Application of IFI6 gene as target spot in inhibition of replication of serum type 4 fowl adenovirus

Abstract

The invention relates to application of an IFI6 gene as a target spot in inhibition of replication of serum type 4 fowl adenovirus, and belongs to the technical field of gene expression biology. The eukaryotic expression plasmid of the recombinant chicken IFI6 is successfully constructed through overexpression of the IFI6 gene, it is found that the eukaryotic expression plasmid can inhibit replication of the fowl adenovirus type 4, and therefore the IFI6 can serve as a target spot to be used for screening drugs for inhibiting replication of the fowl adenovirus type 4; the invention also finds that the inhibition or silence IFI6 gene can promote the replication of the fowl adenovirus type 4, and the silence IFI6 or its expression inhibitor can be used as the replication or production synergist of the fowl adenovirus type 4; in addition, the invention finds that the replication of the serum type 4 fowl adenovirus can be inhibited by refilling the IFI6 gene. A research tool and a material are provided for researching a molecular mechanism of the IFI6 gene for regulating and controlling virus replication in cells, and the IFI6 gene can also be used for animal breeding of antiserum type 4 fowl adenovirus.

Description

Technical Field

[0001] The invention belongs to the field of gene expression biotechnology, and specifically relates to the use of IFI6 gene as a target in inhibiting the replication of serum type 4 avian adenovirus. Background Art

[0002] Hydropericardium hepatitis syndrome (HHS) is a poultry infectious disease caused by serotype 4 fowl adenovirus (Fowl adenovirus serotype 4) characterized by pericardial effusion and inclusion body hepatitis. It mainly affects 3-5 week old broilers, with a mortality rate of up to 80%. It is one of the major diseases that endanger my country's poultry farming industry. Serotype 4 fowl adenovirus can be transmitted both horizontally and vertically, with horizontal transmission mainly through contact transmission, but it can also be transmitted over short distances through aerosols. HHS was first reported in Angaragoth, Pakistan in 1987, so it is also called Ankara disease, and then spread to various regions around the world. After 2015, the disease occurred in Shandong, China, and then quickly spread throughout the country, gradually threatening the development of the poultry farming industry. The innate immune response is the first line of defense for the host to resist infection by pathogenic microorganisms, and interferon plays a key role in this process. After pathogenic microorganisms infect the host, the host recognizes pathogen-associated molecular patterns through pattern recognition receptors (PRRs) and activates nuclear transcription factors IRF3 / 7 to produce interferon. After being secreted into the extracellular space through autocrine and paracrine forms, it binds to interferon receptors on the cell surface and activates the JAK / STAT signaling pathway to induce the production of interferon-stimulated genes (ISGs), thereby exerting its antiviral function. There are currently few reports on avian interferon-stimulated factors. Our previous studies have found that both type I and type III interferons can induce the expression of interferon-stimulated factor IFI6; at the same time, the transcription of IFI6 mRNA in chicken liver cancer cells (Leghorn male hepatoma cells, LMH) infected with serotype 4 avian adenovirus is significantly downregulated, indicating that chicken IFI6 may be involved in the infection process of serotype 4 avian adenovirus.

[0003] IFI6 is an ISG belonging to the FAM14 family. It plays an important role in the innate immune response and functions in the development of various cancers and antiviral infections. Considering the broad antiviral effects of IFI6, we selected the anti-serum 4 avian adenovirus ISG candidate IFI6 to further explore its anti-serum 4 avian adenovirus function in LMH cells. Currently, IFI6 has been shown to be a key factor in the antiviral infection process of dengue virus, hepatitis B virus, flavivirus, avian reovirus, etc. Summary of the invention

[0004] In view of the above technical problems, the purpose of the present invention is to provide the use of IFI6 gene as a target in inhibiting the replication of serotype 4 avian adenovirus. By overexpressing or inhibiting the IFI6 gene, the correlation between the expression of chicken IFI6 and the proliferation of serotype 4 avian adenovirus is studied. The results show that overexpression of IFI6 can inhibit the replication of serotype 4 avian adenovirus, and inhibition or silencing of the host IFI6 gene can promote the replication of serotype 4 avian adenovirus. This provides research tools and materials for studying the molecular mechanism of IFI6 gene regulating viral replication in cells, and can also be used for breeding animals resistant to serotype 4 avian adenovirus.

[0005] The specific scheme adopted by the present invention is as follows:

[0006] In the first aspect, the present invention provides an application of an IFI6 gene / protein as a target in screening drugs for preventing or treating serotype 4 avian adenovirus infection. The drug targets the IFI6 gene / protein, overexpresses the IFI6 gene / protein, and constructs a chicken IFI6 eukaryotic expression plasmid.

[0007] To achieve the above purpose, the technical solution adopted is: a method for constructing an expression vector that inhibits the replication ability of serotype 4 avian adenovirus, the method comprising constructing the IFI6 gene onto a basic vector to obtain an expression vector that expresses the IFI6 gene.

[0008] Preferably, the base vector is a eukaryotic expression vector.

[0009] Preferably, the basic vector is a Pcaggs-EGFP-3flag vector with a GFP fluorescent tag. By connecting the IFI6 gene to the Pcaggs-EGFP-3flag vector with a GFP fluorescent tag, the present invention can greatly reduce the amount of viral expression compared to the common method, and can also observe the cell state in time through the fluorescent tag.

[0010] In a second aspect, the present invention provides a method for inhibiting the replication ability of serotype 4 avian adenovirus, the method comprising transfecting the above-mentioned expression vector into cells producing serotype 4 avian adenovirus. The present invention provides a method for inhibiting the replication of serotype 4 avian adenovirus using the autophagy-related gene IFI6 gene, preferably, the IFI6 gene of the present invention is connected to a eukaryotic expression vector Pcaggs-EGFP-3flag vector, which is easy to produce, low in cost, and has a high efficiency in inhibiting the number of viruses, providing a way to stably inhibit the replication of serotype 4 avian adenovirus.

[0011] In a third aspect, the present invention provides the use of the IFI6 gene in inhibiting the replication ability of serotype 4 avian adenovirus.

[0012] In a fourth aspect, the present invention provides use of the above-mentioned expression vector in inhibiting the replication ability of serotype 4 avian adenovirus.

[0013] In a fifth aspect, the present invention provides the use of an IFI6 gene overexpressing cell line in detection for non-diagnostic and therapeutic purposes, or as an animal anti-serum type 4 avian adenovirus breeding cell line.

[0014] In a sixth aspect, the present invention provides the use of an IFI6 gene / protein expression inhibitor in the preparation of a drug for enhancing serotype 4 avian adenovirus infection.

[0015] Preferably, the inhibitor is an RNA fragment that interferes with the expression of the IFI6 gene / protein, or an siRNA that targets the IFI6 gene / protein, or a small molecule compound that downregulates the expression of the IFI6 gene / protein.

[0016] Preferably, the inhibitor is siRNA targeting IFI6 gene / protein.

[0017] Preferably, the inhibitor carries siRNA targeting IFI6 gene / protein and is delivered into an animal via a drug delivery vector to inhibit IFI6 gene expression.

[0018] Preferably, the drug delivery vehicle is a liposome nanoparticle.

[0019] Preferably, the sequence of the siRNA targeting IFI6 gene / protein is: Si-IFI6-2-F:5'-CUAUCCAGUCUAUCUCAAUTT-3'; Si-IFI6-2-R: 5'-AGUAGCAGUAGUCCCUCCATT-3'.

[0020] In a seventh aspect, the present invention provides the use of IFI6 protein or an expression inhibitor thereof in the preparation of a replication enhancer of serotype 4 avian adenovirus or a production enhancer of serotype 4 avian adenovirus vaccine.

[0021] In an eighth aspect, the present invention provides the use of a cell line that inhibits or silences the IFI6 gene as a production cell line for serotype 4 avian adenovirus or vaccine.

[0022] Beneficial effects: ① The present invention successfully constructed a eukaryotic expression vector Pcaggs-EGFP-3flag-IFI6, and achieved the amplification of chicken IFI6. In addition, the Pcaggs-EGFP-3flag vector carries a GFP fluorescent protein gene, and the expression of the target gene can be clearly seen under a fluorescence microscope. Not only can the efficient expression of the connected gene in the cell be guaranteed, but the biological activity of the transfected cells can also be observed under a microscope. ② The present invention found that after overexpression of IFI6, the replication of serum type 4 avian adenovirus can be inhibited, and it can be used as a target for the preparation of drugs that inhibit the replication of serum type 4 avian adenovirus. ③ The present invention first discovered that by inhibiting or silencing the host IFI6 gene, IFI6 or its expression inhibitor can be used as a replication or production enhancer of serum type 4 avian adenovirus, and used for the production of serum type 4 avian adenovirus or vaccine; and the cell line that inhibits or silences IFI6 can be used as a production cell line for serum type 4 avian adenovirus or vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The Western Blot result diagram of overexpression of IFI6 inhibiting the replication of serotype 4 fowl adenovirus; wherein, IFI6: transfected Pcaggs-EGFP-3Flag-IFI6 plasmid; Vector: blank vector Pcaggs-EGFP-3Flag;

[0024] Figure 2 The results of knocking down IFI6 to promote the replication of serotype 4 fowl adenovirus; A: Real-time fluorescence quantitative PCR to detect the knockdown efficiency of siRNA; B: Western Blot results of siRNA interfering with IFI6 to promote the replication of serotype 4 fowl adenovirus;

[0025] Figure 3 This is the result of real-time fluorescence quantitative PCR detection of the effect of IFI6 complementation on the infection and replication of serotype 4 avian adenovirus. DETAILED DESCRIPTION

[0026] The present invention analyzes the correlation between the expression of chicken IFI6 and the proliferation of serotype 4 avian adenovirus by real-time fluorescence quantitative PCR and Western Blot; through overexpression, a eukaryotic expression plasmid of recombinant chicken IFI6 is constructed, and siRNA interference and corresponding complementation experiments are performed to analyze the role of chicken IFI6 in the infection of serotype 4 avian adenovirus, thereby providing research tools and materials for studying the molecular mechanism of IFI6 gene regulating virus replication in cells, and can also be used for animal breeding resistant to serotype 4 avian adenovirus.

[0027] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0028] In the following examples, unless otherwise specified, all reagents used are commercially available and all methods used are conventional operations.

[0029] Example 1: Construction of chicken Pcaggs-EGFP-3Flag-IFI6 eukaryotic expression plasmid

[0030] 1. Primer Design and Synthesis

[0031] According to the predicted sequence of chicken IFI6 gene provided in Genbank (GenBank NM_001001296.6), primers Q-IFI6-F and Q-IFI6-R were designed to amplify chicken IFI6 gene, and primers for real-time fluorescence quantitative PCR detection of serotype 4 avian adenovirus were designed by NCBI.

[0032] The primer sequences for amplification of IFI6 are as follows: Q-IFI6-F:TCAACACACTCCTCAGGCTTTACC; Q-IFI6-F:GAACTCCGCCTCCGCAAGAG.

[0033] The primer sequences for real-time fluorescence quantitative PCR detection of serotype 4 avian adenovirus are as follows:

[0034] q-Hexon-F:CGAGGACTACGACGATTA;

[0035] q-Hexon-R:CGTGATACAGCAGGTTAATG.

[0036] 2. Amplification of Chicken IFI6 Gene

[0037] RNA was extracted from chicken liver cancer cells and reverse transcribed to obtain a cDNA template for amplifying the chicken IFI6 gene. Using this cDNA as a template, the following IFI6-F and IFI6-R primers were used to amplify the desired chicken IFI6 target gene. The PCR reaction system was 50 μL, including 25 μL of Green Taq mix, ddH 2 O 18μL, upstream and downstream primers 2.5μL each, cDNA 3μL. PCR reaction conditions are: pre-denaturation at 95℃ for 3min, denaturation at 95℃ for 30s, primer Tm value annealing for 30s, extension at 72℃ (30s for every 1000bp), 35 cycles, final extension at 72℃ for 5min, PCR set to 16℃ for storage. Load the amplified product onto 1% agarose gel, run at 150V for 15min, and cut the successfully amplified target band under the gel imager for use.

[0038] 3. Recovery of Chicken IFI6 Target Gene

[0039] Use a clean blade to cut the agarose gel block containing the target gene under a long-wave ultraviolet lamp and place it in a 1.5ml centrifuge tube; add 200μL Binding Buffer for every 100mg agarose gel, place in a 55℃~65℃ water bath for 10 minutes, and mix every 2-3 minutes during the period; dissolve the agarose block completely; transfer the dissolved agarose gel to the HiBindTM DNA column, centrifuge at 10,000×g for 1min at room temperature, and discard the liquid; put the column back into the collection tube, add 300μL Binding Buffer to the HiBind DNA column; centrifuge at 10,000×g for 1 minute at room temperature, and discard the filtrate; put the column back into the collection tube, add 700uLSPW Wash Buffer to the HiBind DNA column, centrifuge at 10,000×g for 1 minute at room temperature, and discard the filtrate. Put the column back into the collection tube, repeatedly add 700μL SPW Wash Buffer to the HiBindDNA column, centrifuge at 10,000×g for 1 minute at room temperature, and discard the filtrate; discard the liquid, put the empty column back into the collection tube, centrifuge at 10,000×g for 1 minute to shake off the residual liquid in the column matrix; install the column in a clean 1.5mL centrifuge tube, add 30-50μL elution buffer or sterile water onto the column membrane, centrifuge at 10,000×g for 1 minute, and the solution in the centrifuge tube is the purified DNA product, which should be stored at -20 degrees.

[0040] 4. Construction of recombinant eukaryotic expression plasmid Pcaggs-EGFP-3Flag-IFI6.

[0041] Pcaggs-EGFP-3Flag was linearized using designed primers, as shown in Table 1. Full-length amplification primers containing homology arms of the linearized vector were designed using the online primer design software CE Design based on the chicken IFI6 sequence published on NCBI.

[0042] Table 1 Primers used for the construction of IFI6 eukaryotic expression plasmid

[0043] Using Pcaggs-EGFP-3Flag plasmid as template, dilute the template to 1ng / μL, and use Qingke Gold Mix for PCR amplification, including: Gold Mix 45μL, 10μM upstream and downstream primers 2μL each, cDNA 1μL. PCR reaction conditions are: pre-denaturation at 98℃ for 2min, denaturation at 98℃ for 10s, primer Tm value annealing for 15s, extension at 72℃ (extension for 15s per 1000bp), after running 35 cycles, final extension at 72℃ for 5min, PCR settings 12℃ storage. The amplified products were separated by 1% agarose gel electrophoresis, and the target bands were cut for gel recovery. The linearized vector recovered from the gel and IFI6 were connected by homologous recombination, wherein: linearized Pcaggs-EGFP-3Flag 111.14ng, IFI6 12.84ng, 2×CE Mix 5μL, ddH2O was added to make up the system to 10μL. The system was prepared on ice, reacted on a PCR instrument at 50℃ for 5min, and then cooled on ice.

[0044] 5. Transformation and identification of recombinant expression plasmid

[0045] Add 10 μL of the obtained ligation product to 100 μL of competent cells DH5a, mix gently, and place on ice for 30 minutes. After 90 seconds of heat stress at 42°C, quickly place on ice for 2 minutes. Add 900 μL of LB liquid culture medium, place in a shaker, shake at 37°C, 150 r / min for 1 hour. Centrifuge at 5000 r / min for 5 minutes. Discard the culture medium, add 200 μL of fresh LB liquid culture medium to resuspend, take the resuspended bacterial solution and spread it on the ampicillin-resistant LB solid culture medium plate. After the bacterial solution is completely absorbed, put it in an incubator and culture it upside down at 37°C for 12 to 16 hours. After cultivation, pick the colony and culture it in ampicillin-resistant LB culture medium, use the bacterial solution PCR method to screen the positive clones, and obtain the recombinant eukaryotic expression plasmid.

[0046] 6. Transfection of recombinant expression plasmid

[0047] Select cells with good growth in the logarithmic phase and pass them into 6-well plates. The cultured LMH cells can be used for transfection when the density reaches 70%-80% within 24 hours. Dilute 2μg of the constructed recombinant plasmid and 4μL of transfection reagent Lipofectamine2000 with an equal volume of DMEM / F12, flick to mix, then add 0.5μg and 1μg of plasmid respectively, shake and mix, and place at room temperature for 15 minutes. During the static process, wash the cells in the 6-well plate with DMEM / F12 medium and mark them. Place at 37°C, 5% CO 2After 5-6 hours of culture in an incubator, replace with DMEM containing 2% FBS and continue to culture for 24-72 hours. Perform tests at different time points according to the purpose of the experiment. Inoculate the transfected cells with serum type 4 avian adenovirus strain. Collect cells 24 hours after inoculation to extract RNA for subsequent testing.

[0048] 7. Detection of serotype 4 avian adenovirus in transfected cells

[0049] Collect total protein from cells. First, prepare the lysis solution: add 10μL PMSF to 1mL RIPA (medium) lysis solution and shake thoroughly. First, add an appropriate amount of pre-cooled PBS to each 35mm cell culture dish to gently wash away the culture medium, add 120-150μL lysis solution, lyse on ice for several minutes, scrape the cells with a cell scraper and move them to a 1.5mL centrifuge tube. Centrifuge at 12000rmp, 4℃ for 10min, transfer the supernatant to a new centrifuge tube, and use the BCA method to determine the protein concentration. Add an appropriate amount of 5×SDS to the collected protein, mix well by blowing, heat in a 100℃ metal bath for 10min, centrifuge at 12,000rpm for 1min, and take the supernatant for polyacrylamide gel electrophoresis. After the procedure, the membrane was blocked with TBST containing 5% skim milk for 1 hour; the primary antibody (mouse anti-Hexon antibody and rabbit anti-GAPDH) was incubated overnight at 4°C, and the membrane was washed 3 times with 1×TBST, each time for 5 minutes; the secondary antibody (HRP-conjugated goat anti-rabbit secondary antibody, HRP-conjugated goat anti-mouse secondary antibody) was incubated on a shaker at room temperature for 1 hour, and the membrane was washed 3 times with 1×TBST, each time for 5 minutes, and the luminescent substrate ECL developer was added to the nitrocellulose membrane, exposed and developed, and the protein expression level of the LMH cell line overexpressing the IFI6 gene was verified. The results are as follows Figure 1 As shown, when a lower dose of Pca-IFI6-EGFP-3Flag plasmid was transfected, the replication of serotype 4 avian adenovirus could be significantly inhibited.

[0050] Example 2: IFI6 gene knockdown LMH cell line

[0051] 1. Design of siRNA targeting IFI6 gene

[0052] According to the sequence of IFI6, three pairs of siRNA were designed for this gene and synthesized by Shanghai Bioengineering Co., Ltd. The sequence information is shown in Table 2:

[0053] Table 2 siRNA sequences

[0054] 2. Cell Transfection

[0055] LMH cells were plated in 6-well plates, and when the cell confluence reached 50% to 80%, siRNA transfection was performed. Three pairs of siRNA corresponding to the IFI6 gene were transfected into the cells, and a disordered RNA transfection group was set up as a negative control (NC).

[0056] 3. After transfection, the IFI6 knockdown efficiency was detected by real-time fluorescence quantitative PCR.

[0057] 24 hours after transfection, the cell pellet was collected, total RNA was extracted, and reversed to cDNA. The obtained cDNA was diluted 10-100 times so that the internal reference was between 15 and 35. The real-time fluorescence quantitative PCR reaction system was prepared, including 2×ChamQUniversal SYBR qPCR Master Mix 10μL, 10μM upstream and downstream primers 0.4μL each, cDNA 1μL, ddH 2 O8.2μL. The real-time fluorescence quantitative PCR reaction program is 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s, 60℃ denaturation for 30s, a total of 40 cycles; melting curve 95℃ 5s, 65℃~95℃ 5s. After the reaction is completed, check the melting curve, and establish a standard curve if there is no abnormality. Use 2 -ΔΔCT The relative amount was determined by the method and normalized using β-actin as an internal reference. Figure 2 As shown in A, all three pairs of siRNAs have good knockdown effects.

[0058] 4. Detection of serotype 4 avian adenovirus in transfected cells

[0059] Three pairs of siRNA corresponding to the IFI6 gene were transfected into cells, and a random RNA transfection group was set up as a negative control. 24 hours after transfection, 0.1 MOI of serotype 4 fowl adenovirus was inoculated, and 24 hours later, the cell pellet was collected for Western Blot. The results are shown in Figure 2 As shown in B, knockdown of IFI6 promoted the infection and replication of serotype 4 avian adenovirus in LMH cells.

[0060] Example 3: IFI6 gene complementation of LMH cell line

[0061] IFI6 knockdown and IFI6 knockdown complement experiments were performed on LMH cells. 0.1 MOI of serotype 4 avian adenovirus was inoculated 48 hours later, and cell samples were collected 24 hours after infection. Total RNA was extracted and real-time fluorescence quantitative PCR was performed. The results are shown in Figure 3As shown in the figure, after knocking down IFI6, the transcription level of IFI6 was significantly reduced; after knocking down IFI6 and then overexpressing IFI6, the transcription level of IFI6 was significantly increased. Compared with the control group, the transcription level of serum type 4 avian adenovirus Hexon was the highest in the IFI6 knockdown group, and the transcription level of serum type 4 avian adenovirus Hexon was significantly reduced after IFI6 complementation.

[0062] The above results indicate that knocking down the IFI6 gene in LMH cells can significantly promote the replication of serotype 4 avian adenovirus and be used in the preparation of drugs for the reproduction of serotype 4 avian adenovirus infection.

[0063] The present invention firstly finds that by overexpressing the host IFI6 gene, the eukaryotic expression plasmid of recombinant chicken IFI6 can inhibit the replication of serotype 4 avian adenovirus, and can be used as a target for preparing a method for inhibiting serotype 4 avian adenovirus; secondly, the present invention provides a siRNA specifically targeting the IFI6 gene, and the siRNA can specifically target the IFI6 gene and enhance the replication of serotype 4 avian adenovirus in cells. Furthermore, by using the IFI6 gene / protein overexpression cell line as a target, drugs for preventing or treating serotype 4 avian adenovirus infection can be screened, providing a new idea for the prevention and control of serotype 4 avian adenovirus; finally, the present invention finds that after inhibiting or silencing IFI6, the replication of serotype 4 avian adenovirus can be significantly promoted. Therefore, IFI6 or its inhibitor can be used as a replication or production enhancer of serotype 4 avian adenovirus, and used for the production of serotype 4 avian adenovirus or vaccine; and the cell line inhibiting or silencing IFI6 can be used as a production cell line of serotype 4 avian adenovirus or vaccine.

[0064] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. Use of a compound for increasing the activity of IFI6 protein or overexpressing IFI6 gene in the preparation of a drug for preventing or treating serotype 4 avian adenovirus infection or chicken pericardial effusion-hepatitis syndrome caused by serotype 4 avian adenovirus infection, characterized in that: The IFI6 protein is encoded by the IFI6 gene, and the IFI6 gene is a chicken IFI6 gene, and the GenBank number of the sequence is NM_001001296.6; The compound is an IFI6 gene / protein overexpression cell line.

2. The use according to claim 1, characterized in that: The overexpression cell line is obtained by constructing the IFI6 gene into a basic vector to obtain an expression vector expressing the IFI6 gene, and then transfecting the expression vector into a host cell; The basic vector is a Pcaggs-EGFP-3flag vector with a GFP fluorescent tag.

3. Application of IFI6 gene overexpressing cell lines as breeding cell lines for animal anti-serum type 4 avian adenovirus, or as detection cell lines for non-diagnostic and therapeutic purposes.

4. A method for inhibiting the replication ability of serotype 4 fowl adenovirus, characterized in that: The IFI6 gene is constructed into a basic vector to obtain an expression vector expressing the IFI6 gene, and then the expression vector is transfected into a host cell; The basic vector is a Pcaggs-EGFP-3flag vector with a GFP fluorescent tag.

5. Application of IFI6 gene / protein expression inhibitor in the preparation of replication enhancer of serotype 4 avian adenovirus or production enhancer of serotype 4 avian adenovirus vaccine.

6. Application of cell lines with suppressed or silenced IFI6 gene as production cell lines for serotype 4 avian adenovirus or vaccines.

7. An IFI6 gene / protein expression inhibitor, characterized in that: The inhibitor is an RNA fragment that interferes with the expression of the IFI6 gene / protein, or an siRNA that targets the IFI6 gene / protein, or a small molecule compound that downregulates the expression of the IFI6 gene / protein.

8. The IFI6 gene / protein expression inhibitor according to claim 7, characterized in that The inhibitor is siRNA targeting IFI6 gene / protein, and the siRNA targeting IFI6 gene / protein is delivered into an animal via a drug delivery vector to inhibit IFI6 gene expression.

9. The IFI6 gene / protein expression inhibitor according to claim 8, characterized in that The drug delivery carrier is liposome nanoparticles.

10. The IFI6 gene / protein expression inhibitor according to claim 8, characterized in that The sequence of the siRNA targeting the IFI6 gene / protein is: Si-IFI6-2-F:5'-CUAUCCAGUCUAUCUCAAUTT-3'; Si-IFI6-2-R: 5'-AGUAGCAGUAGUCCCUCCATT-3'.

Images