NO: 1, and the nucleotide sequence of the hygR is shown in SEQ ID NO: 2.

[0017] Add 1.32 mL of PEG solution, mix gently, and let stand at room temperature for 5 minutes. The formula of the PEG solution is: 30% PEG4000, 300 mM calcium chloride, 10 mM Tris-HCl pH 7.5;

[0018] Add 2.64 mL of GTC buffer, mix carefully, add the upper layer of YMPG medium containing 100 μg / mL hygromycin B to resuspend, pour onto the lower layer of YMPG medium containing 100 μg / mL hygromycin B, and place in a 30°C constant temperature incubator. After culturing for 4 days, transformants were obtained. The formula of the GTC solution is: 25 mM calcium chloride, 0.6 M mannitol, 10 mM Tris-HCl pH 7.5.

[0019] Upper layer YMPG medium: 0.6 M mannitol, 0.2% yeast extract, 1% malt extract, 0.2% tryptone, 1% glucose, 0.1% asparagine monohydrate, 0.1% magnesium sulfate heptahydrate, 0.2% potassium dihydrogen phosphate, 0.75% agarose.

[0020] Lower layer YMPG medium: 0.6 M mannitol, 0.2% yeast extract, 1% malt extract, 0.2% tryptone, 1% glucose, 0.1% asparagine monohydrate, 0.1% magnesium sulfate heptahydrate, 0.2% potassium dihydrogen phosphate, 1.5% agar.

[0021] >SEQ ID NO: 1:

[0022] TGGTACGACGAATGACTCGTTCATGTCGTAGGTATGGGAAGATTATCGTGCAAG

[0023] AGATTGATAAGCTGTGTCCTCCTATCATTACCCTCAGATGGTGTTCTTGCGAAGC

[0024] GTTGAGATTCGGAATACGTTTTCAACAGCGTACCGAAATTGTTGCGGTATGACA

[0025] GTCAGAACAAGACTACGTAGTAGGAATCGGCGCGAGACATACACTGCATGACA

[0026] GATAGCGAAATGGTTTCGTATCTCATTCCATACTTAGAAACATACAAAAACATAT

[0027] CCAGAAGCCGAATCACCATGGCCTCCATATATTGACGGCCTGTAGCACCGAATT

[0028] TCGAATGGGAGTGGACAGGCGTAGGGCGGGTCTAGACGTGAGCTCGGAGATC

[0029] GGATGGTCGGCATGATATAGGTGTTGCGGATGGAGAGATGGCAGGAGATGGCG

[0030] CAAAGCGTCCGCCGAGAGGGTAGAACGGATTGTCATTGGATGCCACCGTGTGG

[0031] CTCATCGCATGTGGGTACCCCTCTAGCCGCACCATAGTGAACCTCCACAGTGCT

[0032] AGTTTCTGCTGGCTGGTTCTCATCATTACCATCGCAGGCTGCAGTACATTTGTGA

[0033] GATTACCAGATAAGGAAAACAAAACAAAACATCTGGTTGTATGTCGGGCTA

[0034] GGCGAAGGGCGGTGTAGCGGAGCGCAGAGTCGCCGCAGACAGGTTTGTCAGA

[0035] CTCTGACAAAACTGCAGAGACGCGGACGACCGATAGCCATCATGCTAGGCTGC

[0036] GCCAGTTCTTTGCGAAGTTTTTCGATTGGCCTGGCGAAGACTGGGAGCATGTC

[0037] GAACAGGCGTCGACCACGACCGAGAGCAACGTCAAGGAGGAGATGCTATGCG

[0038] GTCGACGCTCTAGAGCCGAATTCCTGGCTAGATTCGAATCAGAGTTGCTAGTCG

[0039] AGGCGACGCTCTGGATTGGCCCTTGGCGCAATCCGCGGAATATTTTTGGCTGAT

[0040] AACTCCGAATGTGGCATGGGTGATCTTTAGATATCGATGACGAAAGCGTATATAT

[0041] ACCTGCCGTCGCGTCCATCCACTCTCTCCCCAACCCCCAACACCTCCTATCC

[0042] ACAACAAGCAATGGCAGTGAGTGTCTTTTGCATCGTTCACCACAGCCGAGCTCGCATCCTAACTCGTTCCCCGTTCTCCAG。

[0043] >SEQ ID NO:2

[0044] ATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAA

[0045] GTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTG

[0046] CTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCG

[0047] CCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCT

[0048] CCCGATTCCGGAAGTGCTTGACATTGGGGAGTTTAGCGAGAGCCTGACCTATTG

[0049] CATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAAC

[0050] TGCCCGCTGTTCTACAACCGGTCGCGGAGGCTATGGATGCGATCGCTGCGGCCG

[0051] ATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAA

[0052] TACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACT

[0053] GGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGAT

[0054] GAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGC

[0055] GGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCAT

[0056] TGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCT

[0057] TCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAG

[0058] CGGAGGCATCCGGAGCTTGCAGGATCGCCACGACTCCGGGCGTATATGCTCCG

[0059] CATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGC

[0060] AGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTG

[0061] TCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGT

[0062] GTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGC

[0063] AAAGAAATAGTCCGTCGACCTGCAGATCGTTCAAACATTTGGCAATAAAGTTTC

[0064] TTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAA

[0065] TTACGTTAAGCATGTAATAATTAACATGTAATGCATAGTACCGAGAAACTAGTGGATCTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCA.

[0066] According to the technical solution of the present application, the combination of lysing enzymes and the type of osmotic pressure stabilizer significantly affect the quality of the preparation of protoplasts of the milky white mushroom. When the combination of lysing enzyme and pectinase Vino Taste Pro is used, the number of protoplasts that can be prepared after 4 hours of enzymatic hydrolysis is 2.5x10 6cells / mL; when using a single lysing enzyme, only a very small number of protoplasts were produced after 4 hours of enzymatic hydrolysis. GTC solution and YMPG contain mannitol, which acts as an osmotic stabilizer. The number of hygromycin-resistant transformants obtained for P. lactis was approximately 200, while no hygromycin-resistant transformants were obtained using other osmotic stabilizers.

[0067] The present invention has the following beneficial effects:

[0068] The present invention establishes for the first time a method for preparing protoplasts of the white rot fungus Psoralea corylifolia and carrying out genetic transformation. The transformation efficiency is 6 to 7 transformants / μg DNA, and the transformation cycle is 1 to 2 weeks. It has the characteristics of high transformation efficiency and short transformation time cycle, and provides strong support for future research on the gene function and strain improvement of Psoralea corylifolia. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 Shows the process of genetic transformation of protoplasts of Rhizobium leucogenum;

[0070] Figure 2 The results of the sensitivity test of the lactobacillus to different concentrations of hygromycin B are shown;

[0071] Figure 3 The genomic PCR verification results of transformants constitutively expressing hygR are shown. DETAILED DESCRIPTION

[0072] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0073] The chemical reagents involved in this application include:

[0074] PDB and PDA culture media from BD, Lysing enzyme from Sigma-Aldrich, and Vino Taste Pro pectinase from Novozymes.

[0075] MMC solution: 12.5 mM calcium chloride, 0.5 M mannitol, 25 mM maleic acid buffer pH 5.5.

[0076] PEG solution: 30% PEG 4000, 300 mM calcium chloride, 10 mM Tris-HCl pH 7.5.

[0077] GTC solution: 25 mM calcium chloride, 0.6 M mannitol, 10 mM Tris-HCl pH 7.5.

[0078] Upper layer YMPG medium: 0.6 M mannitol, 0.2% yeast extract, 1% malt extract, 0.2% tryptone, 1% glucose, 0.1% asparagine monohydrate, 0.1% magnesium sulfate heptahydrate, 0.2% potassium dihydrogen phosphate, 0.75% agarose.

[0079] Lower layer YMPG medium: 0.6 M mannitol, 0.2% yeast extract, 1% malt extract, 0.2% tryptone, 1% glucose, 0.1% asparagine monohydrate, 0.1% magnesium sulfate heptahydrate, 0.2% potassium dihydrogen phosphate, 1.5% agar.

[0080] The lactobacillus 5.809 was purchased from the China General Microbial Culture Collection Center. Figure 1 shown.

[0081] Example 1 Evaluation of the sensitivity of the white rot fungus Psoralea corylifolia to hygromycin B

[0082] To determine whether the white rot fungus, Pseudomonas aeruginosa, is tolerant to hygromycin B and what its tolerance concentration is, the fungus blocks were inoculated on PDA culture medium containing 0, 50, 100, and 200 μg / mL hygromycin B and placed in a 30°C constant temperature incubator. After culturing for 3 days, the growth of Pseudomonas aeruginosa on culture medium with different hygromycin B concentrations was observed to determine the lowest hygromycin B concentration that inhibited the growth of Pseudomonas aeruginosa. Figure 2 As shown in the results, 50 μg / mL hygromycin B can completely inhibit the growth of P. lactis. In order to fully suppress the occurrence of false positives, 100 μg / mL hygromycin B was selected for resistance screening in the establishment of the P. lactis genetic transformation system.

[0083] Example 2 Protoplast preparation and genetic transformation of the white rot fungus Lactobacillus spp.

[0084] 1. Preparation of Protoplasts of Pseudomonas aeruginosa

[0085] Inoculate one-quarter of the bacterial mass on the plate into 100 mL of PDB medium and culture at 30°C for 3 days;

[0086] Use a 100-mesh sieve to filter out the bacterial solution, collect the cells, and then rinse once with 0.5 M magnesium sulfate solution;

[0087] The washed cells were placed in a 50 mL centrifuge tube and 20 mL of 3 wt% Lysingenzyme + 3% pectinase Vino Taste Pro solution was added.

[0088] The above bacterial digestion suspension was placed in a constant temperature shaker, incubated at 30°C, with a rotation speed of 75 rpm, and enzymatically hydrolyzed for 4 hours;

[0089] The above bacterial digestion suspension was then filtered through a double layer of lens paper to remove residual mycelia, and the protoplast fluid was collected using a sterile 50 mL centrifuge tube;

[0090] Place the protoplast fluid in a centrifuge, set the speed to 4000 rpm, and centrifuge for 10 minutes;

[0091] After centrifugation, the supernatant was discarded, and the protoplasts were washed once with 4 mL MMC buffer;

[0092] The supernatant was discarded and the protoplasts were suspended in 0.4 mL MMC solution.

[0093] 2. Construction of the hygR gene expression cassette

[0094] The hygromycin B phosphotransferase gene (hygR) was used as a genetic marker to construct a hygR gene expression cassette. The primers are shown in the following table:

[0095] Table 1 Primers used to construct the hygR gene expression cassette

[0096]

[0097]

[0098] Using Pseudomonas aeruginosa genomic DNA as a template, primers Pgpd-F / Pgpd-R were used to amplify the gpd gene promoter fragment; using plasmid pBARGPE1-hygR-EGFP as a template, primers hygR-F / hygR-R were used to amplify the hygR genetic screening marker fragment; then, using products Pgpd and hygR as templates, primers Pgpd-F / hygR-R were used to amplify the gene expression cassette product Pgpd+hygR, which was recovered and ligated with the pEASY-Blunt vector, transformed into a Trans I cloning host, and sequenced to obtain the vector pEASY-Blunt-Pgpd (SEQ ID No: 1)-hygR (SEQ ID No: 2).

[0099] 3. Transformation of Protoplasts of Pseudomonas aeruginosa

[0100] Take 200 μL of protoplast suspension, add 10 μL of 3 μg / μL linearized hygR gene expression cassette and 50 μL of PEG solution, mix gently, and place on ice for 20 minutes;

[0101] Add 1.32 mL of PEG solution, mix gently, and let stand at room temperature for 5 minutes;

[0102] Add 2.64 mL of GTC buffer, mix carefully, add the upper layer of YMPG medium containing 100 μg / mL hygromycin B to resuspend, pour onto the lower layer of YMPG medium containing 100 μg / mL hygromycin B, and place in a 30°C constant temperature incubator. After culturing for 4 days, approximately 200 hygromycin-resistant L. lactis transformants were obtained, with a transformation efficiency of 6 to 7 transformants / μg DNA.

[0103] 4. PCR Identification and Sequencing Verification of Transformants

[0104] Seven transformants with hygromycin B resistance were randomly selected from the plate and transferred to PDA plates. After culturing in a 30°C constant temperature incubator for 3 days, a small amount of transformant hyphae was picked and the genome was extracted using the UniversAll Tissue Extraction Kit. PCR verification was performed using YZ-hygR-F / YZ-hygR-R as primers. Figure 3 As shown, a band of about 900 bp was amplified in the transformant genome, and sequencing confirmed that it was a hygR resistance gene fragment, indicating that the hygR gene expression cassette was successfully inserted into the L. lactis genome, with a positive rate of 100%.

[0105] Table 2 Primers used to verify the hygR gene expression cassette in transformants

[0106] Primers Sequence (5'-3') YZ-hygR-F GCTGCGCCGATGGTTTCTACAA YZ-hygR-R GGGGCGTCGGTTTCCACTATC

[0107] Example 3 Effect of Lysis Enzyme Combination on the Number of Protoplasts Generated During Protoplast Preparation

[0108] The lysing enzyme combination of lysing enzyme and pectinase Vino Taste Pro in the preparation step of the protoplasts of the lactobacillus in Example 2 was replaced with a single lysing enzyme with the same total mass of enzymes, and the generation of protoplasts was observed.

[0109] Result analysis: When Lysing enzyme and pectinase Vino Taste Pro were used in combination, the number of protoplasts that could be prepared after 4 hours of enzymatic hydrolysis was 2.5x10 6 When using a single lysing enzyme, only a very small amount of protoplasts were generated after 4 hours of enzymatic hydrolysis.

[0110] Example 4 Effect of Osmotic Stabilizer Type in Protoplast Regeneration Medium on Transformation Efficacy

[0111] The osmotic pressure stabilizer mannitol in the regeneration medium in the transformation step of the protoplasts of Lactobacillus lactis in Example 2 was replaced with an equal amount of sorbitol, and the growth of the transformants was observed.

[0112] Result analysis: When mannitol was used as an osmotic pressure stabilizer, the number of hygromycin-resistant transformants of P. lactis was about 200; when sorbitol was used as an osmotic pressure stabilizer, no hygromycin-resistant transformants were obtained.

[0113] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any simple modification, equivalent changes and modifications made to the above implementation methods based on the technical essence of the present invention are within the scope of the technical solution of the present invention.

Claims

1. A method for genetic transformation of protoplasts of white rot fungus Lactobacillus leucoderma, characterized in that: The method comprises the following steps: (1) Preparation of protoplasts of white rot fungus milky white rake fungus: Inoculate the bacterial mass of milky white rake fungus into PDB medium and culture it statically; Filter out the bacterial solution, collect the bacteria and rinse them; Adding filtered sterilized lytic enzyme and pectinase solution to the washed bacterial cells to obtain a bacterial digestion suspension, wherein the concentration of the lytic enzyme solution and the pectinase solution are both 3wt%, and the mass ratio of the wet weight of the bacterial cells to the amount of enzyme is 1:1; The bacterial digestion suspension was placed in a constant temperature culture and enzymatically hydrolyzed for 4 hours; Filter to remove residual mycelium, collect protoplast fluid, discard supernatant, wash, add MMC solution to obtain protoplast suspension, (2) Genetic transformation: Take the above-prepared protoplast suspension and add the linearized hygR gene expression cassette and PEG solution. The ratio of the number of protoplasts to the amount of hygR gene expression cassette is 10. 4 protoplasts / μg DNA; mix well and place on ice, wherein the hygR gene expression cassette includes Pgpd and hygR from upstream to downstream, the nucleotide sequence of the promoter Pgpd is shown in SEQ ID NO: 1, and the nucleotide sequence of the hygR is shown in SEQ ID NO: 2; Add PEG solution, mix well, and leave at room temperature; Add GTC buffer, mix well, add upper YMPG medium containing hygromycin B to resuspend, pour onto lower YMPG medium plate containing hygromycin B, and obtain transformants after culture.

2. The method for genetic transformation of protoplasts of the white rot fungus Lactobacillus leucoderma according to claim 1, characterized in that: The formula of the MMC solution is: 12.5 mM calcium chloride, 0.5 M mannitol, 25 mM maleic acid buffer pH 5.

5.

3. The method for genetic transformation of protoplasts of the white rot fungus Lactobacillus spp. according to claim 1, characterized in that: The formula of the PEG solution is: 30% PEG 4000, 300 mM calcium chloride, 10 mM Tris-HCl pH 7.

5.

4. The method for genetic transformation of protoplasts of the white rot fungus Lactobacillus spp. according to claim 1, characterized in that: The formula of the GTC solution is: 25 mM calcium chloride, 0.6 M mannitol, 10 mM Tris-HCl pH 7.

5.

5. The method for genetic transformation of protoplasts of the white rot fungus Lactobacillus leucoderma according to claim 1, characterized in that: The upper YMPG culture medium and the lower YMPG culture medium contain 0.6M mannitol osmotic pressure stabilizer.

Images