Application of fusarium NF01 in preparation of spermidine and catalysis of lignite liquefaction

Abstract

The invention belongs to the technical field of spermidine preparation and application, and particularly relates to application of fusarium NF01 in preparation of spermidine and catalysis of lignite liquefaction. The fusarium NF01 is a fusarium strain Fusarium sp. NF01, and the fusarium strain NF01 is a fusarium strain NF01. Research finds that the fusarium strain Fusarium sp.NF01 can secrete spermidine synthetase, putrescine and decarboxylated S-adenosylmethionine are catalyzed by the spermidine synthetase to biologically synthesize spermidine, the spermidine acts on the lignite, then the lignite is liquefied, and the technical progress and application expansion in the field of coal development can be promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of spermidine preparation and application, and particularly relates to application of Fusarium NF01 in preparing spermidine and catalyzing lignite liquefaction. Background Art

[0002] Spermidine is a highly biologically active aliphatic nitrogenous alkaloid, belonging to biologically derived polycationic polyamines. Alkalinity is an important chemical property of spermidine. Spermidine can inhibit neuronal NO synthase, bind and precipitate DNA; it can also be used to purify DNA-binding proteins and stimulate T4 polynucleotide kinase activity. Related research results have shown that spermidine can also effectively delay cell aging, optimize immune regulation, and inhibit cell oxidative stress and necrosis through the cell autophagy mechanism.

[0003] The preparation methods of spermidine include chemical method and biological method. Among them, the chemical method mainly uses organic solvents or acid-base solutions to extract broken tissues of animals and plants, and then separates and purifies them to obtain spermidine; while the biological method is an efficient and environmentally friendly method. The biological method of synthesizing spermidine is mainly through the secretion of biological enzymes by specific microorganisms, and then undergoes a series of complex biochemical transformation processes to obtain spermidine. The prepared spermidine is mainly used in the medical field, such as anti-aging, neuroprotection and immunotherapy, making it an important target for future drug development.

[0004] Currently, microorganisms used to prepare spermidine mainly include intestinal bacteria, such as Lactobacillus reuteri, Bifidobacterium, and engineered strains constructed by modern biotechnology. However, these microorganisms are inefficient in preparing spermidine, which limits the wide application of spermidine. At the same time, there are very few research reports on the ability of Fusarium strains to prepare spermidine, and it is necessary to develop a new product application of Fusarium strains in the preparation of spermidine. Summary of the invention

[0005] In order to develop a new application of Fusarium strains in the preparation of spermidine, the present invention proposes the application of Fusarium NF01 in the preparation of spermidine and catalysis of lignite liquefaction. To achieve the above purpose, the present invention adopts the following technical scheme.

[0006] There are two main pathways for the synthesis of spermidine in organisms. The first is the direct synthesis of spermidine via carboxylated adenosylmethionine and putrescine under the action of spermidine synthase. Carboxylated adenosylmethionine can be obtained from methionine through adenylation and decarboxylation catalysis of related enzymes. This pathway is a common traditional spermidine synthesis pathway in animals, plants and microorganisms. The second is the synthesis of spermidine via aspartate-β-semialdehyde and putrescine under the catalysis of carboxyspermidine dehydrogenase and decarboxylase. Aspartate-β-semialdehyde can be synthesized from common amino acids such as aspartate through phosphorylation and dehydrogenation catalysis of related enzymes. This pathway is a newly discovered alternative synthesis pathway, which mainly exists in some bacteria, including important human pathogens, intestinal flora, etc.

[0007] Both of the above-mentioned two pathways involve an important intermediate - putrescine, which can be synthesized from common amino acids - ornithine or arginine through relevant enzyme catalysis. In the synthesis process of spermidine, it is an important intermediate substrate. Because the enzymes in these pathways are highly regulated, the spermidine content of plants and animals is low, and no microorganisms that can produce spermidine in large quantities have been found. Based on this background, the present invention provides the use of Fusarium NF01 in the preparation of spermidine and catalytic lignite liquefaction. The Fusarium NF01 provided by the present invention can produce spermidine in large quantities, and the prepared spermidine is highly efficient, and a new product application of a Fusarium strain in the preparation of spermidine is developed. Among them, the Fusarium NF01 is a Fusarium strain Fusarium sp. NF01. The strain is screened by collecting coal samples in situ from coal seams, and the strain obtained in this way can have significant advantages in terms of adaptability to coal seam environments, efficiency of coal conversion, and technical feasibility.

[0008] Preferably, the Fusarium sp. NF01 is inoculated in a culture medium for culture. The culture medium is a MM-SGC solid culture medium, which is prepared by adding 1.4% to 1.6% agar by mass to a MM-SGC liquid culture medium.

[0009] The components and final concentrations of the MM-SGC liquid culture medium are: 8g / L-12g / L sodium gluconate, 2g / L-4g / L KH2PO4, 0.5g / L-2.5g / L MgSO4·7H2O, 0.5g / L-1.5g / L (NH)2SO4, 0.05mg / L-0.15mg / LFeSO4·7H2O, 0.1mg / L-0.3mg / L CuSO4·5H2O, 0.5mg / L-1mg / L ZnSO4, and the solvent is water. The selection of this culture medium component can better achieve the synthesis of spermidine by the Fusarium sp. NF01.

[0010] The Fusarium sp. NF01 strain secretes spermidine synthase, and spermidine is synthesized by the spermidine synthase.

[0011] Preferably, the culture condition is a constant temperature culture at 28°C to 32°C.

[0012] Preferably, the culture time is 8 to 12 days.

[0013] Preferably, the method for inoculating the Fusarium sp. NF01 is: directly inoculating the mycelium of the Fusarium sp. NF01 into the culture medium.

[0014] The present invention also provides the use of the Fusarium sp. NF01 in catalyzing lignite liquefaction. After the Fusarium sp. NF01 is cultured in a culture medium for 8 to 12 days, lignite is placed on hyphae grown by the Fusarium sp. NF01 and cultured for 17 to 23 days.

[0015] The Fusarium sp. NF01 is used to secrete putrescine, spermine, tyramine, phenylethylamine and tryptamine, and acts on lignite together with spermidine to catalyze lignite liquefaction.

[0016] Preferably, the amount of lignite placed on the hyphae grown by the Fusarium sp. NF01 is: the mass ratio of the volume of the culture medium to the lignite is: 50 mL: 0.28 g to 0.32 g.

[0017] The particle size of the lignite is 0.070 cm to 0.078 cm.

[0018] In this process, the Fusarium sp. NF01 was able to convert the pre-treated lignite into liquid.

[0019] Preferably, the lignite is lignite pretreated with nitric acid. The method of nitric acid pretreatment is:

[0020] Mix lignite with 6 mol / L nitric acid and leave for 36 to 72 hours.

[0021] The volume ratio of the mass of the lignite to the nitric acid with a concentration of 6 mol / L is 1:3 to :5. The purpose of selecting nitric acid to pretreat the lignite is to oxidize the macromolecular structure of the lignite, break its structure, promote oxidation activity, and improve the liquefaction rate of the lignite.

[0022] Wherein, the culture medium is a solid culture medium.

[0023] Specifically, the solid culture medium is an MM-SGC solid culture medium, and the MM-SGC solid culture medium is prepared by adding 1.4% to 1.6% by mass of agar to an MM-SGC liquid culture medium.

[0024] The components and final concentrations of the MM-SGC liquid culture medium are: 8g / L-12g / L sodium gluconate, 2g / L-4g / L KH2PO4, 0.5g / L-2.5g / L MgSO4·7H2O, 0.5g / L-1.5g / L (NH)2SO4, 0.05mg / L-0.15mg / L FeSO4·7H2O, 0.1mg / L-0.3mg / L CuSO4·5H2O, 0.5mg / L-1mg / L ZnSO4, 1.5%wt agar, and the solvent is water. The selection of this culture medium component can better achieve the liquefaction amount of lignite by the Fusarium sp. NF01 strain.

[0025] Preferably, the culture condition is a constant temperature culture of 28°C to 32°C. The culture time is 25 to 35 days. The specific culture method is as follows:

[0026] The Fusarium sp. NF01 is first cultivated for 8 to 12 days, and then the lignite is placed on the grown hyphae and cultivated for 17 to 23 days. Cultivating the Fusarium sp. NF01 for 8 to 12 days can make the hyphae grow well, secrete spermidine, and make it easier to liquefy the lignite, thereby increasing the liquefaction amount of the lignite.

[0027] Preferably, the Fusarium sp. NF01 can secrete spermidine synthase, which catalyzes the biosynthesis of putrescine and decarboxylation of S-adenosylmethionine to obtain the spermidine. Spermidine can be synthesized by the Fusarium sp. NF01, the process is simple, and the yield of the harvested spermidine is high. At the same time, in the process of synthesizing spermidine, lignite can be liquefied, which can promote technological progress and application expansion in the field of coal development.

[0028] The Fusarium sp.NF01 is used to secrete putrescine, spermine, tyramine, phenylethylamine, and tryptamine, and acts on lignite together with spermidine to catalyze lignite liquefaction. The above method provided by the present invention has a simple production process and the raw materials are easy to obtain and low in cost, has good industrial application prospects, and is different from producing spermidine by genetically engineered bacteria. The present invention only needs to cultivate the Fusarium sp.NF01 in a culture medium added with lignite to synthesize spermidine, which is simple to operate and efficient.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. The present invention provides the application of Fusarium NF01 in the preparation of spermidine and catalysis of lignite liquefaction. The Fusarium NF01 provided by the present invention can produce spermidine in large quantities, and the prepared spermidine has high efficiency, and develops a new application of a Fusarium strain in the preparation of spermidine. The present invention uses proteomics technology to quantitatively and qualitatively analyze the significantly differentially expressed proteome of Fusarium NF01 cultivated under lignite conditions, revealing the biological strategy of the Fusarium NF01 strain in response to the lignite environment, and adopts targeted detection of biogenic amines and lignite bioliquefaction experiments under inhibition of polyamines to determine the reasons for the biological liquefaction of target proteins and lignite, and finally infers the way for Fusarium NF01 to synthesize spermidine. The present invention reveals the mechanism of Fusarium NF01 liquefaction of lignite, promotes the industrial process of lignite microbial liquefaction, improves production efficiency, reduces costs, reduces environmental pollution, etc. Among them, Fusarium NF01 is strain Fusarium sp. NF01.

[0031] 2. The present invention discloses the coping strategy of Fusarium NF01 in response to the lignite cultivation environment; and discloses the reason why lignite is liquefied by Fusarium NF01, namely, spermidine synthase catalyzes putrescine and decarboxylates S-adenosylmethionine to biosynthesize spermidine, making its culture fluid alkaline and liquefied in lignite. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is a volcano plot of the relative protein abundance changes of the two groups of samples in the present invention.

[0033] Figure 2 The present invention is the bioliquefaction of lignite with or without the addition of polyamine inhibitors; wherein, Figure 2 Figure A in the figure is the bioliquefaction diagram with the addition of polyamine inhibitors; Figure 2 Figure B shows the bioliquefaction diagram without the addition of polyamine inhibitors. DETAILED DESCRIPTION

[0034] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0035] The culture medium and reagents used in the following examples are as follows:

[0036] (1) Culture medium

[0037] MM-SGC solid culture medium: MM-SGC solid culture medium is prepared by adding 1.5% agar by mass to MM-SGC liquid culture medium.

[0038] MM-SGC liquid culture medium: 10 g / L sodium gluconate, 3 g / L K2H2PO4, 1.5 g / LMgSO4·7H2O, 1 g / L(NH)2SO4, 0.1 mg / LFeSO4·7H2O, 0.2 mg / L CuSO4·5H2O, 0.68 mg / L ZnSO4, made up to 1 L with water, and the pH was adjusted to 7.1.

[0039] (2) Reagents and materials

[0040] The raw lignite samples were sourced from the surface coal yards of the Liujia Coal Mine in the Yuanbaoshan Coalfield, Chifeng City, Inner Mongolia Autonomous Region.

[0041] Sodium gluconate, K2H2PO4, MgSO4·7H2O, and (NH)2SO4 in the above culture medium were purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0042] FeSO4·7H2O, CuSO4·5H2O, and ZnSO4 were all purchased from Tianjin Fuchen Chemical Reagent Co., Ltd.

[0043] The inorganic salt reagents in the above culture medium were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0044] Example 1: Obtaining strain Fusarium sp. NF01

[0045] 1. Isolation and purification of strains

[0046] Coal blocks were collected from the in-situ coal seams of the 6-8 working faces of the North Section 3 of the West Second Mining Area of ​​Liujia Coal Mine in Yuanbaoshan Coalfield. The coal blocks were quickly packed into sterile bags and sealed, and transported to the laboratory for storage in a 4°C insulated box. In the super workbench, the coal blocks were crushed, and coal samples from the center of the coal blocks were taken. After enrichment, separation and purification, the strains were obtained. For specific separation and purification methods, see "Biological Characteristics and Microstructural Analysis of the Degradation of Lignite by Native Bacteria", the first author of which is Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510.

[0047] The strain obtained above is called strain Fusarium sp.NF01. The strain Fusarium sp.NF01 is recorded in "Biological Characteristics and Microstructural Analysis of Lignite Degradation by Native Bacteria", the first author of which is Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510. The strain is the native bacteria F.spp.NF01 in the above literature.

[0048] 2. Identification of strain Fusarium sp. NF01

[0049] 1. The morphology and culture characteristics of strain Fusarium sp.NF01 are detailed in "Biological Characteristics and Microstructural Analysis of Lignite Degradation by Native Bacteria", the first author of which is Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510.

[0050] 2. The ITS sequence of strain Fusarium sp.NF01 was determined.

[0051] The ITS sequence of the strain Fusarium sp.NF01 determined is shown in SEQ ID NO.1:

[0052] TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAAC CATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGC ATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC.

[0053] Based on the comprehensive morphological characteristics and molecular identification results, the strain Fusarium sp.NF01 was preliminarily identified as Fusarium sp., which was recorded in "Biological Characteristics and Microstructural Analysis of Lignite Degradation by Native Bacteria", with Niu Xian as the first author, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510. This strain is the native bacteria F.spp.NF01 mentioned in the above literature.

[0054] The sequence number of the strain Fusarium sp.NF01519bq has been entered into the NCBI GenBank database with accession number MN822700.

[0055] Example 2: Application of strain Fusarium sp. NF01 in the preparation of spermidine

[0056] 1. Significantly Different Proteins

[0057] The present invention has found that the strain Fusarium sp.NF01 can secrete spermidine synthase, and then the spermidine synthase catalyzes putrescine and decarboxylates S-adenosylmethionine to biosynthesize spermidine. The present invention also uses the TMT technology in proteomics to analyze the significant differential proteins of the strain during liquefaction of lignite. The specific research is as follows:

[0058] Two test groups were established. The first test group was cultured in a medium without lignite for 30 days under a shaking incubator at a constant temperature of 30°C and 130 rpm. The medium without lignite was MM-SGC liquid medium.

[0059] The second test group was strain Fusarium sp. NF01 cultured in MM-SGC liquid medium supplemented with 0.3 g lignite at a constant temperature of 30° C. and a shaking incubator at 130 rpm for 30 days.

[0060] The lignite added to the MM-SGC liquid culture medium is lignite obtained after nitric acid pretreatment, and the specific pretreatment method is as follows:

[0061] The raw lignite sample was mixed with 6 mol / L HNO3 at a mass-to-HNO3 volume ratio of 1:3.5 g / mL, and after pretreatment for 48 h, it was filtered and washed to neutral pH 6.7, and dried at 30 °C to obtain the pretreated lignite sample.

[0062] The particle size of the raw lignite sample is 0.074 mm.

[0063] In the above two test groups, when inoculating Fusarium sp. NF01, the mycelium of Fusarium sp. NF01 was directly inoculated into the MM-SGC liquid culture medium.

[0064] After 30 days of cultivation, the protein samples in the above two experimental groups were subjected to proteomic detection and comparison using TMT technology.

[0065] The specific sample preparation and detection methods are as follows:

[0066] (1) Protein extraction: The test sample was first placed in a precooled ultrafiltration tube and centrifuged at 3000×g and 4°C for 30 min to obtain a concentrated sample. 20 μL of the concentrated sample was mixed with 5 volumes of lysis buffer, sonicated for 5 min, and centrifuged at 20,000×g and 4°C for 30 min. The above steps were repeated 3 times. Then, 10 mM dithiothreitol was added to the supernatant, and the sample was incubated at 56°C for 1 hour. Finally, 55 mM iodoacetamide was added for alkylation in the dark for 1 hour, centrifuged at 20,000×g and 4°C for 30 min, and the supernatant was used for subsequent analysis.

[0067] The test samples refer to the protein samples corresponding to the above two test groups, namely, the mixed culture fluid consisting of the strains and culture medium of the two test groups after 30 days of cultivation.

[0068] The formula composition of the lysis buffer is: 8M urea, 30mM HEPES, 1mM PMSF, 2mM EDTA and 10mM DTT, with water as the solvent.

[0069] Ultrafiltration tube: 10K; EMD Millipore.

[0070] The conditions for ultrasonic treatment were 2 s pulse on, 3 s pulse off and 180 W power.

[0071] (2) Protein quantification and quality control: The protein samples were quantified using the Bradford method. 6 μg of protein in each sample was mixed with 5 volumes of buffer and boiled at 98°C for 10 min. Then, the proteins in the sample were separated by 12.5% ​​sodium dodecyl sulfate-polyacrylamide gel electrophoresis at a constant 120 V for 120 min. After electrophoresis, the gel was stained with Coomassie Brilliant Blue G250.

[0072] The buffer solution includes 0.1M tris buffer, pH 6.8, v / v 4% sodium dodecyl sulfate, v / v 0.2% β-mercaptoethanol, v / v 40% glycerol and w / v 0.002% bromophenol blue. Sodium dodecyl sulfate is also called SDS.

[0073] Coomassie Brilliant Blue G250: Thermo Fisher Scientific, Waltham, MA, USA.

[0074] (3) Stable isotope labeling of proteins: A sample containing 30 μg of protein was first placed in a precooled ultrafiltration tube and centrifuged at 14,000×g and 4°C for 40 min to obtain a concentrated sample. The concentrated sample was mixed with 200 μL of 50 mM tetraethylammonium bromide and centrifuged at 14,000×g and 4°C for 40 min. The above steps were repeated 3 times. Then, 30 μg of trypsin was added to the protein sample for digestion overnight in a 37°C water bath, and the resulting peptide digest was freeze-dried. The freeze-dried peptides were resuspended in 25 μL of 200 mM TEAAB and labeled according to the manufacturer's instructions for the TMT-10-plexTM isobaric labeling kit. The samples were labeled as follows: NF1-1, 129C; NF1-2, 130N; NF2-1, 130C; and NF2-2, 131. After labeling, equal volumes of each sample were thoroughly mixed and dried in a vacuum concentrator.

[0075] Trypsin: Promega, Madison, WI, USA.

[0076] Pressure labeling kit: Thermo Fisher Scientific, Waltham, MA, USA.

[0077] (4) Reverse phase pre-separation: The labeled peptide mixture was fractionated using an L-3220 reverse phase separator. Specific steps: First, the mixture was dissolved in 1 mL of buffer A and centrifuged at 15,000 × g and 4°C for 10 min; then, the supernatant was injected into a C18 column and gradient eluted with buffer B at a flow rate of 1 mL / min: 0-5% buffer B for 101 min; 5%-9% buffer B for 101 min to 107 min; 9%-13% buffer B for 107 min to 113 min; 13%-19% buffer B for 113 min to 119 min; 19%-80% buffer B for 119 min to 125 min; 80%-5% buffer B for 125 min to 130 min; buffer B was reset to 0% after 130.01 min. Finally, the peptides were separated into 10 pre-separation fractions and vacuum dried.

[0078] Among them, C18 column: Phenomenex Gemini NX-C18; 250mm×4.60mm; 5μm; Phenomenex, Torrance, CA, USA.

[0079] L-3220 reversed phase separator: RIGOL, Beijing, China.

[0080] Buffer A: 95% H2O and 5% acetonitrile; pH adjusted to 9.8 with ammonia. Buffer B: 95% acetonitrile plus 5% H2O; pH adjusted to 9.8 with ammonia.

[0081] (5) Liquid chromatography / tandem mass spectrometry analysis: The samples were analyzed by LC-MS / MS using a Dionex Ultimate 3000Nano-LC liquid chromatograph coupled to a Q-ExActive mass spectrometer. Specific steps: First, the sample was loaded onto a reverse capture column in buffer A and connected to a C18 reverse phase analytical column, and gradient separation was performed using buffer B at a flow rate of 0.4 μL / min. The linear gradient was as follows: 0-40 min, 5%-30% buffer B; 40-45 min, 30%-60% buffer B; 45-48 min, 60%-80% buffer B; 48-65 min, 80%-5% buffer B. Then, the separated components were identified by Q-ExActive MS mass spectrometry with the following main setting parameters: positive ion mode; scan range 350-2,000 m / z; full scan resolution 70,000; MS / MS scan resolution 35,000; capillary temperature 320°C; ion source voltage 1,800 V; collision energy normalization 30 eV.

[0082] Among them, C18 reverse phase analytical column: 75μm×15cm; nanoviper C18; 5μm; Thermo Fisher Scientific.

[0083] Dionex Ultimate 3000Nano-LC liquid chromatograph: Thermo Fisher Scientific.

[0084] Buffer A: 0.1% formic acid, 2% acetonitrile, 98% water. Buffer B: 0.1% formic acid plus 98% acetonitrile plus 2% water.

[0085] Reverse trapping column: Acclaim PepMap100: 150 μm × 2 cm; 5 μm; Thermo Fisher Scientific.

[0086] (6) Bioinformatics analysis: Proteome Discoverer v.1.4 software platform combined with Mascot v.2.3.01 search engine was used to analyze the proteome. The protein database of Fusarium was downloaded from UniProt: http: / / www.uniprot.org database. The search results were standardized and quantified. The protein identification threshold was a false discovery rate of <0.01, and a maximum of 1 nonspecific cleavage site was allowed. The significance evaluation of protein quantification took p < 0.05 as the difference screening standard. Among them, differential proteins with a fold change of ≥ 2 were up-regulated proteins, and FC ≤ 0.5 were down-regulated proteins. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases were used to analyze GO functional annotation and KEGG pathway enrichment, respectively.

[0087] Among them, Proteome Discovererv.1.4: Thermo Fisher Scientific.

[0088] Mascot v.2.3.01: Matrix Science, London, UK.

[0089] Protein Database: Uniprot-taxonomy 5506_Fusarium; 900,164 sequences.

[0090] Gene Ontology: GO; http: / / geneontology.org.

[0091] The English abbreviation of false discovery rate is FDR. The English abbreviation of differential protein fold change is FC.

[0092] The English abbreviation of the Genome Encyclopedia Database is KEGG, and the specific website is https: / / www.kegg.jp.

[0093] They were used to analyze GO functional annotation and KEGG pathway enrichment, respectively.

[0094] The above test results are as follows Figure 1 shown.

[0095] Depend on Figure 1 The volcano plot of protein DEPs showed that 18 significantly differentially expressed proteins were identified after proteomics detection, of which 8 DEPs were up-regulated: significantly differential protein fold ≥ 1.2 and P value ≤ 0.05, and 10 DEPs were down-regulated: FC ≤ 0.83 and P value ≤ 0.05.

[0096] According to the protein difference fold FC values, the top three up-regulated DEPs were analyzed, which were spermidine synthase, plasma membrane ATPase, and γ-glutamyltransferase, and the top three down-regulated DEPs were analyzed, which were 6-hydroxy-d-nicotine oxidase, 3-phosphoinositide synthase, and aspartate aminotransferase.

[0097] Among them, DEPs refer to significantly differentially expressed proteins.

[0098] Protein number of spermidine synthase: X0JZR4, EC 2.5.1.16, protein number of plasma membrane ATPase: A0A365MSF8; PM H + -ATPase, EC 3.6.1.34, protein number of γ-glutamyltransferase: A0A420Q050; GGT, EC 2.3.2.2. Protein number of 6-hydroxy-d-nicotine oxidase: A0A2H3TJF9; 6-HDNO, EC 1.5.3.6, protein number of 3-phosphoinositide synthase: A0A1B8B876; IPS, EC 5.5.1.4, protein number of aspartate aminotransferase: A0A3L6NBM6; AST, EC 2.6.1.1.

[0099] After 6 protein analyses, it was found that the strain Fusarium sp.NF01 adopted a multi-level protein regulation strategy to respond to the culture environment containing lignite. In the analysis of significantly up-regulated proteins, the main strategies included the transport and synthesis of nutrients, active regulation of the plasma membrane, optimization of immunity, and inhibition of cell damage and death. In the analysis of significantly down-regulated proteins, the strain Fusarium sp.NF01 showed slow growth and poor metabolism in the MM-SGC liquid medium supplemented with lignite. In addition, spermidine synthase, the most significantly up-regulated protein with differential proteins, was selected as the target protein. Because spermidine synthase can catalyze the transfer of propylamine from S-adenosylmethionine to putrescine to synthesize spermidine. Spermidine is a class of nitrogen-containing low molecular weight alkaline organic compounds, belonging to the aliphatic class of biogenic amines. When spermidine meets water, it undergoes hydrolysis reaction, releasing hydroxide ions, making the solution alkaline. Previously, the strain Fusarium sp.NF01 cultured in MM-SGC liquid medium was alkaline. Therefore, spermidine synthase was selected as the target protein.

[0100] From the above experimental results, it can be seen that the strain Fusarium sp.NF01 can secrete spermidine synthase, and it mainly adopts a multi-protein regulatory strategy to respond to the lignite culture environment. The main strategies include the transport and synthesis of nutrients, active regulation of the plasma membrane, optimization of immunity, and inhibition of cell damage and death.

[0101] 2. Targeted detection of biogenic amines

[0102] The present invention conducts targeted detection of biogenic amines synthesized by spermidine synthase in strain Fusarium sp. NF01, and the specific research is as follows:

[0103] Two experimental groups were established, each with three replicates.

[0104] The first test group was strain Fusarium sp. NF01 cultured in MM-SGC solid medium without adding lignite at a constant temperature of 30°C.

[0105] The second test group was strain Fusarium sp.NF01, which was first cultured in MM-SGC solid medium without adding lignite at a constant temperature of 30°C for 10 days; after 10 days of culture, 0.3g of lignite powder was evenly placed on the mycelium and cultivated for another 20 days.

[0106] The lignite is lignite pretreated with nitric acid. The specific pretreatment method is:

[0107] The raw coal sample was mixed with 6 mol / L HNO3 at a ratio of 1:3.5 g / mL, and after pretreatment for 48 hours, it was filtered and washed to neutral pH 6.7, and dried at 30°C to obtain the pretreated coal sample.

[0108] When the lignite powder in the culture dish of the second test group was observed to be mostly liquefied, 100±0.2 mg of mycelium from the first test group and mycelium from the second test group not covered by lignite were picked up, respectively, and frozen at -80°C before testing. The specific testing method is as follows:

[0109] Weigh 50 mg of mycelium sample and place it in a centrifuge tube, then add 1 mL of 0.1 M hydrochloric acid, vortex mix, and extract for 1 hour at room temperature. Then, centrifuge the sample at 4°C and 10000 rpm for 15 minutes, take 10 μL of supernatant sample into a bottle, add 70 μL of AccQ Tag Ultra Borate buffer and 20 μL of AccQ Tag reagent. Finally, heat the sample at 55°C for 10 minutes to mix and react, and after cooling, the sample is subjected to high-performance liquid chromatography and high-resolution mass spectrometry detection. Among them, the chromatographic column is Waters BEH C18, with specifications of 50*2.1 mm, 1.7 μm. Mobile phase A is ultrapure water containing 0.1% formic acid by volume, phase B is acetonitrile containing 0.1% formic acid by volume, flow rate is 0.5 mL / min, column temperature is 55°C, and injection volume is 1 μL. The elution gradient was 0 min water / acetonitrile: 95:5 V / V, 5.5 min water / acetonitrile; 90:10 V / V, 7.5 min water / acetonitrile: 75:25 V / V, 8 min water / acetonitrile: 40:60 V / V, 8.5 min water / acetonitrile: 95:5 V / V, 13 min water / acetonitrile; 95:5 V / V. The mass spectrometer used an electrospray ion source, sheath gas 40 arb, auxiliary gas 10 arb, ion spray voltage +3000 V, temperature 350 ° C, ion transfer tube temperature 320 ° C, full scan positive ion mode, primary scan range 150-700.

[0110] Among them, the targeted biogenic amines of the samples to be tested are shown in Table 1.

[0111] High performance liquid chromatography: Vanquish, UPLC, Thermo, USA. High resolution mass spectrometry: Q Exactive, Thermo, USA.

[0112] Table 1 Information on biogenic amine standards

[0113] name English name CAS Number Molecular formula Putrescine Putrescine 110-60-1 <![CDATA[C4H 12 N2]]> Cadaverine Cadaverine 462-94-2 <![CDATA[C5H 14 N2]]> Phenylethylamine Phenethylamine 64-04-0 <![CDATA[C8H 11 N]]> Tyramine Tyramine 51-67-2 <![CDATA[C8H 11 N O ]]> Spermine Spermine 71-44-3 <![CDATA[C 10 H 26 N4]]> Spermidine Spermidine 124-20-9 <h2 style=";text-align:left;direction:ltr"><![CDATA[C7H <h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> N3]]><h2 style=";text-align:left;direction:ltr"> Tryptamine Tryptamine 61-54-1 <![CDATA[C 10 H 12 N2]]> histamine Histamine 51-45-6 <![CDATA[C5H9N3]]>

[0114] A total of 6 biogenic amines were detected, namely spermidine, putrescine, spermine, tyramine, phenylethylamine, and tryptamine, as shown in Table 2 for details.

[0115] Table 2 Qualitative and quantitative results of biogenic amines

[0116]

[0117] Among them, the content of spermidine in the first test group was 132.838ug / g, accounting for 68% in this group; the content of spermidine in the second test group was 128.903ug / g, accounting for 65% in this group.

[0118] The content of putrescine in the first test group was 31.435 ug / g, accounting for 16.1% of the group; the content of putrescine in the second test group was 40.541 ug / g, accounting for 20.4% of the group.

[0119] The content of spermine in the first test group was 15.696 ug / g, accounting for 8% of the group; the content of spermine in the second test group was 16.616 ug / g, accounting for 8.4% of the group.

[0120] The above data show that the secretion of strain Fusarium sp.NF01 contains rich biogenic amines. Among them, the biogenic amines secreted by strain Fusarium sp.NF01 are mainly composed of spermidine, putrescine and spermine, with spermidine having the highest content. In addition, the second test group did not find a significant increase or decrease in the content of each biogenic amine compared with the first test group, indicating that lignite pulverized coal has little effect on the secretion of biogenic amines by the strain.

[0121] In addition, biogenic amines are a general term for small molecular weight nitrogen-containing organic alkaline compounds with biological activity. The alkalinity principle is similar to that of inorganic ammonia, such as: The nitrogen atoms on the biogenic amines have unbonded arc pairs of electrons, which are protonated to generate stable ammonium ions and hydroxide anions, thus presenting alkalinity. Therefore, biogenic amines are the reason why the culture medium of strain Fusarium sp.NF01 cultured in MM-SGC solid medium presents alkaline culture medium, and the spermidine content in the first group of samples is the highest, accounting for more than 65%, which is the main alkaline substance that makes the culture medium alkaline.

[0122] At the same time, combined with the above-mentioned proteomic analysis results, it was shown that the spermidine synthase secreted by the strain Fusarium sp. NF01 cultivated in MM-SGC solid medium could catalyze putrescine and decarboxylate S-adenosylmethionine to biosynthesize spermidine.

[0123] Example 3: Application of strain Fusarium sp. NF01 in catalytic lignite liquefaction

[0124] From the above research results, it can be seen that the spermidine synthase secreted by the strain Fusarium sp. NF01 cultivated in MM-SGC solid culture medium can catalyze putrescine and decarboxylation of S-adenosylmethionine to biosynthesize spermidine and polyamines.

[0125] Polyamines refer to spermidine, putrescine, and spermine.

[0126] In order to further determine whether the polyamines secreted by the strain Fusarium sp. NF01, namely 65% ​​spermidine, 20.4% putrescine, and 8.4% spermine, are the main cause of lignite bioliquefaction. The present invention selected a polyamine mixed inhibitor: difluoromethylornithine and propionylguanidine hydrazone to conduct a comparative test of lignite bioliquefaction, the purpose of which is to determine the change in the amount of lignite bioliquefaction when the polyamines are inhibited and not inhibited, thereby revealing the cause of lignite bioliquefaction.

[0127] Among them, the polyamine mixed inhibitor was purchased from Shanghai MacLean Biochemical Technology Co., Ltd. Difluoromethylornithine is also known as DFMO; propionylguanidine is also known as MGBG.

[0128] The specific comparative test is as follows:

[0129] The experiment was designed with two groups of control samples, 3 biological replicates in each group, and a total of 6 culture dish samples. The first group of culture dishes were filled with 45mL of sterilized MM-SGC, and polyamine mixed inhibitors, namely 1mmol / L difluoromethylornithine and 1mmol / L propionamizone, were added. The second group of culture dishes were filled with 45mL of sterilized MM-SGC. A ring of Fusarium sp.NF01 mycelium was inoculated in the first and second groups of culture dishes. After 10 days of cultivation, 1.8g of nitric acid pretreated coal samples were evenly placed on the mycelium of the 6 culture dish samples in the first and second groups, with 0.3g of nitric acid pretreated coal samples in each culture dish. Continue to cultivate for 20 days, use a 2.0μL pipette to suck the bioliquefied lignite droplets in each culture dish, and record the amount of bioliquefaction. Among them, propionamizone is also called MGBG. Difluoromethylornithine is also called DFMO.

[0130] The nitric acid pretreatment method is as above.

[0131] The results are as follows Figure 2 As shown, Figure 2 The comparison pictures of lignite being liquefied by biomass with and without inhibitors are shown. Figure 2 Figure A in the figure is the bioliquefaction diagram with the addition of polyamine inhibitors; Figure 2 Figure B shows the bioliquefaction diagram without the addition of polyamine inhibitors.

[0132] After the strain Fusarium sp.NF01 was cultivated on MM-SGC solid medium for 30 days, only 0.28 mL of black droplets of lignite bioliquefaction were collected in the first group, and 2.2 mL were collected in the second group. The amount of lignite bioliquefaction in the first group (with polyamine inhibitors added) was significantly reduced by 87.3% compared with the amount of lignite bioliquefaction in the second group (without polyamine inhibitors added).

[0133] The above results indicate that the polyamines secreted by strain Fusarium sp. NF01 cultured in MM-SGC solid medium, namely 65% ​​spermidine, 20.4% putrescine and 8.4% spermine, are the main causes of lignite bioliquefaction.

[0134] The disclosure of the mechanism of lignite microbial liquefaction by the present invention can effectively promote the industrial process of lignite microbial liquefaction, thereby improving production efficiency, reducing environmental pollution, increasing product value, and significantly reducing mining costs. The Fusarium NF01 provided by the present invention can secrete spermidine synthase to catalyze putrescine and decarboxylate S-adenosylmethionine to biologically prepare spermidine, thereby having an efficient liquefaction ability for lignite.

[0135] Among them, Fusarium NF01 is strain Fusarium sp.NF01.

[0136] The Fusarium NF01 provided by the present invention has the characteristics of cleanliness and safety in the process of catalyzing lignite liquefaction, and can quickly liquefy lignite. Therefore, the Fusarium NF01 provided by the present invention can be used for coal liquefaction, and has the advantages of being environmentally friendly, safe, efficient, and multi-value-added in coal mining and utilization.

[0137] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0138] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic creative concept, and these changes and modifications are all changes and modifications that fall within the scope of the present invention.

Claims

1. Application of Fusarium NF01 in the preparation of spermidine, characterized in that: The Fusarium NF01 is the Fusarium sp. NF01.

2. The use of Fusarium NF01 according to claim 1 in the preparation of spermidine, characterized in that: The Fusarium sp. NF01 strain is inoculated into a culture medium and cultured for 8 to 12 days; The culture medium is a MM-SGC solid culture medium, which is prepared by adding 1.4% to 1.6% agar by mass to a MM-SGC liquid culture medium; The components and final concentrations of the MM-SGC liquid culture medium are: 8g / L-12g / L sodium gluconate, 2g / L-4g / L KH2PO4, 0.5g / L-2.5g / L MgSO4·7H2O, 0.5g / L-1.5g / L (NH)2SO4, 0.05mg / L-0.15mg / L FeSO4·7H2O, 0.1mg / L-0.3mg / L CuSO4·5H2O, 0.5mg / L-1mg / L ZnSO4, and the solvent is water; The Fusarium sp. NF01 strain secretes spermidine synthase, and spermidine is synthesized by the spermidine synthase.

3. The use of Fusarium NF01 in the preparation of spermidine according to claim 2, characterized in that: The culture condition is a constant temperature culture of 28°C to 32°C.

4. The use of Fusarium NF01 in the preparation of spermidine according to claim 2, characterized in that: The method for inoculating the Fusarium sp. NF01 is as follows: the mycelium of the Fusarium sp. NF01 is directly inoculated into the culture medium.

5. Application of Fusarium NF01 in catalyzing lignite liquefaction, characterized in that: After the Fusarium sp. NF01 of claim 2 is cultured in a culture medium for 8 to 12 days, lignite is placed on the hyphae grown by the Fusarium sp. NF01 and the culture is continued for 17 to 23 days; The Fusarium sp. NF01 is used to secrete putrescine, spermine, tyramine, phenylethylamine and tryptamine, and acts on lignite together with spermidine to catalyze lignite liquefaction.

6. The use of Fusarium NF01 in catalyzing lignite liquefaction according to claim 5, characterized in that: The amount of lignite placed on the hyphae grown by the Fusarium sp. NF01 strain is: the mass ratio of the volume of the culture medium to the lignite is: 50 mL: 0.28 g to 0.32 g; The particle size of the lignite is 0.070 cm to 0.078 cm.

7. The use of Fusarium NF01 in the preparation of spermidine according to claim 5, characterized in that: The lignite is lignite pretreated with nitric acid.

8. The use of Fusarium NF01 in the preparation of spermidine according to claim 7, characterized in that: The method of the nitric acid pretreatment is: Mix the lignite and concentrated nitric acid and leave for 36 to 72 hours; Wherein, the mass ratio of the lignite to the concentrated nitric acid is 1:3-5; The concentration of the concentrated nitric acid is greater than or equal to 6 mol / L.

9. The use of Fusarium NF01 in the preparation of spermidine according to claim 8, characterized in that: The concentration of the concentrated nitric acid is 6 mol / L nitric acid.

Images