Construction method and application of succinic acid-producing escherichia coli genetically engineered bacterium

Abstract

The invention discloses a construction method and application of succinic acid-producing escherichia coli genetically engineered bacteria, and belongs to the technical field of biology. The method comprises the following steps: knocking out a lactic dehydrogenase coding gene ldhA and a phosphate acetyltransferase coding gene pta in Escherichia coli, blocking lactic acid and formic acid production pathways, amplifying a ppc gene, a pck gene and a zwf gene, constructing a recombinant plasmid, and improving the carbon dioxide immobilization capability of the strain by overexpressing the ppc gene, so that the carbon dioxide immobilization capability of the strain is improved. The pck gene and the zwf gene are overexpressed for cofactor regulation and control to balance the cell growth and metabolism rate, and the engineering bacterium E.coli K12-ppc-pck-zwf (delta ldhA-delta pta) is obtained through screening. The obtained engineering bacteria are subjected to cell proliferation under an aerobic condition, succinic acid accumulation is performed under an oxygen limiting condition, the yield of succinic acid is increased to 160%, and the engineering bacteria have wide industrial application prospects and market values.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a construction method and application of a succinic acid-producing Escherichia coli genetic engineering bacterium. Background Art

[0002] As a direct or indirect synthetic intermediate of many important chemicals, succinic acid is widely used in the synthesis of chemical products such as 1,4-butanediol, tetrahydrofuran, new green solvents, and high molecular polymers, and has high commercial value. In recent years, with the rapid development and gradual maturity of bioengineering technology, the production of succinic acid by biofermentation has the advantages of both resource renewable utilization and CO absorption. 2 These advantages have broad development potential and are receiving more and more attention.

[0003] In E. coli, succinate can be synthesized through a variety of pathways, but the wild-type E. coli has insufficient reducing power, produces more byproducts, and produces less succinate. The production of succinate can be effectively increased by blocking the byproduct synthesis pathway, strengthening the succinate synthesis pathway, and improving the reducing power. The main function of phosphoenolpyruvate carboxylase (PPC) is to catalyze the conversion of phosphoenolpyruvate (PEP) and CO 2 Oxaloacetate (OAA) is generated, and the generated OAA enters the tricarboxylic acid cycle and finally generates succinate under the action of other enzymes. Phosphoenolpyruvate carboxykinase (PCK) can also catalyze the synthesis of OAA from PEP, and its catalytic process will generate ATP, which is beneficial to the synthesis of succinate. Under oxygen-limited conditions, intracellular ATP production is directly related to cell growth and succinate accumulation. Expressing PCK in Escherichia coli can produce additional ATP, which is coupled with cell growth and increases succinate production. Combined optimization of the expression of the two enzymes PPC and PCK can effectively increase succinate production. On the other hand, overexpression zwf The gene will enhance the flow of the pentose phosphate pathway, thereby increasing the synthesis of NAD(P)H and 5-phosphoribose. Red homologous recombination technology is a commonly used gene editing method for Escherichia coli. The principle is to introduce a fragment carrying homologous sequences on both wings of the target gene into the host bacterial cell, and use the action of the lambda phage Red recombinase to make the linear DNA fragment introduced into the cell undergo homologous recombination with the specific target sequence of the chromosome, thereby replacing the target gene. Using this knockout system, researchers can knock out more than 40 genes in Escherichia coli and successfully achieve gene editing of Escherichia coli. Many studies have shown that knocking out the acetic acid synthesis gene ackA and pta It plays a key role in activating the glyoxylate pathway. ldhA , ptsG and ackA-pta Gene, carbon flow will further flow to the TCA reduction pathway, and part of the carbon flow will flow to the glyoxylate branch, and the succinate yield has been significantly improved. Studies have reported that by constructing the lactate dehydrogenase gene ldhA Inactivating mutant strains, blocking the main redundant metabolic branch, and fermenting with corn starch industrial waste corn pulp as a nitrogen source can increase the yield to 59.3 g / L. In addition, with the help of cofactor engineering, sufficient ATP and NADH are provided for the reductive tricarboxylic acid pathway, which reduces consumption and strengthens synthesis, increasing the yield by 17.81% compared with the starting strain.

[0004] The present invention uses Escherichia coli as the starting strain and utilizes homologous recombination strategy to modify the lactate dehydrogenase gene that affects the production of succinic acid byproducts. ldhA and phosphate acetyltransferase encoding genes pta knockout and overexpression of CO in the succinate biosynthesis pathway 2 Fixed key enzyme phosphoenolpyruvate carboxylase gene ppc , strengthen the CO involved in the succinate synthesis pathway 2 Fixed and overexpressed pck and zwf The gene is used to regulate the balance of cofactors and construct a recombinant Escherichia coli that does not produce byproducts such as lactic acid and formic acid and produces high succinic acid. The main differences between the relevant comparative documents and the invention patent of this application are listed below, as shown in Table 1.

[0005] Table 1 Main differences between the relevant comparative documents and the invention patent of this application Summary of the invention

[0006] The present invention provides a method for constructing a genetically engineered bacterium for producing succinic acid Escherichia coli and its application, and uses homologous recombination technology to knock out the lactate dehydrogenase gene in the host bacterium. ldhA , phosphate acetyltransferase encoding gene pta , and overexpressed CO in the succinate biosynthesis pathway 2 Fixed key enzyme phosphoenolpyruvate carboxylase gene ppc and phosphoenolpyruvate carboxykinase gene that enhances ATP and NADH supply pck Glucose-6-phosphate dehydrogenase zwf Gene, which increases the production of succinic acid.

[0007] The first object of the present invention is to provide a method for constructing a genetically engineered bacterium producing succinic acid, E.coli K12- ppc-pck-zwf (Δ ldhA -Δ pta ); The second purpose is to provide the application of the genetically engineered bacteria producing succinic acid in the production of succinic acid.

[0008] Furthermore, the engineered bacteria E.coli K12- ppc-pck-zwf (Δ ldhA -Δ pta ) is to use PCR technology to first amplify the resistance selection gene ldhA and pta Knock out the frame fragment and then ldhA Knockout box fragments and pta The knockout frame fragment was transferred into the knockout starting strain with pKD46 plasmid by electroporation. E.coli In K12, resistance is finally eliminated and overexpression ppc Gene, pck Genes and zwf Gene finally got it.

[0009] Furthermore, the ldhA The knockout cassette fragment was amplified using pKD4 as a template, including ldhA The homology arms of 40-60 bp upstream and downstream of the gene, pta The knockout cassette fragment was amplified using pKD4 as a template, including pta Homology arms 40-60 bp upstream and downstream of the gene, ppc Gene, pck Genes and zwf Gene from Escherichia coli E.coli K12.

[0010] Furthermore, the encoding ldhA The nucleotide sequence of the gene knockout frame fragment is shown in SEQ ID NO.1, encoding the pta The nucleotide sequence of the gene knockout frame fragment is shown in SEQ ID NO.2, encoding the ppc The nucleotide sequence of the gene is shown in SEQ ID NO.3, encoding the pck The nucleotide sequence of the gene is shown in SEQ ID NO.4, encoding the zwf The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0011] Furthermore, the PCR amplification system involved in the genes is 25-50 μL: ①2×Rapid TaqMaster Mix: 12.5-25 μL; ②Genomic template (10-100 ng / μL): 0.5-1 μL; ③Upstream primer F (10 μmol / L): 1-2 μL; ④Downstream primer R (10 μmol / L): 1-2 μL; ⑤Add ddH 2 Add 3% HO to make up to 25-50 μL.

[0012] Furthermore, the PCR amplification conditions are: ①95℃: 3 min; ②95℃: 15 s; ③annealing temperature (55-65℃): 15 s; ④72℃: 15 s / kb; ⑤72℃: 5 min, (②-④ cycles 30-35 times).

[0013] Furthermore, the succinic acid-producing Escherichia coli genetically engineered bacteria overexpress ppc The gene fragment was expressed using pET-28a as an expression vector. pck and zwf The gene was expressed using pACYCDuet-1 as an expression vector, and then the expression vector was co-transfected into the gene knockout bacteria E.coli K12(Δ ldhA-Δpta ) and finally obtained the recombinant bacteria E.coli K12- ppc- pck-zwf (Δ ldhA -Δ pta ).

[0014] Furthermore, the recombinant bacteria obtained by screening E.coli K12- ppc-pck-zwf (Δ ldhA -Δ pta ) is inoculated into the seed culture medium to obtain the seed culture solution; the culturing time of the seed culture solution is 10-20 h; the culturing temperature of the seed culture solution is 25-45°C, and the shaking speed is 180-200 r / min.

[0015] Furthermore, the seed culture medium formula is: tryptone 5-15 g / L, yeast extract 3-10 g / L, NaCl 5-15 g / L.

[0016] Further, the seed culture solution is inoculated into the fermentation medium at 6-12% (v / v), and cultured to the end of the logarithmic growth phase, at which time a pH neutralizer is added to adjust the pH range of succinic acid fermentation to 6.2-7.2. The pH neutralizer is Na 2 CO 3 , K 2 CO 3 , NaOH, KOH, CaCO 3 MgCO 3 One or a mixture of several.

[0017] Furthermore, by introducing CO 2 Gas or 10-20 g / L bicarbonate, or both, are added to the oxygen-limited condition, and the bottle mouth is sealed to start fermentation. The fermentation temperature is 30-38°C, the fermentation time is 12-78 h, and the shaking speed is 120-150 r / min.

[0018] Furthermore, the fermentation medium formula is: glucose 30-40 g / L, yeast extract 3-10 g / L, tryptone 10-20 g / L, CaCl 2 0.25-1 g / L, K 2 HPO 4 0.5-1.5 g / L, KH 2 PO 4 1-2 g / L, (NH 4 ) 2 SO 4 3-10g / L, MgSO 4 7H 2 O 0.5-2 g / L, NaHCO 3 30-50 g / L.

[0019] Furthermore, during the oxygen-limiting stage, the glucose concentration was controlled to be 5-15 g / L.

[0020] Furthermore, a fermentation broth containing succinic acid is obtained.

[0021] Furthermore, the organic acid content was determined by high performance liquid chromatography. Method: The fermentation broth was centrifuged in a high-speed centrifuge, and then the supernatant was taken and the succinic acid standard was prepared into standard solutions of different concentrations according to the proportion. The fermentation broth and the standard solution were filtered through a 0.45 μm microporous membrane and detected by a chromatographic separation column and a UV detector.

[0022] The present invention has the following beneficial effects: The present invention adopts homologous recombination strategy to knock out the related enzymes encoded by the byproducts affecting the production of succinate, and blocks the lactate and formate production pathways by knocking out the genes encoding lactate dehydrogenase and phosphate acetyltransferase; at the same time, overexpressing phosphoenolpyruvate carboxylase strengthens the CO involved in the succinate synthesis pathway. 2 fixation; further overexpression of phosphoenolpyruvate carboxykinase gene pck Glucose-6-phosphate dehydrogenase zwf Genes were added to increase the supply of ATP and NADH, balance cell growth and metabolic rate, and construct engineered strains with significantly improved succinic acid production.

[0023] Genetically engineered strain constructed by the present invention E.coli K12- ppc-pck-zwf ( ΔldhA-Δpta ), the succinic acid production reached 90 g / L after 48 hours of fermentation and 96.1 g / L after 72 hours, and the production was 160% of that of the original strain. This shows that compared with the original strain, the utilization of carbon flow is effectively improved, the fermentation process is simple, and it has broad industrial application prospects and market value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1: Histogram of succinic acid production at different fermentation times Figure 2: Gel validation of lactate dehydrogenase knockout Figure 3: Gel validation of knockout of phosphate acetyltransferase Figure 4: Structure of the recombinant vector expressing phosphoenolpyruvate carboxylase DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention. Without departing from the spirit and scope of the present invention, those skilled in the art may modify or change the technical solution of the present invention, and such modifications and changes are also included in the scope of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the reagents and materials used, unless otherwise specified, can be obtained from commercial channels.

[0027] Example 1: Construction of genetically engineered Escherichia coli producing succinic acid ldhA Gene knockout cassette fragment upstream primer ldhA-F The sequence is shown in SEQ ID NO.6, and the downstream primer ldhA-R The sequence is shown in SEQ ID NO.7. First, plasmid pKD4 was used as a template and the synthetic primers ldhA-F / ldhA-R Perform PCR amplification to obtain ldhA Gene knockout frame fragment, PCR amplification system: ①2×Rapid Taq Master Mix: 12.5-25 μL; ②Genomic template (10-100 ng / μL): 0.5-1 μL; ③Upstream primer F (10 μmol / L): 1-2 μL; ④Downstream primer R (10 μmol / L): 1-2 μL; ⑤Add Sterilized ddH2O to make up to 25-50 μL; PCR amplification conditions: ①95℃: 3min; ②95℃: 15 s; ③Annealing temperature (55-62℃): 15 s; ④72℃: 15 s / kb; ⑤72℃: 5 min, (②-④ cycle 28-32 times). Then transform the pKD46 plasmid into E.coli K12 competent cells were used to obtain the knockout strain containing the pKD46 plasmid. ldhA The knockout frame fragment was transferred into the knockout strain containing the pKD46 plasmid by electroporation, and the positive transformants were screened by Kan resistance plate. Finally, the Kan resistance gene was eliminated by heat-induced FLP recombinase expression with the help of the thermosensitive plasmid pCP20. The culture was transferred three times at 42°C to eliminate the thermosensitive plasmids pKD46 and pCP20. Sequencing verification was performed, and the lactate dehydrogenase knockout strain was successfully obtained. E.coli K12( ΔldhA ).

[0028] pta Gene knockout cassette fragment upstream primer ptaX-F The sequence is shown in SEQ ID NO.8, and the downstream primer ptaX-R The sequence is shown in SEQ ID NO.9. First, plasmid pKD4 was used as a template and the synthetic primers ptaX-F / ptaX-R Perform PCR amplification to obtain pta The gene knockout frame fragment, PCR amplification system and conditions are the same as above. Then the pKD46 plasmid is transformed into E.coli K12( ΔldhA ) competent cells to obtain the knockout strain containing the pKD46 plasmid. pta The knockout frame fragment was transferred into the knockout strain containing the pKD46 plasmid by electroporation, and the positive transformants were screened by Kan resistance plate. Finally, the Kan resistance gene was eliminated by heat-induced FLP recombinase expression with the help of the thermosensitive plasmid pCP20. The culture was transferred three times at 42°C to eliminate the thermosensitive plasmids pKD46 and pCP20. Sequencing verification was performed, and the lactate dehydrogenase knockout strain was successfully obtained. E.coli K12( ∆ ldhA-∆pta ); Primer sequence (SEQ ID NO.6~9) ldhA -F:AGGCGCTATTCTAGTTTGTGATATTTTTTCGCCACCACAAGGAGTGGAAAGTGTAGGCTGGAGCTGCTTC ldhA -R:ACAGAACGATTAAGTGAATTCGGATGGCGATACTCTGCCATCCGTAATTTTGAATATCCTCCTTAGTTCC ptaX-F:GGTGCTGTTTTGTAACCCGCCAAATCGGCGGTAACGAAAGAGGATAAACCGTGTAGGCTGGAGCTGCTTC ptaX-R:TTATTTCCGGTTCAGATATCCGCAGCGCAAAGCTGCGGATGATGACGAGATGAATATCCTCCTTAGTTCC Phosphoenolpyruvate carboxylase ppc The sequence is shown in SEQ ID NO.3, and the restriction site is designed. ppc Upstream primer ppc-F The sequence is shown in SEQ ID NO.10, and the downstream primer ppc-R The sequence is shown in SEQ ID NO.11. ppc Gene as template, using synthetic primers ppc-F / ppc-R PCR amplification was performed using the same PCR amplification system and conditions as above. The pET-28a plasmid was digested with BamH I and Hind III. ppc The recovered product after gene amplification obtains the linearized vector and the target gene fragment. The linearized vector and the target gene fragment are then connected to obtain the recombinant plasmid pET28a. -ppc , successfully constructed the recombinant plasmid pET28a -ppc Transformed into E. coli E.coli In DH5α competent cells, the correct positive transformants were screened and sequenced to obtain pET28a -ppc Expression vector.

[0029] Phosphoenolpyruvate carboxykinase gene pck The sequence is shown in SEQ ID NO.4, and the restriction site is designed. pck Upstream primer pck-F The sequence is shown in SEQ ID NO.12, and the downstream primer pck-R The sequence is shown in SEQ ID NO.13. pck Gene as template, using synthetic primers pck-F / pck-R PCR amplification was performed using the same PCR amplification system and conditions as above. The pET-28a plasmid was digested with BamH I and Hind III. pck The recovered product after gene amplification was used to obtain the linearized vector and the target gene fragment. The linearized vector and the target gene fragment were then connected to obtain the recombinant plasmid pACYCDuet-1- pck , successfully constructed the recombinant plasmid pACYCDuet-1- pck Transformed into E. coli E.coli In DH5α competent cells, correct positive transformants were screened and sequenced for verification.

[0030] Glucose-6-phosphate dehydrogenase zwf The sequence is shown in SEQ ID NO.5, and the restriction site is designed. zwf Upstream primer zwf-F The sequence is shown in SEQ ID NO.14, and the downstream primer zwf-R The sequence is shown in SEQ ID NO.15. zwf Gene as template, using synthetic primers zwf-F / zwf-R PCR amplification was performed, and the PCR amplification system and PCR amplification conditions were the same as above. pACYCDuet-1- pck Plasmids and zwf The recovered product after gene amplification was used to obtain the linearized vector and the target gene fragment. The linearized vector and the target gene fragment were then connected to obtain the recombinant plasmid pACYCDuet-1- pck-zwf , successfully constructed the recombinant plasmid pACYCDuet-1- pck-zwf Transformed into E. coli E.coli In DH5α competent cells, the correct positive transformants were screened and sequenced to obtain pACYCDuet-1- pck-zwf Expression vector.

[0031] Primer sequence (SEQ ID NO.10~15) ppc-F:CGCGGATCCATGAACGAACAATATTCCGCATT ppc-R:CCCAAGCTTTTTAGCCGGTATTACGCATACCTG pck-F:CGCGGATCCAAATGCGCGTTAACAATGGTTTGACC pck-R:CCCAAGCTTTTACAGTTTCGGACCAGCCG zwf-F:GGAAGATCTATGGCGGTAACGCAAACAGC zwf-R:CGGGGATCCTTACTCAAACTCATTCCAGGAACG Prepared by calcium chloride method E.coli K12( ΔldhA-Δpta ) strain competent, and the correctly sequenced recombinant plasmid pET28a -ppc and pACYCDuet-1- pck-zwf Transfer In E.coli K12( ΔldhA-Δpta ) In the competent state, the final recombinant bacteria were obtained by screening using resistance plates E.coli K12( ΔldhA-Δpta )- ppc .

[0032] Example 2: Fermentation of succinic acid by genetically engineered Escherichia coli The seed culture medium formula is: tryptone 5-15 g / L, yeast extract 3-10 g / L, NaCl 5-15 g / L. The fermentation culture medium formula is: glucose 30-40 g / L, yeast extract 3-10 g / L, tryptone 10-20 g / L, CaCl 2 0.25-1g / L, K 2 HPO 4 0.5-1.5 g / L, KH 2 PO 4 1-2 g / L, (NH 4 ) 2 SO 4 3-10 g / L, MgSO 4 7H 2 O 0.5-2 g / L, NaHCO 3 30-50 g / L. The recombinant bacteria obtained by screening E.coli K12- ppc-pck-zwf (Δ ldhA -Δ pta ) was inoculated into the seed culture medium to obtain the seed culture solution. The culture time was 10-20 h, the culture temperature was 25-45 °C, and the shaking speed was 180-200 r / min. The seed culture solution was inoculated into the fermentation medium at 10-12% (v / v) and cultured to the end of the logarithmic growth phase. At this time, the pH neutralizer Na 2 CO 3 , adjust the pH range of succinic acid fermentation to 6.2-7.2. By adding 10-20 g / L bicarbonate, switch to oxygen-limited conditions, seal the bottle mouth and start fermentation. The fermentation culture temperature is 35-38°C, the fermentation culture time is 24-72 h, and the shaking speed is 120-150 r / min to obtain the fermentation liquid.

[0033] The fermentation broth was centrifuged at 8000-12000 r / min for 5-15 min, the supernatant was collected, and the succinic acid standard was prepared into standard solutions of different concentrations according to the proportion. The fermentation broth and the standard solution were filtered through a 0.45 μm microporous filter membrane, and the content of succinic acid was determined by high performance liquid chromatography (HPLC). Aminex HPX-87H (300×7.8 mm) chromatographic separation column and UV detector were used, the mobile phase was 0.02 mol / L potassium dihydrogen phosphate, the column temperature was 30℃, the detection wavelength was 210 nm, the injection volume was 10 μL, and the flow rate was 0.5 mL / min. The yield of succinic acid in the fermentation broth was detected after 48 and 72 hours.

[0034] In summary, the technology of the present invention uses genetic engineering technology to knock out the genes encoding related byproducts: lactate dehydrogenase encoding gene ldhA Phosphate acetyltransferase encoding gene pta , and overexpression of phosphoenolpyruvate carboxylase gene ppc、 Phosphoenolpyruvate carboxykinase gene pck and glucose-6-phosphate dehydrogenase gene zwf Can effectively increase the yield of succinic acid.

Claims

1. A method for constructing a genetically engineered bacterium for producing succinic acid Escherichia coli, characterized in that: The genetically engineered bacteria are based on Escherichia coli K12 as the starting strain, and the lactate dehydrogenase encoding gene in the host bacteria is knocked out. oeLh , phosphate acetyltransferase encoding gene pta , obtain gene knockout strains E. coli K12(Δ oeLh -Δ pta ), and pET-28a was used as an expression vector to overexpress the gene encoding phosphoenolpyruvate carboxylase ppc , and overexpressed using pACYCDuet-1 as an expression vector pck and wxya Genes to construct engineered bacteria E. coli K12- ppc-pck-zwf (Δ ldhA- Δ pta ).

2. The method for constructing a genetically engineered bacterium for producing succinic acid Escherichia coli according to claim 1, characterized in that: Encoded oeLh The nucleotide sequence of the gene knockout frame fragment is shown in SEQ ID NO.1, encoding the pta The nucleotide sequence of the gene knockout frame fragment is shown in SEQ ID NO.2, encoding the ppc The nucleotide sequence of the gene is shown in SEQ ID NO.3, encoding the pck The nucleotide sequence of the gene is shown in SEQ ID NO.4, encoding the wxya The nucleotide sequence of the gene is shown in SEQ ID NO.

5.

3. The method for constructing a genetically engineered bacterium for producing succinic acid Escherichia coli according to claim 1, characterized in that: The oeLh The gene knockout fragment includes oeLh Gene upstream and downstream homology arm sequences and resistance gene expression elements with FLP recombinase recognition sites; pta The gene knockout fragment includes pta Gene upstream and downstream homology arm sequences and resistance gene expression elements with FLP recombinase recognition sites.

4. The method for constructing a genetically engineered bacterium for producing succinic acid Escherichia coli according to claim 1, characterized in that: The resistance gene expression element with the FLP recombinase recognition site is obtained by amplification using pKD4 as a template.

5. Use of the method for constructing a succinic acid-producing genetically engineered Escherichia coli according to any one of claims 1 to 4 in producing succinic acid.

Images