RNA (Ribonucleic Acid) in-vitro cyclization and rolling circle translation method based on I-type intron and application thereof

Abstract

The invention discloses an RNA (Ribonucleic Acid) in-vitro cyclization and rolling circle translation method based on an I-type intron and an application of the RNA in-vitro cyclization and rolling circle translation method. According to the invention, a ribonucleic acid construct is obtained by splitting a specific non-complementary region of the I-type intron, and the preparation of'scarless' (traceless) circular RNA is realized through a ribozyme self-splicing principle and can be popularized to other I-type intron. By optimizing a splitting structure, high-efficiency cyclization can be realized without additionally adding GTP for catalysis under the condition of no homologous arm. Meanwhile, the original part of the ribonucleic acid construct is optimized, so that the cyclization efficiency is further improved. Particularly, a rolling circle translation (RCT) technical platform based on the CITE sequence is established, and the expression quantity of the protein or the polypeptide is greatly improved. Through verification, the cyclization and rolling circle translation method provided by the invention shows potential in vaccine and CAR treatment, and is expected to be used for clinical treatment of various diseases.

Description

Technical Field

[0001] The invention relates to the fields of molecular biology and immunology, and in particular to a method for RNA in vitro cyclization and rolling circle translation based on type I introns and an application thereof. Background Art

[0002] Circular RNA is a type of single-stranded RNA without a 5' cap and a 3' poly(A) tail, which is connected by covalent bonds to form a closed circular topology. The circular structure protects it from degradation by nucleases and has high stability. For a period of time after circular RNAs were discovered, they were considered to be rare, non-functional abnormal splicing byproducts. However, in the past decade, there has been a fundamental shift in the view that circular RNAs are ubiquitous and functionally important molecules in biology. This is largely due to the emergence of RNA-seq technology, which has revealed that circular RNAs are ubiquitous and evolutionarily conserved in eukaryotes. Circular RNAs have specific biological functions in RNA ligands, miRNA sponges, protein sponges, antisense circular molecules, innate immune activators, innate immune suppressors, protein translation, and biomarkers.

[0003] In organisms, pre-mRNA removes introns and connects to form mRNA. This is caused by the spliceosome acting on the 5' and 3' splicing sites of the introns, resulting in the introns being spliced ​​and the exons being connected to form mRNA, which is forward splicing. However, the circular RNA produced in most organisms is not achieved through forward splicing, but through back splicing. Back splicing does not occur at the two ends of the intron, but at the two ends of the exon (i.e., the 3' end of the first intron and the 5' end of the second intron). This type of splicing will circularize the exons and form circular RNA.

[0004] Due to its high stability, people have paid attention to the application of circular RNA in nucleic acid drugs, especially the preparation of circular RNA in vitro. The current methods mainly include: first, chemical synthesis, through the synthesis and connection of special nucleotide derivatives; second, the end connection of linear RNA catalyzed by nucleic acid ligase; third, the end connection of linear RNA based on the self-splicing characteristics of intron ribozymes.

[0005] Nucleic acid drugs are another type of drug that has been studied extensively after small molecule drugs and protein drugs, and circular RNA has been greatly developed under the impetus of linear RNA. Endogenous circular RNA can be used as a new drug target or a marker for disease diagnosis, while artificially prepared circular RNA can target multiple targets and exert its effects in cells. Currently, circular RNA has made great breakthroughs in the fields of infectious vaccines, tumor vaccines, CAR-T, protein replacement therapy, gene editing, etc., so the preparation of circular RNA is crucial for its application.

[0006] The preparation of circular RNA based on the ribozyme self-splicing mechanism currently mainly includes the Group I intron (type I intron) and Group II intron (type II intron) self-splicing methods. Among them, the type I intron self-splicing has adopted the type I intron sequence on the Anabaena tRNA Leu gene or the thymidylate synthase (td) gene of T4 phage. Both of these type I introns have been proven to be highly efficient in promoting RNA circularization. The main idea is to use the PIE system to transform introns, which generally include the 3' intron, the adjacent exon E2, the target gene, the adjacent exon E1, and the 5' intron. The RNA circularization process is roughly as follows: (1) A guanosine nucleophile attacks the E1 splicing site and replaces the 3' end; (2) The 3' end of the intermediate further attacks the E2 splicing site to form a circular RNA.

[0007] Recently, it has been reported that the trans-splicing ribozyme uses the Tetrahymena group I intron to recognize the target site (5'-NNNNNU-3') on the substrate RNA with specific base complementary pairing through the internal guide sequence IGS (5'-GNNNNN-3'), forming a P1 helical structure. The P1 and P10 helices define the 5' and 3' splicing sites, respectively. The target sequence recognized by the ribozyme is placed at the 3' end of the target gene, and the ribozyme sequence with IGS is placed at the 5' end of the target gene, and cyclization can be achieved without carrying AS, ABS, or P10 sequences (Lee, KH, et al., Efficient circular RNA engineering by end-to-end self-targeting and splicing reaction using Tetrahymena group I intron ribozyme. MolTher Nucleic Acids, 2023.33: p.587-598).

[0008] There are still some unsolvable problems in the existing cyclization technology: the ribozyme self-splicing mechanism is used to prepare circular RNA. Due to the difference in RNA sequences, the circular RNA structure formed is very different, resulting in low cyclization efficiency, high innate immunogenicity and low expression. Among them, the splicing of type I introns of Ana and T4 will introduce exogenous exon sequences, which may affect the function of circular RNA and bring about higher innate immunogenicity. The type I intron of Tetrahymena has a relatively low cyclization efficiency in the absence of homologous arms. Moreover, the efficiency of circular RNA translation also limits the application of this technology.

[0009] In view of this, a method for preparing and translating circular RNA is needed to improve circularization efficiency, reduce exogenous sequences, reduce immunogenicity, and increase expression amount, so the present invention is proposed. Summary of the invention

[0010] To solve the above problems, the present invention innovatively splits the P9 non-complementary region of the type I intron, and realizes the preparation of circular RNA through the principle of ribozyme self-splicing. By optimizing the structure, in the absence of homologous arms, no additional GTP is added, and efficient cyclization can be achieved, which is conducive to industrial preparation. At the same time, the cyclization method of the present invention introduces fewer exogenous sequences, reduces innate immunogenicity, and has higher effectiveness and safety when applied to vaccines and in situ CAR drugs.

[0011] The first object of the present invention is to provide a ribonucleic acid (RNA) construct for the preparation of circular RNA, which comprises the following operable elements from the 5' end to the 3' end:

[0012] 3' intron and including the 3' splice site,

[0013] GOI region, including the target gene,

[0014] 5' intron and includes the 5' splice site;

[0015] The 3' intron and the 5' intron are two fragments obtained by splitting the type I intron, respectively. The 3' intron is a fragment containing the 3' end of the type I intron, and the 5' intron is a fragment containing the 5' end of the type I intron. The type I intron contains at least 9 paired double helical regions P1-P9 from the 5' end to the 3' end, wherein the splitting site is located in the non-complementary region or adjacent to the non-complementary region of the type I intron divided into the P9 region from the 5' end to the 3' end. In other words, the 3' intron contains at least part of the P9 region at the 3' end of the type I intron, and the 5' intron contains at least the P1-P8 region at the 5' end of the type I intron and another part of the P9 region.

[0016] wherein the distance between the adjacent non-complementary region of P9 and the 5' end or 3' end of the non-complementary region of P9 is 0-40 nucleotides; the type I intron is not modified or is optimized and modified;

[0017] The P9 is a general term for sub-regions such as P9.0, P9, P9a, P9.1, P9.2, and P9.1a.

[0018] In the present invention:

[0019] (1) Limitations on the split area:

[0020] Through the prediction analysis of the homologous structure of type I introns, it was found that type I introns have 10 structurally conserved paired double helix regions P1-P10 (from the 5' end to the 3' end), each of which may also contain subregions, and the splitting site is located in the loop region or adjacent to the loop region in the stem-loop structure of the paired double helix region or its subregion.

[0021] (2) Definitions of complementary and non-complementary regions:

[0022] Taking the Tetrahymena I type intron of the present invention as an example, the specific sites of the P1-P10 complementary region and the non-complementary region are shown in Figure 2-3 ( Figure 2-3 The P1-P10 sequence sites are marked in Figure 1). These domain divisions are conservative, and other group I introns can be predicted, and other group I intron complementary and non-complementary regions can be found.

[0023] (3) Regarding the splicing site:

[0024] It is well known to those skilled in the art that the 5' splice site and the 3' splice site are contained in the I-type intron itself (as shown in FIG. Figure 3 ), which is described in detail below.

[0025] Selection of 5' cleavage site - internal guiding sequence (IGS):

[0026] The recognition of substrates and the selection of cleavage sites by type I intron ribozymes are achieved through base pairing with the substrate. Of the two chains involved in the formation of P1, the 3' chain comes entirely from the intron, called the internal guide sequence (IGS). It pairs with the substrate sequence, and the formed P1 extends into the catalytic center of the ribozyme, exposing the phosphorus atom at the 5' cleavage site of the substrate chain to the vicinity of the nucleophilic group, resulting in site-specific internal cleavage of the RNA molecule. The exon base before the 5' cleavage site is usually U, and the intron IGS base paired with it is G. The U:G pairing they form is the characteristic base pair of the cleavage site. The U:G base pair at this position is conserved in all type I introns and plays an important role in cleavage.

[0027] Selection of 3' splicing site:

[0028] A short sequence close to IGS can form a pairing region called P10 with the 3' exon close to the splice site. Although P10 contributes to the positioning of the 3' splice site, the selection of the 3' splice site does not depend on the formation of P10. The last nucleotide of the 3' of the I-type intron is usually G, called ωG, and it has been confirmed that ωG is closely related to the selection of the 3' splice site.

[0029] In summary, in the embodiments of the present invention, preferably: the 3' intron includes a 3' splicing site and the target splicing site contains ωG, the 5' intron includes a 5' splicing site and the target splicing site and IGS have a U:G pairing. Of course, other sites that can achieve splicing can also be applied to the cyclization method of the present invention.

[0030] Further, the type I intron contains at least 10 paired double helix regions P1-P10 from the 5' end to the 3' end, and the splitting site is located in the non-complementary region or adjacent to the non-complementary region of the type I intron divided into the P9 region from the 5' end to the 3' end. In other words, the 3' intron contains at least part of the P9 region and the P10 region at the 3' end of the type I intron, and the 5' intron contains at least the P1-P8 region and part of the P9 region at the 5' end of the type I intron. That is, the present invention attempts to remove the P10 region of the type I intron, and finds that the above RNA construct can still achieve efficient cyclization.

[0031] Furthermore, the present invention found that compared with other split regions, the RNA construct formed by the 5' intron and 3' intron split in the P9 non-complementary region or adjacent to the P9 non-complementary region has the highest circularization efficiency when preparing circular RNA.

[0032] Furthermore, the sources of the type I introns include but are not limited to Tetrahymena, Anabaena, T4 bacteriophage, etc.

[0033] Furthermore, the transformation includes modification of the P1-P10 (or P1-P9) complementary region, and the modification includes one or more of addition, deletion, and mutation.

[0034] Furthermore, the transformation includes modification of the non-complementary region of P1-P10 (or P1-P9), and the modification includes one or more of addition, deletion, and mutation.

[0035] Furthermore, the RNA construct also contains an optimized sequence for promoting cyclization and expression. Preferably, the optimized sequence is selected from one or more of homology arms, spacer sequences, and UTR (Untranslated Region) sequences.

[0036] Preferably, at least one of the following is included:

[0037] (1) The homology arms include external homology arms and / or internal homology arms;

[0038] (2) The spacer sequence comprises a polyA sequence or a polyAC sequence.

[0039] Further, the homology arm is located on the extension arm of the complementary region of the type I intron P1-P10 (or P1-P9) before splitting, or is located at the 5' end or 3' end of the 3' intron or 5' intron after splitting. That is, when the homology arm is an external homology arm, in the RNA construct, the external homology arm is located at the 5' end of the 3' intron and / or the 3' end of the 5' intron; when the homology arm is an internal homology arm, in the RNA construct, the internal homology arm is located at the 3' end of the 3' intron and / or the 5' end of the 5' intron.

[0040] Preferably, the length of the homology arm is 10-1000 bp, more preferably 10-500 bp, most preferably 10-200 bp.

[0041] Furthermore, the spacer sequence is located before the IRES sequence (or CITE sequence) and / or after the GOI; the 5'UTR sequence is located before the IRES sequence (or CITE sequence), and the 3'UTR sequence is located after the GOI sequence.

[0042] Furthermore, in addition to the coding sequence of the target gene, the GOI region also contains a sequence for initiating translation. The sequence for initiating translation includes but is not limited to an IRES sequence (internal ribosome entry site), an m6A motif, a cap-independent translation enhancer (CITE) sequence, a kozak sequence, and the like.

[0043] Among them, the IRES sequence is a nucleotide sequence with the ability to initiate translation that is not dependent on the cap structure, and can recruit ribosomes to translate mRNA with the assistance of trans-acting factors. The kozak sequence is an important sequence for initiating translation in eukaryotes. It exists in the initiation region of mRNA translation. It guides the translation element to read mRNA and determine the correct start site, thereby ensuring the correct synthesis of protein. However, the commonly used internal ribosome entry site (Internal ribosome entry site, IRES) translation element sequence is long and contains multiple stop codons, so rolling circle translation cannot be achieved. Therefore, the present invention obtains a non-cap-dependent translation enhancer (CITE) element that can perform rolling circle translation and is compatible with base modification by screening new non-cap translation initiation elements. Unlike IRES, which directly recruits ribosomes to mediate translation, CITE mediates translation by binding to translation initiation factors (eIFs). On this basis, the present invention has developed a variety of new RNA technologies that can perform rolling circle translation, which significantly improves the expression level and half-life of proteins. Here, the present invention has developed a new "scarless" self-splicing ribozyme cyclization scheme to avoid the introduction of exogenous sequences to the greatest extent and reduce the impact of redundant sequences on polypeptide function.

[0044] Further, at least one of the following is included:

[0045] (a) The IRES sequence is derived from Simian V4, CVB3, CVB5, CVB1, HRV-A89, HRV-B3, SalivirusAGUT, EV107, CVA3, HRV-B37, EchoV11, HRV-C54, HRV-B4, EV-D94, HRV-B93, EV-J, SwineVesicular, CVA20, PV1, HRV-A1, Salivirus A SZ1, Salivirus FHB, EMCV-cf, HCV, Aichivirus, CrPV, Covid 19, Crohivirus B, EchoV-E11, Sapevirus or Phopivirus, etc.;

[0046] (b) The CITE sequence is derived from the 5'UTR or 3'UTR of viruses such as PMV, CarMV-PTE, CbMV, CCFV, CIRV, GaMV, HCRSV, HnRSV, MNeSV, MNSV, PLPV, PEMV2, PFBV, PSNV, RCNMV1, SCV, TBSV, TCV, TNV, BBV, BYDV, STNV, SCV, PEMV2, TPAV or STNV; or from the 5'UTR or 3'UTR of genes such as HIF-1α, FGF9, p53A or p53B in the Homo sapiens genome.

[0047] Furthermore, the coding sequence of the target gene in the RNA construct includes but is not limited to viral antigen sequences, tumor antigen sequences, monoclonal antibody sequences, bispecific antibody sequences, CAR sequences, cytokine sequences, coagulation factor sequences, growth factor sequences, gene editing enzyme sequences, fluorescent protein sequences, luciferase sequences, etc.

[0048] Furthermore, the RNA construct also contains elements necessary for expression such as a promoter, and of course, other elements can actually be added as required.

[0049] The second object of the present invention is to provide a circular RNA obtained by cyclizing the above-mentioned ribonucleic acid construct.

[0050] The third object of the present invention is to provide a method for preparing circular RNA, which is obtained by cyclizing the above-mentioned RNA construct. Specifically, in the absence of homology arm sequences and GTP addition, circular RNA can be efficiently prepared, with less exogenous sequences, low immunogenicity, and high expression in cells.

[0051] Furthermore, the plasmid containing the target gene was linearized, and circular RNA was obtained through in vitro transcription (IVT) technology, DNaseI treatment, and RNA purification. The circular RNA was further purified and enriched through different treatments (including RNase R, HPLC, and CIP) to prepare high-purity circular RNA.

[0052] Furthermore, the in vitro transcription time is at least 0.5 h, preferably 4-16 h.

[0053] Furthermore, the purified circular RNA was treated with RNase R, and electrophoresis was performed to observe whether the circularization was successful. Reverse transcription-PCR (RT-PCR) was performed on the purified circular RNA, and the target band was sequenced to confirm that the circular RNA was successfully prepared and the connection site was correct.

[0054] Furthermore, the purified circular RNA was transfected into 293T cells, and its high expression was detected by fluorescence microscopy and flow cytometry 24 hours later.

[0055] Furthermore, modified nucleotides are added during the preparation process, with the addition ratio being 0%-100%.

[0056] The fourth object of the present invention is to provide a recombinant cell containing a RNA construct or a circular RNA, wherein the host cell can be any eukaryotic cell or prokaryotic cell, and can be applied in the pharmaceutical field (preferably a human cell).

[0057] The fifth object of the present invention is to provide a method for preparing a protein or polypeptide using circular RNA, wherein the ribonucleic acid construct is prepared into circular RNA, and the circular RNA is introduced into a host cell to express the protein, wherein the target gene encodes the protein or polypeptide.

[0058] The sixth object of the present invention is to protect the use of the above-mentioned ribonucleic acid construct or circular RNA in the preparation of diagnostic products, preventive or therapeutic products.

[0059] A seventh object of the present invention is to prepare a drug containing a ribonucleic acid construct or a circular RNA, or a modification thereof (such as a recombinant cell, an expression vector carrying a sequence, etc.).

[0060] Furthermore, the drug is a vaccine, specifically, the vaccine contains the RNA construct or circular RNA, wherein the target gene is an antigen coding sequence. If the antigen is a B cell epitope or a T cell epitope, it is injected into the body to produce neutralizing antibodies and T cell immune responses, thereby achieving anti-infectious diseases and anti-tumor effects.

[0061] Furthermore, the vaccine also comprises a liposome delivery carrier.

[0062] Furthermore, the drug is a CAR immunotherapy drug, including a circular chimeric antigen receptor CAR molecule, that is, the target gene in the above-mentioned circular RNA is a CAR coding sequence. Specifically, the circular RNA molecule expressing the chimeric antigen receptor is injected into the body, targeted to the target site in the body, and the in situ immune cells in the body are engineered to achieve immunotherapy and resist tumors.

[0063] Furthermore, the CAR immunotherapy drug also contains a delivery vector with a targeting function. Specifically, the ribonucleic acid construct prepares a circular RNA drug, which enters the body through a delivery vector with a targeting function to produce in situ CAR, wherein the targeted immune cells include T cells, macrophages, natural killer cells, neutrophils, γδT cells, etc., and engineered immune cells are produced in situ, characterized in that an in vivo in situ immunotherapy drug for anti-tumor is prepared.

[0064] Furthermore, the drug can be used to treat a variety of diseases, especially diseases that can be improved by gene therapy, including but not limited to tumors (solid tumors or non-solid tumors), autoimmune diseases, etc. For example, the drug is an immunotherapy drug for autoimmune encephalomyelitis (EAE), including a circular antigen molecule, that is, the target gene in the circular RNA is the MOG35-55 short peptide coding sequence. Specifically, the circular RNA molecule expressing the antigen receptor is injected into the body, targeted to the target site in the body, and the in situ immune cells in the body are engineered to achieve immunotherapy.

[0065] In the embodiment of the present invention, in terms of vaccine application, the optimized "scarless" cyclization scheme is used to synthesize short-sequence circRNA, and the model antigen OVA antigen peptide is delivered by lipid nanoparticles (LNP). The rolling circle translation circular RNA vaccine encoding the OVA antigen peptide is analyzed. The immune activation effect in vivo is analyzed. Compared with linear mRNA, the circular RNA vaccine has better anti-tumor effect and T cell immune response. The present invention provides a new method for preparing anti-infectious disease and anti-tumor circular RNA vaccines that produce efficient T cell immune responses. In terms of antigen chimeric receptor (CAR) therapy, a method for engineering immune cells (including T cells, NK cells, macrophages, etc.) in vivo based on circular RNA "off-the-shelf" in vivo CAR is provided, and anti-tumor in vivo CAR immunotherapy drugs can be developed. In terms of immunotherapy, the present invention establishes an autoimmune encephalomyelitis (EAE) mouse model, and uses the cyclization scheme of the present invention to prepare circular RNA that can be rolled circle translated, and is used to treat autoimmune diseases.

[0066] Beneficial effects of the present invention:

[0067] 1) The present invention uses Tetrahymena type I introns, and can achieve a high cyclization rate without adding GTP, and can also achieve efficient cyclization for large-molecule RNA, which is easy to scale up and industrialize.

[0068] 2) Compared with other type I intron cyclizations, the present invention introduces fewer exogenous sequences, brings lower innate immunogenicity, reduces toxic side effects, and increases expression levels.

[0069] 3) Compared with other type I intron cyclizations, the present invention can achieve efficient preparation of circularized RNA without adding homology arms.

[0070] 4) The present invention splits the non-complementary region in the Tetrahymena type I intron and realizes the circularization of RNA based on the principle of self-splicing. This method can be extended to other type I introns to achieve effective circularization.

[0071] 5) The present invention realizes a new cyclization scheme for type I introns, which has great application in nucleic acid drugs (such as vaccines, in situ CAR, etc.), has high stability, and will not be integrated into the genome, thereby reducing the risk of carcinogenesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 Schematic diagram of the design of the circular RNA construct of the present invention.

[0073] Figure 2 The secondary structure of the Tetrahymena type I intron reconstructed by cryo-EM. The bold lines with arrows indicate base continuity; the lines with different symbols indicate different base pairing and stacking; the dashed lines indicate the hydrogen bonds in the P2-P4-P14 bridge.

[0074] Figure 3 This is the Tetrahymena type I intron gene sequence and the P1-P10 partition annotation.

[0075] Figure 4 The circular RNA connection site sequencing results. Circular RNA-EGFP was reverse transcribed into cDNA and subsequently amplified by PCR using specific primers. The PCR product was analyzed by Sanger sequencing, showing the precise connection mediated by the PICC system.

[0076] Figure 5 Fluorescence microscopy results of GFP expression in circular RNA generated by different circularization schemes 24 hours after HEK293T cells were transfected with circular RNA.

[0077] Figure 6 24 hours after HEK293T cells were transfected with circular RNA, the difference in GFP expression of circular RNA produced by PICC and STS-P1 circularization schemes was quantitatively analyzed by flow cytometry.

[0078] Figure 7Results of screening and immunogenicity testing of cap-independent translation enhancer (CITE) sequences after modification. (A) An overview of various translation initiation mechanisms, covering traditional cap-dependent and cap-independent strategies. The latter is further subdivided into IRES, m6A, and CITE-mediated methods; (BC) Analysis of the characteristics of 32 IRES and 30 CITE elements, including their sequence length and the number of stop codons in the frame (green), +1 frame (yellow), and +2 frame (blue); (D) HEK293T cells were transfected with equal amounts of RNA, and RNA expressed various engineered CITE structures. The proportion of EGFP-positive cells is shown on the left, and different structures are shown on the right; (E) HEK293T cells were transfected with equal amounts of RNA to evaluate the translational capacity of 31 CITEs and detect the proportion of EGFP-positive cells; ( F) HEK293T cells were transfected with equal amounts of RNA to evaluate the compatibility of different base modifications, including m1A, m6A, mo5U, 2-Thio-UTP, ψ and m5C, and the compatibility of different CITEs with these base modifications was detected; (G) In A549 cells, cells were transfected with equal amounts of RNA (encoding EGFP) to evaluate the compatibility of various CITEs with mo5U-modified bases; (H) The relative expression of innate immune genes (IFN-β, TNF-α, RIG-I, IL-6, RANTES) in A549 cells was measured by qRT-PCR 6 hours after transfection. The relative fold change was normalized by cells in the mock group; (I) Cell viability of A549 cells with equal amounts of mo5U-modified or unmodified RNA was measured 24 hours after transfection. Data are expressed as mean ± standard deviation (SD). Two-sided unpaired Student's t test was used for comparison. The following symbols indicate significance levels: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant.

[0079] Figure 8The comparison results of the cyclization scheme used in the present invention with other cyclization schemes and the results of the circular RNA rolling circle translation verification constructed based on the present invention. Among them, (A) schematic diagram shows the in vitro cyclization system of circular RNA. The top is the PIE system, in which the target RNA is produced from a DNA template by in vitro transcription (IVT) and cyclized by the rearranged Anabaena pre-tRNAI type intron autocatalytic splicing. In the middle is the STS system, in which the target RNA is produced by IVT and cyclized by the Tetrahymena I type intron autocatalytic splicing P1 splitting method. The bottom is the PICC system, in which the target RNA is produced by IVT and cyclized by the Tetrahymena I type intron autocatalytic splicing P9 splitting method. (B) The production of circRNA by three in vitro cyclization systems at different IVT reaction times was measured by urea-polyacrylamide gel (Urea-PAGE) denaturing electrophoresis. EGFP (C) Urea-PAGE electrophoresis was used to detect the generation of circRNA by three in vitro cyclization systems after GTP treatment. EGFP (D) Urea-PAGE electrophoresis was used to evaluate the circRNA generation by the PICC and PIE systems after RNase R treatment for 30 minutes. EGFP (E) Precise ligation mediated by the PICC system. Above, a schematic diagram showing the linear RNA precursor and circRNA EGFP The process of reverse transcription into cDNA and subsequent PCR amplification using specific primers (left), and the results of agarose gel electrophoresis analysis of PCR products (right). Below, the sequencing analysis results of PCR products. (F) Detection of circRNAs generated by the PICC system by adding external homology arms of different lengths by urea-polyacrylamide gel (Urea-PAGE) denaturing electrophoresis EGFP (G) Urea-PAGE denaturing electrophoresis was used to detect the circRNA produced by the PICC system by adding internal homology arms of different lengths. EGFP (H) Urea-PAGE electrophoresis was used to detect the production of circRNA by the PICC and PIE systems by adding internal and / or external homology arms. EGFPCircularization efficiency of the PICC system. (I) The circularization efficiency of the PICC system was evaluated by urea-polyacrylamide gel (Urea-PAGE) denaturing electrophoresis in the presence or absence of P10 (a structural component of type I intronic ribozymes) (lane 1, PICC-RNA construct; lane 2, PICC-RNA construct without P10 structure). (J) The circularization efficiency of precursor RNA containing CVB3 IRES and insertion sequences (including Gaussia luciferase (GLuc), human erythropoietin (hEpo), EGFP or Cre coding regions) was evaluated by urea-polyacrylamide gel (Urea-PAGE) denaturing electrophoresis. (K) The proportion of EGFP-positive cells in HEK293T cells transfected with EGFP-encoding circular RNA generated by the PICC and PIE systems was measured by flow cytometry. (L) Relative expression of immunogenicity-related genes (IFN-β, RIG-I, IL-6, IP-10, RANTES, and TNF-α) in A549 cells was measured by qRT-PCR within 6 hours after transfection with circRNA-Gluc and circRNA-POLR2A generated by the PICC and PIE systems. The relative fold changes were normalized by cells in the mock group. (M) Flag protein expression in HEK293T cells transfected with linear mRNA or circular RNA containing stop codons or P2A elements generated by the PICC system mediated by BBV or CVB3 sequences was detected by western blot. (N and O) The expression of 1×OVA and 3×OVA proteins encoded by PICC-circRNA-BBV with added internal or / and external homology arms was detected by western blot in HEK293T cells. Circular

[0080] Screening results of RNA-OVA-3×Flag-P2A (N), screening results of circular RNA-3xOVA-3×Flag-P2A (O). (P) HER2 protein expression in HEK293T cells of circular RNA produced by the PICC system with different lengths of 3×Flag sequences or internal or / and external homology arm sequences was measured by western blot. Data are presented as mean ± standard deviation (SD). The following symbols are used to indicate significance levels: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant.

[0081] Fig. 9The results of in vivo validation of the circular RNA rolling circle translation OVA antigen constructed by the present invention in mice. Among them, (A) OVA+CT26 tumor-inoculated mice received treatment including PBS and a series of RNA vaccines, which included mRNA encoding OVA257-264, mRNA encoding full-length OVA, circular RNA encoding OVA257-264 generated by the PIE system, and circular RNA encoding OVA257-264 generated by the PICC system. (B) Tumor growth curve of tumor-inoculated mice. Tumor volume was monitored every day 5 days after tumor inoculation. (C) Survival rate statistics of tumor-inoculated mice. Compared with the group expressing full-length OVA, mice receiving PICC-circRNA-OVA 257-264 Mice treated with OVA (expressed by rolling circle translation) had better survival rate. (D) OVA + CT26 tumor-inoculated mice received a range of interventions including PBS, modified mRNA encoding full-length OVA, and mRNA encoding OVA produced by the PICC system. 257-264 (E) Tumor growth curves of tumor-inoculated mice. Tumor volume was monitored from the first administration. (F) Survival statistics of tumor-inoculated mice. Compared with the N1mΨ modified mRNA group, mice receiving PICC-circRNA-OVA 257-264 The treated mice had a better survival rate. (G) Flow cytometry was used to detect CD45 in tumors. + Immune cell infiltration, tumor infiltration CD45 + CD8 + The proportion of T cells and tumor-infiltrating CD45 + The proportion of Treg cells in cells and the MHCII expression in tumor-associated macrophages + (H) The proportion of macrophages in cells receiving PBS, N1mΨ-mRNA-OVAFL or PICC-circRNA-OVA 257-264 H&E staining of tumor tissue sections from mice inoculated with CT26-OVA tumors treated with PBS or N1mΨ-mRNA-OVA FL or PICC-circRNA-OVA 257-264 CD8 +IHC staining of cells. Data are presented as mean ± standard error (SEM). In (B and E), tumor growth curves were calculated using two-way ANOVA analysis. In (C and F), survival curves were calculated using Kaplan-Meier survival analysis. In (G), comparisons were made using a two-sided Student's t test. The following symbols indicate significance levels: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, no significant difference. DETAILED DESCRIPTION

[0082] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0083] The sequences involved in the following embodiments are as follows:

[0084] (1) Sequences required to construct PICC-circRNA structure:

[0085] T7 promoter (SEQ ID NO.1):

[0086] TAATACGACTCACTATAGG

[0087] 3' intron (SEQ ID NO.2):

[0088] AAGTATATTGATTAGTTTTGGAGTACTCGTAAGGT

[0089] Kozak sequence (SEQ ID NO.3):

[0090] GCCACC

[0091] CVB3 IRES sequence (SEQ ID NO.4):

[0092] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA

[0093] GFP nucleotide sequence (SEQ ID NO.5):

[0094] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0095] 5' Intron (SEQ ID NO.6):

[0096] CTCTCTAAATAGCAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGA Tetrahymena group I intron (SEQ ID NO.7):

[0097] CTCTCT A 1 AATAGCAATATTTACCTTT GGAGGG AAAAGTTATCAGGCA TGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGA 384 A 385 AGTATATTGATTAGTTTTGGAGTACTC G TAAGGT

[0098] Tetrahymena group I intron without P10 (SEQ ID NO.8):

[0099] CTCTCT A 1 AATAGCAATATTTACCTTTGGAGGGAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGGAGGAAGTAAGTAGGCTGAGCTGA GGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACGATTTGATTGA 384 A 385 AGTATATTGATTAGTTTTGGAGTACTC G

[0100] (2) the PICC-circRNA interaction with CITE:

[0101] BBV(SEQ ID NO.9):

[0102] UGUUUAGGUUCGCUUUUUGUUUUUUUUUUCGAAAAC

[0103] BYDV(SEQ ID NO.10):

[0104] GUGAAGAUUGACCAUCUCACAAAGCUGUUACGUGCUUGUAACACACUACCUCUCGUUUUUUUUUCGAGAAGUAGUUGCAACAACGGUUCCCUCAUGCCUGACAAGCUGAGGGCCACCCUUCUAUCCCCACCCCCAUC

[0105] CarMV(SEQ ID NO.11):

[0106] AUGCAAGAGAAAAGUUUGGUAGACACACACGGCGGGACGUGUUGCUAGAGCUGCCACUCUGCCCGAGAUGGAUCGAUAUUAACCAUCUUUGGCAACAGCGUGUGUGAUCGACCAAACCUAGUAAUUGCGUAGCAUCCGACUGUAACCUGUUCUCUGCUGAAUGCGAGGGUGGCCUCGUGAUCCCAAACCAUAAAAGAAACCAACUUGUUGGUGGAAGGGCUUGGAAGUAGGAUCAACCACUGUUUAUUAAUUAGGGGUGAGAGUAUUCACUGUACUCUUUCCCCGCCC

[0107] CCFV(SEQ ID NO.12):

[0108] AGUAAGUAGCCUAACCUGCUGCAGCAGGAAGUAUUCUAGGUAGUAUAGUAACUCUUUCUUCAACUUCUUACUUAGAAAAACACAAAAAUACCCCCAGCUCGCUUUUGUUUUGAGCUGUGUUAGGGACCAAAAACGGCGACUCAUCCGUCCUGAGUGGCCUCUGGUGUGGAAACCAGAGAGUCUUGCGGUAACCAACGAAAUCUCUUCGGAGUGGGUGUUGGGGACCACCAAAUGAAGAAAAUAGCCCCUCCCUCGCGCAGGGGGGGGCCAGCCC

[0109] FGF9(SEQ ID NO.13):

[0110] UGAAACAGCAGAUUACUUUUAUUUAUGCAUUUAAUGGAUUGAAGAAAAGAACCUUUUUUUUCUCUCUCUCUCUGCAACUGCAGUAAGGGAGGGGAGUUGGAUAUACCUCGCCUAAUAUCUCCUGGGUUGACACCAUCAUUAUUGUUUAUUCUUGUGCUCCAAAAGCCGAGUCCUCUG

[0111] HCRSV(SEQ ID NO.14):

[0112] GUUUGUAUUGUAUGGGCCUCCGUGAAGUUAGGGGCAGUGGAAACGUCGGUCUAGCCAGCCGUCCCCUGGUAGUGUGCUCUGUCUAUGUACACCACUACUCGGUUUCCACAAACGAUCGGACUCCCAAUAUAGUGUACAUUA UGUUGAUUGCUUCUUUCUACCUAUAUAUAUAUCUCCUCUCAUCUCUCCUCUACGCUUGGAAUCCAUAAAAUCCUUCGGGUGGGCUUGGAUUUCGGGUACUUGUUUGAAAUUCCCUCACGACCGCCAUAGUUGUGAGGCAGCCC

[0113] HIF-α (SEQ ID NO.15):

[0114] GUGCUGCCUCGUCUGAGGGGACAGGAUCACCCUCUUCGUCGCUUCGGCCAGUGUGUCGGGCUGGGCCCUGACAAGCCACCUGAGGAGAGGCUCGGAGCCCGGGCCCGGACCCGGCGAUUGCCGCCCGCUUCUCUCUAGUCUCACGAGGGGUUUCCCGCCUCGCACCCCCACCUCUGGACUUGCCUUUCCUUCUUCUCGCGCGUGUGGAGGGAGCCAGCGCUUAGGCCGGAGCGAGCCUGGGGGCCGCCGCGUGAAGACAUCGCGGGACCGAUUCACC

[0115] P53A(SEQ ID NO.16):

[0116] UCUAGAGCCACCGUCCAGGGAGCAGGUAGCUGCUGGGCUCCGGGGACACUUUGCGUUCGGGCUGGGAGCGUGCUUUCCACGACGGUGACACGCUUCCCCUGGAUUGGCAGCCAGACUGCCUUCCGGGUCACUGCC

[0117] RCNMV(SEQ ID NO.17):

[0118] UUGGUUCUUUUAAGUGUAGCCUCCACCCGAGUUGCAAGAGGGGAACACGCAGUCUCGCCGACCCUGUUGGCAAACAGUAAAAUUGCAAAAAAUAGAGUGCUAGGAGUAGUUCCCGUACCCGCGGGAGCAAGACCCUACUACAGUAGACGAACCGGCAUCGGACCCUGGGAAACAGGUACCUAGCGUAUUAAUAGGUCGCUAGAAAUCGGGCGGGCUUCACCUUCGGGUAACCCGCCGUCGAGAGGGAAAACCUCUGUGUGGUUGUGCGCACGUCGUUGUCGGAAGACUCUCACUGUUGUAGUUAUUUCCUUUUUCUUUUAGGUAGGAGCACUUGCUCAGAGGGCGCAUACCUCUGGUAAAACAAAAUUGGCCCCUGAGAGUAGAAAACUCAGGUUAAUAAAACAGGAGAAUAUUUACCUAGUCGUAUAACGGCUAGGUACCCC

[0119] PCRPV(SEQ ID NO.18):

[0120] UUAUUUGUAUAUGUUAUGUAUAAUUAUAAUCAUGCAAUGGCACAUGUAGUUCCCCUAACCUCUCAGUAGGAGUCAAGCCCUGAUGCGCCAACAUCCAGAAGGGGGUAAAGCUGAGUCGGUGCAAGGAACCUUGUUAGCCCUAAGAAAAACCCAAAAACAGAGUGCAUAGUUUAGCUUUUGUGUUGUAGGAGCCAGAGACCAAAGAUCCAGACAACUGGUGAGGGCGGUCGAUGGUGCGAAGUAAAUUAGAAAGGGGGGCGUUUACCCACGUCCUCCCUUGCCC

[0121] PMV(SEQ ID NO.19):

[0122] ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGACAUGACACCUUUGAGACAGACCGUACAGCAGUCACACGGGACGCCACACCACCUUUGCAGAGGUGCCCUUGGGAAACCAAUGGUGUGGGGUGACACUGAUUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCCUCACCAGGCCCCbMV(SEQ ID NO.20):

[0123] ACACUAAGAGUUACUGCCACCAAAAGAGGAUAAUCAGACCACUUGUAGUUUGCUGCCACAAACUGGUUGACAAGUUAAUGCCUCUCUCUUAGUUAGUAAGCCGGAUUCAAGUAGGGAAUGUGGAGGGAGAUGCCAUGGUGGCAUCAGAGCAGACCUGGAAAUACUCUUCGGAGGGGCGCCAGAACUGCACUAAACACUUGUUAUCAGGGGACUGUUGAGGAGUCUCCCCGCCCG

[0124] CIRV(SEQ ID NO.21):

[0125] GUUCGCUGAAACGAGUGUAAAUCUGGCAUAGCAUACAGGUUACUCUUGUUGGGUUCUAGAUGUUAUGAUGACGAGUCGGUUCGGGCUCCGCACUAGGUUUGGUCACCUAGGGGAUGGAGAUAUGGAAAGGGUCUCGUGUGCUGUUAGACGGUCGUAAGACGCGCUUGCAACAUGGGCCUAUGACCGGAUAAGUCAUAGCAAUACUAGCCAACAUGAAUAGGAUUCCUGUUUACGAAAGUUAGAUGUCACUUGUGGAAACGGACCCAGACACGGUUGAUCUCACCUUCGGGGGGGCUAUAGAGAUCGCUGGAAGCACUACCGGACAACCGGAACAUUGCAGAAAUGCAGCCC

[0126] GaMV-PTE(SEQ ID NO.22):

[0127] AGGAAGAUGCUUGGGGGUGUUCCCCUAAAGUUCAGAAUGGUCUAUCAGGGAGCAGGCACUUUUCCGGCUUUGGCGAGUCGUCUCCACUUGUAUACGAACAGUGAGGGGAAAAGUUAUCUGAUAGAAGAAUGAACCAUGGACAAGGACACUCUAAACCACCACUAAGAAGCUAUAGGGAAACCUUGCUGAGGGCAGUGAGUGGUCGUACCAGAACGAAUAUGGCUUUGCCCCGCCC

[0128] HnRSV(SEQ ID NO.23):

[0129] ACGGGAUGAGCUUCUGGGGGCUGCCACCCUCGCCUCAUGCGCAUUGCCUGCUCUGGGCGCAUGUGGAAGCUGAUAUAGUUGAGAGCUUCGUGGAAGGAUGUGGAAACCAAGGGAGGGAGAUAUCCAGGGAGGAUGUCGGAGUUGUAAGGAUAAAAUACCUAAGCUUCAUCAGGUUAGGUUGGGCUUCCGAUGCAACAAAACACCAGUAGAUAAAUAGGGGGGGAUCCAGGGGAUCCUUCUCCGCCC

[0130] MNeSV(SEQ ID NO.24):

[0131] GACAAACUCUCCGCCUAAUGUCUGAUGAUGUGAGGAACGUGGACUGUGAUGUGGUGGUGCGGUACCAUGGCUGGUCACCAUGGUAAUGCGUAGGGCAACACAGUUCAUUAAGACUCACUGAUGAUGGCACUAGGCACGGUUCACCCCCAUCCUUCGGGAGGGCUAUAGGGGGUGACCGGGUUACACCACCGGAAGACCGGAACAUUGCCUUUGGGCAGCCC

[0132] MNSV(SEQ ID NO.25):

[0133] AUCUCGCCUUAGGUUUACGGUUACCCGAGCUUCGCCUGAAACGGCGUUCCUCUAAUUCCUUCCUGGUUCUUUCCCUCCACGGCUCGCGUGUUCUGCGGAACUGCAUCUGCUUCACUUCCUUCUUUUUCCCUCUGUGGUGGUACGACCAAUGGGUGGCUCCCAUUGACUGCGUAGGACAUGGAAAAAGAUUGAGUGGAGUGCACGAAGCGUCGCAAGAUCGCUGCCUGACGAGGUCCAGCCAAUCAAAUACCAAACAUCUGGUUUGGGGGCGGAUUGGCUGUAUGUCAUGUAAGUUUGAGGGGUUCUAUCGGAGCCCCCCGCCC

[0134] PLPV(SEQ ID NO.26):

[0135] GGAAAGCCACUGCGGUGGGGUCAGUCUCCUGGUGCGCCAACACCCAGAAGGGGAGACAACUUCAGUGGUUCAAAACCCGAUGCUUCGUGUAAGCCUAGAAAAAUCCAAAAACAGAGUGCUACUGCUUUCAGUGUGCGAGCUUUAUUUGCUCACUUCCUCCGUCGAUAAAAUCCCGAAUUUUCGGGUGGGCUUCGGCGGACAUCCUUAAUGAAGAACGGGGGGGUAACCCACCCCCCUGAUCUGCCC

[0136] PEMV2(SEQ ID NO.27):

[0137] GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGACCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGCUGGUUACAGUAGGAGGGGACAGUGCGCAUCAAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUAUCUCCCUGCGACGUAGUGGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGGUUAUCGGUCCCCUGCUCCUUCGAGCUGGCAAGGCGCCCAAAGGUUCUACACUGCUACUAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGUCCCUUUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCUCAGUGUCUUGGUUGUCUGCCAAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUUGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCCCUUUCUUAGCCAGGGUGGUUACCUCCCUGGCGCCC

[0138] PFBV(SEQ ID NO.28):

[0139] GAGGGCAGUCACCCUACCUUCUGCCAGAGGUUCCCGGAGGAGUGAGUGUAUCUUGGGGGUGAUCAUAGCUAGGAAAAGGUCGGAGAGUUGGGAGGAGGCCAACUGGGGGAGGUGCUAGGAGCACCAGAUGCAGCAGGAGCAAAAUCCGGUUUCACGCCUGGUGCGCGCUCAAUGCUGCUAACACGUUCCUGAAGGAAGGAAAGGUUUCGGUCGAUGGAGACCUUAACCCGCCC

[0140] PSNV(SEQ ID NO.29):

[0141] CAAUAUGCACGAGCUGUCUUGUAACACAGCAAUGGAGUAGGUUACUCUGGUAGCAAUGGGUGGGUGUGGAUCGAUUUCCUACGUUAGCUUGCUCUCUCGUAGUGGGGAAAUAACUCAUUGAGACCAGCCUCAGAACCGUCAGAUUGUCUGGUUUUGGAAUAGAGGGCUUGGGAAAACUCCGUAAGGAGGGCGCCCGAGAGCCUAGUACCUAGCAAAUUUAUAAAACUAAGGGGGGACCGUUAAGGUCUCCCCCCGCC

[0142] TBSV-YSS(SEQ ID NO.30):

[0143] GUUUGUGGAGUUGUAAAAUCUGGCAUAGCAUACAGGUUACUCUUGUGGUUCUGGAUGUAGGAUGAGACGAGUCGACUCGGGCUCCGCACUAGGUUUGGUGCCCUAGGGAGAUAUGGGAAAGGGUCUCGUGUGGUAUCAGUCGGUCGAAAGACGCGCUUCCAACAAUGGGCCUAUGGUGCGGAUAAGUCUUAGCAAUACCAGCCAUGAAUUGGAUUCCUGUUUACGGAAAGUAGGUCACUUGUGGAAGCGGACCCACACGGUUGUAUCCACCCUUCGGGGCUAUUAGAGAAUCGCGGAAGCACUACCGGACAACCGGAACAUUGCAGAAAUGCAGCCC

[0144] TCV-TSS(SEQ ID NO.31):

[0145] UACGGUAAUAGUGGGGGCAGCACUG UCUAGCUGCGGGCAUUAGCCUGGAAACUAGUGCUCUGGUAACCACUAAAAUCCCGAAAGGGUGGCUUUGGGACCCUCCGAACCAAUAGCCUCCCCUCGGACGGGGGGCCUGCCC

[0146] TNV-D(SEQ ID NO.32):

[0147] US UCAACGGGCUCACUGGUGGUGGCCGUCUCCACUCACUGUGGUGGUGAAUUGGUUGUGAUAAGCCUCCUGACAUGGCUCCAUGCAUGGGGGGUCCAGGUCCAUUUUUWAWATER

[0148] STNV(SEQ ID NO.33):

[0149] ACCAUGGUCAUGAUGAUAGUGAAGCGCUGAAAGAUGCWAACCCUCCUGGUGCACUUCCUGGUCAAGCAGAACCAAGGGUACGGUGGUAGGCGGACAGUAGCUGAA

[0150] P53BN(SEQ ID NO.34):

[0151] AUGGAGGAGCCGCAGUCAGAUCCUAGCGUCGAGCCCCCUCUGAGUCAGGAAACAUUUUCAGACCUAUGGAAACUACUUCCUGAAAACAACGUUCUGUCCCCCUUGCCGUCCCAAGCA

[0152] SCV(PTE-TSS)(SEQ ID NO.35):

[0153] GUUGCUCGACUGUGAGGGGACCUACCCACUGUGCUGCCACACAGGAACUUCCAACCUUCGGGUGGCGAGGUAGGGCAGAAGAGUGACUGAACGAGGAUGGUGUAGAGCAAUGGAUGGGGGGGGAGUCCAUGGUGGGCUCCGGCGCGACGAUGCUAAAAUCUCCAUAUCAUGUGUGGAGUGGGCUGCUUAGUCGCUUAUUAGUUGAAAAUUAGGGGGGUCCUUAGGGACCUCUCCCGCCC

[0154] SCV(PTE)(SEQ ID NO.36):

[0155] GUUGCUCGACUGUGAGGGGACCUACCCACUGUGCUGCCACACAGGAACUUCCAACCUUCGGGUGGCGAGGUAGGGCAGAAGAGUGAC

[0156] PEMV2(PTE)(SEQ ID NO.37):

[0157] GGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGGUUAUCGGUCCCCUGCUCCUUCGAGCUGGCAAGGCGCCCAAAGGUUCUAC

[0158] TPAV(SEQ ID NO.38):

[0159] ACUCGCUCAGAGUCAUCCUAGGCUAGGACCGGCCAGACAAAGGUCCGACACUACAUGCAGCGCUCUAGGUGUAGUGACAGUAAGCGCGCUCUAUCCGAAACUCCAGUGACAGGACAAGACCCCAGGCGGGACGCCACACCCAUGUUUGCAGACAUGGCCCG AGGAAACUCUGGUGUGGGCUGGGGGGAAUCCUAUGAUCACUGGACGGAAGGUAGAGAGUUCCAGCACAACCCCUUUAGGUGGGCCGUAAGUGCGUGGGAACAUUUCCUACAGUCUCACUGAGAAGAUUGGACGGGGUACCAUGAGUACCCCUCACCAGGCCC

[0160] (3) External homology arm sequences involved in structure optimization:

[0161] 20 bp 5' external homology arm (SEQ ID NO.39):

[0162] CCGTCGATTGTCCACTGGTC

[0163] 20 bp 3' external homology arm (SEQ ID NO.40):

[0164] GACCAGTGGACAATCGACGG

[0165] 35 bp 5' external homology arm (SEQ ID NO.41):

[0166] GCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0167] 35 bp 3' external homology arm (SEQ ID NO.42):

[0168] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGC

[0169] 70 bp 5' external homology arm (SEQ ID NO.43):

[0170] CGTACTGCTAGCTCGCTGCCATCGATGCTGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0171] 70 bp 3' external homology arm (SEQ ID NO.44):

[0172] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCATCGATGGCAGCGAGCTAGCAGTACG

[0173] 105 bp 5' external homology arm (SEQ ID NO.45):

[0174] CGAATGCGATGCTAGTCGTAGCTAGTCCGATGATGCGTACTGCTAGCTCGCTGCCATCGATGCTGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0175] 105 bp 3' external homology arm (SEQ ID NO.46):

[0176] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCATCGATGGCAGCGAGCTAGCAGTACGCATCGGACTAGCTACGACTAGCATCGCATTCG

[0177] 140 bp 5' external homology arm (SEQ ID NO.47):

[0178] CGCTGATGCTGATCGTAGCTGGATGCTAGTCGTAGCGAATGCGATGCTAGTCGTAGCTAGTCCGATGATGCGTACTGCTAGCTCGCTGCCATCGATGCTGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0179] 140 bp 3' external homology arm (SEQ ID NO.48):

[0180] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCATCGATGGCAGCGAGCTAGCAGTACGCATCGGACTAGCTACGACTAGCATCGCATTCGCTACGACTAGCATCCAGCTACGATCAGCATCAGCG

[0181] (4) Internal homology arm sequences involved in structure optimization:

[0182] 10 bp 5' internal homology arm (SEQ ID NO.49):

[0183] TCCACTGGTC

[0184] 10 bp 3' internal homology arm (SEQ ID NO.50):

[0185] GACCAGTGGA

[0186] 20 bp 5' internal homology arm (SEQ ID NO.51):

[0187] CCGTCGATTGTCCACTGGTC

[0188] 20 bp 3' internal homology arm (SEQ ID NO.52):

[0189] GACCAGTGGACAATCGACGG

[0190] 35 bp 5' internal homology arm (SEQ ID NO.53):

[0191] GCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0192] 35 bp 3' internal homology arm (SEQ ID NO.54):

[0193] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGC

[0194] 70 bp 5' internal homology arm (SEQ ID NO.55):

[0195] CGTACTGCTAGCTCGCTGCCATCGATGCTGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0196] 70 bp 3' internal homology arm (SEQ ID NO.56):

[0197] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCATCGATGGCAGCGAGCTAGCAGTACG

[0198] 100 bp 5' internal homology arm (SEQ ID NO.57):

[0199] aatgataccgtaggagctcatgcggatataCGTACTGCTAGCTCGCTGCCATCGATGC TGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0200] 100 bp 3’ internal homology arm (SEQ ID NO.58):

[0201] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCAT CGATGGCAGCGAGCTAGCAGTACGtatatccgcatgagctcctacggtatcatt

[0202] 150 bp 5’ internal homology arm (SEQ ID NO.59):

[0203] agccaagcagtattcatcctgtacacaattccgataactatccctgatggaatgataccgtaggagctcatgcggatataCGTACTGCTAGCTCGCTGCCATCGATGCTGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0204] 150 bp 3’ internal homology arm (SEQ ID NO.60):

[0205] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCATCGATGGCAGCGAGCTAGCAGTACGtatatccgcatgagctcctacggtatcattccatcagggatagttatcggaattgtgtacaggatgaatactgcttggct

[0206] 200 bp 5’ internal homology arm (SEQ ID NO.61):

[0207] aggacgactctggagtacatcttaggcggagaaccgtgatacacaatggaagccaagcagtattcatcctgtacacaattccgataactatccctgatggaatgataccgtaggagctcatgcggatataCGTACTGCTAGCTCGCTGCCATCGATGCTGATGAGGCACTGGCTGACAGACCGTCGATTGTCCACTGGTC

[0208] 200 bp 3' internal homology arm (SEQ ID NO.62):

[0209] GACCAGTGGACAATCGACGGTCTGTCAGCCAGTGCCTCATCAGCATCGATGGCAGCGAGCTAGCAGTACGtatatccgcatgagctcctacggtatcattccatcagggatagttatcggaattgtgtacaggatgaatactgcttggcttccattgtgtatcacggttctccgcctaagatgtactccagagtcgtcct

[0210] Example 1 Design of circular RNA construct

[0211] Design and construction of PICC-circRNA structure: including T7 promoter (SEQ ID NO.1), 3' intron (SEQ ID NO.2, i.e. P9-P10), GOI (5' to 3' direction includes: kozak sequence shown in SEQ ID NO.3, IRES sequence shown in SEQ ID NO.4, EGFP sequence shown in SEQ ID NO.5), 5' intron (SEQ ID NO.6, i.e. P1-P9). Construction diagram is shown in Figure 1 .

[0212] Among them, the secondary structure of type I introns is highly conservative. The present invention selects type I introns from Tetrahymena, which contains several characteristic pairing regions. These pairing regions form different helical structures according to the principle of base complementary pairing. These structures are named P1 to P10 from the 5' to 3' direction. At the same time, different large helical structures are also divided into some small helical sub-regions, such as P2 includes the P2 and P2.1 regions shown in the figure, P5 includes the P5, P5a, P5b regions shown in the figure, and so on. The 3' intron and 5' intron described in the present invention are two fragments that the type I intron is split into at the non-complementary region of P9, wherein the fragment containing the 3' splice site is the 3' intron, and the fragment containing the 5' splice site is the 5' intron (see the schematic diagram of the structure). Figure 1-3 ).

[0213] Example 2 Preparation and preliminary identification of circular RNA

[0214] (1) The plasmid containing the GFP encoding construct in Example 1 was linearized, and circular RNA was obtained by in vitro transcription (IVT) technology, DNase I treatment, and purification. The circular RNA was subjected to reverse transcription-PCR (RT-PCR), and the cDNA product was further identified by PCR to further confirm that it was circular RNA. The target band was sequenced, and the results showed that the circular RNA was successfully prepared and the ligation site was correct (results are shown in Figure 4 ).

[0215] Will verify the correct circular RNA GFP After transfection into HEK293T cells, the expression of GFP was observed under a fluorescence microscope 24 hours later. The results showed that the circular RNA formed by the PICC-P9 splitting method had a higher GFP expression effect than that formed by the P1 splitting method (see the results). Figure 5 ), and the flow cytometry results further confirmed this result (see Figure 6 ). PICC represents the splitting of the non-complementary region of P9 in Example 1, STS-P1 represents the splitting of the P1 region, and the specific splitting site is the 6th to 7th bases of the sequence shown in SEQ ID NO.7.

[0216] (2) This invention analyzes common translation patterns ( Figure 7 A), and compared the sequence length and number of stop codons of IRES and CITE sequences, and found that IRES sequences are generally too long and contain more stop codons ( Figure 7 B), while CITE sequences are generally shorter and contain fewer stop codons ( Figure 7C). The translation efficiency can be improved by adding a stem-loop structure after the CITE sequence ( Figure 7 D), the present invention therefore screened the translation ability of CITE sequences ( Figure 7 E), in particular, the present invention found that CITE sequences are compatible with different base modifications ( Figure 7 F). Moreover, translation can also be performed in A549 cells ( Figure 7 G) and reduce immunogenicity ( Figure 7 H) and increase cell viability ( Figure 7 I). Therefore, BBV was used to construct PICC, that is, the optimized PICC-circRNA structure included T7 promoter (SEQ ID NO.1), 3' intron (SEQ ID NO.2, i.e., P9-P10), GOI (from 5' to 3' direction, including: kozak sequence shown in SEQ ID NO.3, BBV sequence shown in SEQ ID NO.9, EGFP sequence shown in SEQ ID NO.5), and 5' intron (SEQ ID NO.6, i.e., P1-P9).

[0217] Of course, the present invention provides a universal method for preparing circularized RNA. The same effect can be achieved by selecting type I introns from other species such as Anabaena and T4 bacteriophage, that is, selecting and splitting the non-complementary region of type I intron P9, adding the RNA sequence to be circularized, and achieving high-efficiency circularization. The difference between the "scarless" circular RNA produced by the present invention and other circularization schemes based on type I introns is shown in Figure 8 A.

[0218] Example 3 Validation of circular RNA cyclization and improvement of circularization efficiency of the present invention

[0219] The plasmid containing the GFP encoding constructed in Example 1 was linearized, and the in vitro transcription (IVT) time was set to 0.5h, 2h, 4h and 16h, and circular RNA was obtained after DNase I treatment and purification. The results show that the circularization scheme of the present invention has a high splicing circularization efficiency (see the results). Figure 8 B). The subsequent in vitro transcription time was 16 h.

[0220] In particular, after 16 h IVT, the product was treated with GTP to demonstrate that the present invention can have a high cyclization efficiency without additional GTP treatment (results see Figure 8C). As can be seen from the figure, the cyclization efficiency of the PICC group is significantly higher than that of the STS-P1 group, which is 27.5 times that of the STS-P1 group. This may be due to the unique splitting method of the present invention which greatly improves the cyclization efficiency.

[0221] The purified circular RNA product was further treated with RNase R, and the circular RNA before and after treatment was identified by urea PAGE gel. It was found that the circular RNA band was significantly enriched and the linear RNA band was degraded (see the results). Figure 8 D). Further, the circular RNA was subjected to reverse transcription-PCR (RT-PCR), and the cDNA product was subjected to PCR identification to further confirm that it was circular RNA, and the target band was sequenced. The results showed that the circular RNA was successfully prepared and the connection site was correct (results are shown in Figure 8 E).

[0222] Example 4: Adding homology arms to optimize and improve circularization efficiency

[0223] (1) Add external homology arms

[0224] Design and construction of PICC-circRNA structures with different lengths of external homology arms: including T7 promoter, 5' external homology arm, 3' intron, GOI, 5' intron and 3' external homology arm. "Different lengths" refer to 5' external homology arms and 3' external homology arms of 20 bp, 35 bp, 70 bp, 105 bp and 140 bp (SEQ ID NO. 39-48).

[0225] The plasmids containing the above homology arms with different lengths encoding GFP were linearized, and circular RNA was obtained by in vitro transcription (IVT) technology, DNase I treatment, and purification. The circularization efficiency of the obtained circular RNA was identified by urea PAGE gel (see the results). Figure 8 F). It can be seen that the circularization efficiency is slightly improved when homology arms of different lengths are added compared to when no homology arms are added.

[0226] (2) Add internal homology arms

[0227] Design and construction of circRNA-PICC structures with different lengths of internal homology arms: including T7 promoter, 3' intron, 5' internal homology arm, GOI, 3' internal homology arm and 5' intron. "Different lengths" refer to 5' internal homology arms and 3' internal homology arms of 10 bp, 20 bp, 35 bp, 70 bp, 100 bp, 150 bp and 200 bp (SEQ ID NO. 49-62).

[0228] The plasmids containing the above homology arms with different lengths encoding GFP were linearized, and circular RNA was obtained by in vitro transcription (IVT) technology, DNase I treatment, and purification. The circularization efficiency of the obtained circular RNA was identified by urea PAGE gel (see the results). Figure 8 G). It can be seen that different lengths of homology arms affect the cyclization efficiency, but the cyclization efficiency is improved compared to when no homology arms are added. In particular, the cyclization scheme used in the present invention has a high cyclization efficiency without adding homology arms, but the PIE method does not (results are shown in Figure 8 H).

[0229] Example 5 Group I intron lacks P10 structure and can be cyclized

[0230] Design and construction of PICC-circRNA structure: including T7 promoter, 3' intron, GOI, 5' intron. The 3' intron does not contain the P10 structure of the Group I intron used (i.e., obtained by splitting the sequence shown in SEQ ID NO.8, with the splitting site and others being the same as in Example 1).

[0231] The plasmid encoding GFP was linearized, and circular RNA was obtained by in vitro transcription (IVT), DNase I treatment, and purification. Circular RNA was identified by urea PAGE gel, and the results showed that Group I introns lacking the P10 structure could also be cyclized (see the results). Figure 8 I, although the cyclization efficiency is 68.4% of the original, this design can completely avoid the residue of Group I intron sequence, and will not introduce any exogenous sequence into the prepared circular RNA, further reducing the potential impact of the residual sequence of Group I intron on the circular RNA structure and reducing the immunogenicity of circular RNA).

[0232] Example 6 The present invention has universal applicability to different gene cyclizations

[0233] The plasmid containing GFP, human erythropoietin (hEPO), luciferase (Gaussia luciferase), and Cre-recombinase (Cre) was linearized, and circular RNA was obtained by in vitro transcription (IVT) technology, DNase I treatment, and purification. Circular RNA was enriched by RNase R treatment and identified by urea PAGE gel. The results showed that the present invention can efficiently circularize RNA of different lengths and has universal applicability (see the results). Figure 8 J).

[0234] The circRNA encoding GFP was transfected into 293T cells, and the protein expression levels of different genes were detected after 24 hours. The results showed that PICC can efficiently express different proteins (see the results). Figure 8 K).

[0235] The PICCs used above are all those constructed in Example 1.

[0236] Example 7 The circular RNA of the present invention has low immunogenicity

[0237] The circRNA containing CVB3 IRES and Gaussia luciferase sequences and the circRNA of POLR2A were transfected into A549 cells. After 6 hours, the cell RNA was extracted and reverse transcribed to obtain cDNA. The expression level of immunogenicity-related cytokines was identified by fluorescence quantitative PCR. The results showed that the immunogenic response of A549 cells induced by the circular RNA produced by the present invention had sequence correlation (see the results). Figure 8 L).

[0238] Example 8 Validation of rolling circle translation based on the cyclization scheme of the present invention

[0239] The coding sequence of the circular RNA construct in Example 2 (2) was changed to 3×FLAG-P2A, and the BBV sequence was used to initiate translation. The ORF encoding the ORF without a stop codon was used, and P2A was used to separate the protein polymers produced by rolling circle translation into functional protein monomers. The circular RNA with ORF of 3×FLAG was transfected into 293T cells, and the cell lysate was subjected to immunoblot analysis 24 hours later. Among the five circular RNAs evaluated, only circRNA-BBV-3×FLAG-P2A could undergo rolling circle translation (see the results). Figure 8 M) The coding sequence of the circular RNA construct in Example 1 was changed to OVA 257-264(SIINFEKL) antigen, preparation of circular RNA, and sequence screening (results see Figure 8 N and 8O). Similarly, HER2 molecules were screened and it was found that only the 3×FLAG sequence could produce related protein expression (see the results). Figure 8 P). One interesting phenomenon is that the present invention found that linear mRNA seems to have a weak ability to translate short peptides. After the linear mRNA encoding 3×FLAG generated in vitro was transfected into 293T cells, the expression of the target protein was not detected by western blot.

[0240] Example 9 Preparation of circular RNA vaccine

[0241] The coding sequence of the circular RNA construct in Example 1 was changed to RBD antigen to prepare circular RNA vaccine. First, 293T cells were transfected and the expression of antigen was verified by WB. Then BALB / c-nu / nu mice (15 μg / only) were injected by LNP delivery system, and 1 time was administered in 0 week and 2 weeks respectively. After the 4th week, innate immunogenicity (including MCP-1, IL-6, IP-10, TNF-α, IFN-α, RANTES), humoral immunity level (including binding antibody and neutralizing antibody) and cellular immunity level (related cytokine detection such as IL-4, IL-6, IFN-γ, TNF-α, IL-2) were detected, as well as the ability to prevent infection under the attack model. The results show that the vaccine preparation is efficient, with high humoral immunity and cellular immunity levels, and strong ability to prevent infection.

[0242] Example 10 Preparation of circular RNA tumor vaccine

[0243] The highly efficient encoding OVA screened in Example 8 257-264 The circular RNA construct of SIINFEKL antigen was prepared as a circular RNA vaccine. It was injected into immune normal BALB / c mice bearing CT26 subcutaneous colorectal cancer expressing chicken ovalbumin antigen (OVA) via LNP delivery system (results are shown in Fig. 9 A) When the CT26-OVA tumor volume reached about 60 mm 3 The mice were randomly divided into groups and immunized with PBS, 12 μg of in vitro transcribed full-length OVA antigen (mRNA-OVA FL ) mRNA encapsulated in LNP, 12 μg in vitro transcribed OVA 257-264 Antigen (mRNA-OVA 257-264 ) mRNA encapsulated LNP, 12 μg of OVA produced by PIE strategy 257-264 Peptide circRNA (PIE-circRNA-OVA257-264 ) encapsulated LNP, or 12 μg of PICC-circRNA-OVA 257-264 The mice were encapsulated with LNP and immunized three times with an interval of 3 days. The tumor volume of the treated mice was then monitored (see the results in Fig. 9 A) The results showed that compared with the PBS group, PICC-OVA 257-264 Significantly inhibited CT26 tumor growth and was significantly superior to the other three RNA vaccine groups, including PIE-circRNA-OVA 257-264 , mRNA-OVA 257-26 4 and mRNA-OVA FL ( Fig. 9 B). PICC-circRNA-OVA 257-264 The group also significantly prolonged the survival time of tumor mice, compared with PBS and PIE-circRNA-OVA 257-264 , mRNA-OVA 257-264 and mRNA-OVA FL Group( Fig. 9 C), indicating that rolling circle translation-compatible PICC-circRNA has the potential to serve as a novel cancer vaccine.

[0244] Next, the present invention compared PICC-circRNA with N1mΨ-modified mRNA (N1mΨ-mRNA) (results are shown in Fig. 9 D). Similarly, BALB / c mice bearing subcutaneous CT26-OVA colorectal cancer were injected intramuscularly with PBS, 15 μg of LNP-encapsulated N1mΨ-mRNA-OVA FL or 15 μg LNP-encapsulated PICC-circRNA-OVA 257-264 , and monitored the tumor volume of treated mice (see Figure 8 D) The results showed that compared with PBS or N1mΨ-mRNA-OVA FL Compared with the PICC-circRNA-OVA group 257-264 It can effectively inhibit tumor growth and prolong the survival time of tumor mice (see the results in Fig. 9 E and 9F). At the end of the experiment, the PICC-circRNA-OVA injected 257-264 or N1mΨ-mRNA-OVA FL The tumor tissues of mice treated with the vaccine were analyzed by flow cytometry to detect the infiltration of immune cells. The results showed that PICC-circRNA-OVA 257-264 Vaccines promote CD45 + Infiltration of immune cells in the tumor microenvironment, including CD8 +The proportion of T cells increased significantly, while the proportion of immunosuppressive Treg cells decreased. In addition, we also found that PICC-circRNA-OVA 257-264 Vaccine immunization can increase the proportion of proinflammatory cells, indicating that PICC-circRNA-OVA 257-264 The vaccine was able to reshape the tumor microenvironment in mouse models into a pro-inflammatory state ( Fig. 9 G).

[0245] In addition, we collected tumor tissue samples from treated mice and performed hematoxylin-eosin (H&E) staining and immunohistochemistry (IHC) staining. H&E staining results showed that PICC-circRNA-OVA 257-264 The treated groups showed a significant increase in tumor cell death, while PBS or N1mΨ-mRNA-OVA FL The group showed diffuse growth and dense arrangement in CT26-OVA colorectal cancer mice ( Fig. 9 H) IHC staining results showed that PICC-circRNA-OVA 257-264 CD8 + The infiltration of T cells was significantly higher than that of PBS or N1mΨ-mRNA-OVA FL Group infiltration in CT26-OVA colorectal cancer mice ( Fig. 9 I).

[0246] Example 11 Preparation of circular RNA CAR-M / T

[0247] The coding sequence of the circRNA construct in Example 1 was changed to the HER2-CAR molecule, and circular RNA was prepared. First, the circRNA HER2-CAR After transfection of Jurkat, THP-1 and J774A.1 cells, the prepared CAR-T / M cells were co-incubated with SK-OV-3-LUC and MC38-HER2-LUC cells at different effector-target ratios (effector cells: tumor cells = E:T, 0.25:1, 1:1, 4:1, 16:1), and the killing effect of CAR-T / M cells on tumor cells was detected by luciferase. HER2-CAR The cells were injected subcutaneously into C57BL / 6 mice bearing tumors (SK-OV-3-LUC, MC38-LUC-HER2 cells, 1×10 6 cells / 100μL), and wait until the tumor volume reaches 100mm 3 LNP-circRNA was injected intravenously and at multiple points into the tumor. HER2-CARThe drug was administered once every three days for three times. At the end of the experiment, tumors, lymph nodes, spleens, and peripheral blood were collected, cells were separated, and the proportion of T cells and M1 macrophages, as well as the circRNAs in them, were detected by flow cytometry. HER2-CAR The expression of circRNA in situ was monitored and the survival and tumor volume of mice were observed and recorded every day. HER2-CAR The preparation is efficient and has high anti-tumor ability.

[0248] Example 12 Preparation of circular RNA autoimmune disease therapeutic drugs

[0249] The coding sequence of the circular RNA construct in Example 2(2) was changed to MOG 35-55 The amino acid coding sequence was added, and a 70bp external homology arm and a 12bp internal homology arm were added to prepare a circular RNA vaccine, and sequence screening was performed. First, 293T cells were transfected, and the expression of the antigen was verified by WB. C57BL / 6 mice (20μg / mouse) were then injected with the LNP delivery system to treat EAE disease. After inducing EAE disease in mice, the drug was administered once on the 7th and 10th days or when the EAE score was 1-2. The severity of the disease after administration was detected in mice, when the disease progressed to a score of 1 to 2. CD4 + T cells and MOG 35-55 Specific CD4 + The frequency of T cells (n = 3-4) was 1 day before EAE induction. + 2D2 CD4 + T cells shift to Thy1.2 + The target organs were analyzed in recipient mice at day 16 after disease induction. CD4 staining of the mouse spinal cord and analysis of IFN-γ and IL-17a secreted in the brain and spinal cord were performed at day 16 after EAE induction. The results showed that treatment with antigen-encoded rolling circle translated circular RNA can improve EAE disease in mice.

[0250] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A RNA construct, characterized in that: The RNA construct comprises the following elements from the 5' end to the 3' end: the 3' intron portion including the 3' splice site; Target gene sequence (Gene of interest, GOI); the 5' intron portion including the 5' splice site; The 3' intron and the 5' intron are two fragments obtained by splitting a type I intron, respectively; the type I intron contains at least 9 paired double helix regions P1-P9 from the 5' end to the 3' end; the splitting site is located in a non-complementary region or adjacent to a non-complementary region that is divided into the P9 region from the 5' end to the 3' end of the type I intron; the 3' intron contains at least a portion of the P9 region at the 3' end of the type I intron; and the 5' intron contains at least a P1-P8 region and a portion of the P9 region at the 5' end of the type I intron; The adjacent non-complementary region of P9 is 0-40 nucleotides away from the 5' end or 3' end of the non-complementary region of P9; The group I intron is not modified or is optimized and modified.

2. The RNA construct according to claim 1, characterized in that The type I intron contains at least 10 paired double helix regions P1-P10 from the 5' end to the 3' end, and the split site is located in the non-complementary region or adjacent to the non-complementary region of the type I intron divided into the P9 region from the 5' end to the 3' end.

3. The RNA construct according to claim 1, characterized in that The sources of group I introns include Tetrahymena, Anabaena or T4 bacteriophage.

4. The RNA construct according to claim 1 or 2, characterized in that: The optimization and transformation of the group I introns includes at least one of the following: (1) modifying any site in the P1-P9 or P1-P10 complementary region, wherein the modification includes one or more of addition, deletion, and mutation; (2) Modifying any site in the non-complementary region P1-P9 or P1-P10, wherein the modification includes one or more of addition, deletion, and mutation.

5. The RNA construct according to claim 1, characterized in that The RNA construct also contains a sequence for initiating translation.

6. The RNA construct according to claim 5, characterized in that The sequence for initiating translation includes one or more of an internal ribosome entry site sequence, an m6A motif, a cap-independent translation enhancer sequence, and a kozak sequence.

7. The RNA construct according to claim 6, characterized in that At least one of the following: (1) The internal ribosome entry site sequence is derived from SimianV4, CVB3, CVB5, CVB1, HRV-A89, HRV-B3, SalivirusA GUT, EV107, CVA3, HRV-B37, EchoV11, HRV-C54, HRV-B4, EV-D94, HRV-B93, EV-J, SwineVesicular, CVA20, PV1, HRV-A1, Salivirus A SZ1, Salivirus FHB, EMCV-cf, HCV, Aichivirus, CrPV, Covid 19, Crohivirus B, EchoV-E11, Sapevirus or Phopivirus; (2) The cap-independent translation enhancer sequence is derived from the 5'UTR or 3'UTR of PMV, CarMV-PTE, CbMV, CCFV, CIRV, GaMV, HCRSV, HnRSV, MNeSV, MNSV, PLPV, PEMV2, PFBV, PSNV, RCNMV1, SCV, TBSV, TCV, TNV, BBV, BYDV, STNV, SCV, PEMV2, TPAV or STNV virus; or from the 5'UTR or 3'UTR of HIF-1α, FGF9, p53A or p53B gene in the Homo sapiens genome.

8. The RNA construct according to claim 1 or 5, characterized in that: The RNA construct also contains sequences for promoting cyclization and expression.

9. The RNA construct according to claim 8, characterized in that The sequence for promoting circularization and expression includes one or more of homology arms, spacer sequences, and UTR sequences.

10. The RNA construct according to claim 9, characterized in that At least one of the following: (1) The homology arms include external homology arms and / or internal homology arms; (2) The spacer sequence comprises a polyA sequence and / or a polyAC sequence; (3) The UTR sequence includes a 5'UTR sequence and / or a 3'UTR sequence.

11. The RNA construct according to claim 10, characterized in that At least one of the following: (1) When the homology arm is an external homology arm, in the RNA construct, the external homology arm is located at the 5' end of the 3' intron and / or the 3' end of the 5' intron; when the homology arm is an internal homology arm, in the RNA construct, the internal homology arm is located at the 3' end of the 3' intron and / or the 5' end of the 5' intron; (2) The length of the homology arm is not less than 10 bp; (3) The spacer sequence is located before the sequence that initiates translation and / or after the GOI; (4) The 5'UTR sequence is located before the sequence that initiates translation, and the 3'UTR sequence is located after the GOI sequence.

12. The RNA construct according to claim 1, characterized in that The coding sequence of the target gene includes one or more of a viral antigen sequence, a tumor antigen sequence, a monoclonal antibody sequence, a bispecific antibody sequence, a CAR sequence, a cytokine sequence, a coagulation factor sequence, a growth factor sequence, a gene editing enzyme sequence, a fluorescent protein sequence, and a luciferase sequence.

13. A circular RNA, characterized in that Obtained by cyclizing the ribonucleic acid construct according to any one of claims 1 to 12.

14. A method for preparing circular RNA, characterized in that: The method comprises the following steps: cyclizing the ribonucleic acid construct according to any one of claims 1 to 12 to obtain the circular RNA.

15. The preparation method according to claim 14, characterized in that: The cyclization comprises the steps of in vitro transcription, DNaseI treatment and purification.

16. The preparation method according to claim 14, characterized in that: Modified nucleotides are added during the preparation process, with the addition ratio ranging from 0% to 100%.

17. A recombinant cell containing the ribonucleic acid construct according to any one of claims 1 to 12, the circular RNA according to claim 13, or the circular RNA obtained by the preparation method according to any one of claims 14 to 16.

18. A method for producing a protein or polypeptide, characterized in that: The method comprises the following steps: introducing the ribonucleic acid construct according to any one of claims 1 to 12, the circular RNA according to claim 13, or the circular RNA obtained by the preparation method according to any one of claims 14 to 16 into a host cell to express the protein; wherein the target gene encodes the protein or polypeptide.

19. Use of the ribonucleic acid construct according to any one of claims 1 to 12, the circular RNA according to claim 13, the circular RNA obtained by the preparation method according to any one of claims 14 to 16, or the recombinant cell according to claim 17 in the preparation of a diagnostic product, a preventive or therapeutic product.

20. A drug, characterized in that The drug comprises: the ribonucleic acid construct according to any one of claims 1 to 12, the circular RNA according to claim 13, the circular RNA obtained by the preparation method according to any one of claims 14 to 16, or the recombinant cell according to claim 17.

21. The drug according to claim 20, characterized in that The medicine also includes a pharmaceutically acceptable carrier.

22. The drug according to claim 20, characterized in that The medicine is a vaccine; the vaccine contains the RNA construct or circular RNA, wherein the target gene includes an antigen coding sequence.

23. The drug according to claim 20, characterized in that The drug is a CAR immunotherapy drug; the CAR immunotherapy drug contains the ribonucleic acid construct or circular RNA, wherein the target gene includes a chimeric antigen receptor coding sequence.

24. The drug according to claim 20, characterized in that The drug is a drug for treating autoimmune diseases; the drug for treating autoimmune diseases contains the ribonucleic acid construct or circular RNA, wherein the target gene includes an antigen sequence encoding an inducing immune tolerance.

Images