Kazakstan yeast JM1503 and application thereof in composite leavening agent

Abstract

The invention relates to Kazakstan yeast JM1503 and application of the Kazakstan yeast JM1503 in a composite leavening agent. The Kazakstein yeast JM1503 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.32117, and the preservation date is September 29, 2024. The Kazakstan yeast JM1503 provided by the invention is a new strain separated from a leavening dough sample, and has the advantages of good safety and strong fermentation capability of the strain. Meanwhile, the composite leavening agent containing the strain can replace a leavening agent of the sour dough through mutual cooperation of various strains, so that the steamed buns prepared by adopting the composite leavening agent not only have the fermentation flavor of the sour dough, but also improve the taste, luster and color of the steamed buns, and more importantly, the preparation time of the steamed buns is saved, and the production cost is reduced. And 8-10 hours of fermentation of the leavening dough in the previous day is not needed, so that the production efficiency is greatly improved. Meanwhile, the compound leavening agent is adopted, so that steamed buns can be produced in a batch copying manner, industrial popularization and production are facilitated, and the application prospect is good.

Description

Technical Field

[0001] The present application relates to the field of microorganisms and food fermentation technology, and in particular to a Kazakh yeast JM1503 and its application in a composite starter. Background Art

[0003] The main factors affecting the quality of steamed bread during production include flour raw materials, leavening agents and production processes. Dough fermentation is the most critical link in the production process, which directly affects the quality of steamed bread. There are many methods for dough fermentation, including primary fermentation, secondary fermentation, yeast fermentation and old dough fermentation. Currently, commercially available steamed bread is mainly made of highly active dry yeast, which has a fast fermentation speed and stable product quality, making it more suitable for industrial production. However, because it is fermented with pure yeast, the flavor of steamed bread is relatively simple, the fragrance is not strong, and the sensory quality and re-steaming performance are poor.

[0004] Old dough steamed buns are mainly made by mixed fermentation of wild yeast and other strains. After each fermentation, a portion of the dough is left as the source of strains for the next fermentation, which is old dough. Old dough steamed buns are made by steaming old dough as a fermentation agent through a steamed bun fermentation process. Compared with yeast steamed buns, the number and activity of yeasts contained in it are relatively low, so the fermentation power is low and the dough fermentation time is relatively long. However, the fermentation of yeast and lactic acid bacteria in old dough can increase the types and content of steamed bun flavor substances. The production of organic acids and their esterification reaction are one of the important reasons for its rich flavor, which makes the steamed buns have a full sweet taste, which is what people often call "steamed bun flavor" and "old yeast flavor".

[0005] Due to the various limitations of unstable industrial production process, long fermentation cycle, low efficiency, etc., old dough steamed bread has not been widely promoted. At the same time, in the industrial production process, there are problems such as the non-uniform fermentation state of old dough in factories in different regions, unstable batches, and difficulty in quality supervision. Therefore, a composite leavening agent that can produce the flavor of old dough fermentation is provided, which can shorten the fermentation time and restore the flavor of old dough steamed bread to the greatest extent, thereby optimizing the production process and solving the problem of standardized old dough management. Summary of the invention

[0006] In order to address the deficiencies of the prior art, the present application provides a Kazakhstan yeast JM1503 and a composite leavening agent containing the Kazakhstan yeast JM1503 for producing an old dough fermentation flavor. The steamed buns prepared using the composite leavening agent have a flavor close to that of the old dough steamed buns prepared using old dough fermentation. They not only have the old dough fermentation flavor, but also improve the taste, gloss and color of the steamed buns, and save the time for making the steamed buns.

[0007] To this end, the first aspect of the present application provides a Kazakh yeast JM1503, wherein the Kazakh yeast (Kazachstania humilis) JM1503 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC No.32117 and a deposit date of September 29, 2024.

[0008] The inventor of this application obtained a strain with excellent fermentation ability by isolating and screening old dough samples from an industrial workshop in Shijiazhuang, Hebei. At the same time, the steamed bread fermented by the composite leavening agent containing the strain has a flavor close to that of old dough steamed bread. It not only has the flavor of old dough fermentation, but also improves the taste, gloss and color of the steamed bread, and saves the time of making steamed bread. According to the analysis of experimental data such as cell morphology and 16S rRNA gene sequence, it was identified as "Kazakhstan Yeast" and officially named "Kazakhstan Yeast JM1503". The strain was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on September 29, 2024, with the deposit number CGMCC No.32117.

[0009] In some embodiments, the nucleotide sequence of 16S rRNA of the Kazakh yeast JM1503 is shown in SEQ ID NO:1.

[0010] In the present application, the nucleotide sequence of the 16S rRNA is the gene sequence of the 16S rRNA of the Kazakh yeast JM1503.

[0011] The second aspect of the present application provides a use of the Kazakh yeast JM1503 as described in the first aspect of the present application in preparing steamed bread and / or bread with old-fashioned fermentation flavor.

[0012] The Kazakh yeast JM1503 in this application is screened and separated from old dough samples, and has good safety; the strain has strong fermentation ability and excellent gas and alcohol production ability. At the same time, the steamed bread fermented by the composite starter containing the strain is close to the flavor of the old dough steamed bread prepared by old dough fermentation. It not only has the flavor of old dough fermentation, but also improves the taste, gloss and color of the steamed bread, and saves the time of making steamed bread.

[0013] The third aspect of the present application provides a composite leavening agent for producing old-dough fermentation flavor, characterized in that the composite leavening agent includes the Kazakhstan yeast JM1503 as described in the first aspect of the present application.

[0014] The composite leavening agent provided in the present application contains the Kazakhstan yeast JM1503. By testing the texture, color, gloss, etc. of the steamed buns made with the composite leavening agent, it is found that the steamed buns made with the composite leavening agent are brighter and whiter than the old steamed buns. Generally, the color of the old steamed buns is darker and yellower, and the taste is not delicate enough. The steamed buns made with the composite leavening agent instead of the old leavener not only have the flavor of the old steamed buns, but also improve the taste, gloss and color. And most importantly, it saves the time of making steamed buns, and there is no need to ferment the old dough for 8-10 hours a day in advance, which greatly improves the production efficiency. At the same time, by using the composite leavening agent, the steamed buns can be reproduced in batches, which is more conducive to industrialized production.

[0015] In some embodiments, the composite leavening agent further includes lactic acid bacteria; the lactic acid bacteria include Lactobacillus plantarum and Weissella sinensis.

[0016] In the present application, Weissella cibaria has unique fermentation characteristics, and currently there are already developed fermented foods, such as yogurt, cheese or fermented drinks with special flavors, which bring consumers a new taste bud experience. Weissella cibaria produces beneficial substances, such as probiotics, enzymes and other bioactive ingredients in the process of food fermentation, which improve the nutritional value and health care function of food. The inventors of the present application screened the fermentation bacteria and found that the composite leavening agent prepared by compounding Weissella cibaria, Lactobacillus plantarum and the Kazakhstan yeast JM1503 provided in the present application can replace the old dough leavener to make steamed buns with the old dough fermentation flavor.

[0017] In the present application, the specific strains of lactic acid bacteria in the composite fermentation agent can be purchased through commercial channels or screened from the natural environment. The composite fermentation agent is prepared by compounding the required amount of lactic acid bacteria with Kazakhstan yeast JM1503.

[0018] In some embodiments, the ratio of the number of live bacteria of Kazakhstan yeast JM1503 to that of lactic acid bacteria in the composite leavening agent is 1:(8-12).

[0019] In some specific embodiments, the ratio of the number of live bacteria of Kazakhstan yeast JM1503 to that of lactic acid bacteria in the composite leavening agent can be 8:1, 9:1, 10:1, 11:1 or 12:1, etc.

[0020] In some preferred embodiments, the ratio of the number of live bacteria of Kazakhstan yeast JM1503 to that of lactic acid bacteria in the composite leavening agent is 1:10.

[0021] In the present application, the ratio of the number of live bacteria of Kazakhstan yeast JM1503 to that of lactic acid bacteria in the composite leavening agent will affect the flavor, taste, gloss and color of the steamed bread produced.

[0022] In some embodiments, the ratio of the number of live bacteria of Lactobacillus plantarum and Weissella sinusitis in the lactic acid bacteria is (1.5-2.5):1.

[0023] In some preferred embodiments, the ratio of the viable counts of Lactobacillus plantarum and Weissella sinusitis in the lactic acid bacteria is 2:1.

[0024] In the present application, by controlling the ratio of the live bacterial counts of Lactobacillus plantarum and Weissella vegetabilis in the lactic acid bacteria within the above range, the flavor of the steamed bread prepared by the composite leavening agent can be closer to that of the old-dough steamed bread prepared by old-dough fermentation.

[0025] In some preferred specific embodiments, the composite fermentation agent includes Kazakhstan yeast JM1503 and lactic acid bacteria; the lactic acid bacteria are composed of Lactobacillus plantarum and Weissella sinensis; and the ratio of the number of live bacteria of Kazakhstan yeast JM1503 and lactic acid bacteria in the composite fermentation agent is 1:10, and the ratio of the number of live bacteria of Lactobacillus plantarum and Weissella sinensis in the lactic acid bacteria is 2:1.

[0026] The fourth aspect of the present application provides a method for preparing steamed bread with an old-fashioned fermented flavor, the method comprising the following steps: S1, mixing flour, water and the composite leavening agent described in the third aspect of the present application to form a dough; S2, forming the dough into a dough blank in the shape of steamed buns and allowing it to rise; S3, steaming the dough in the shape of steamed buns after proofing to obtain steamed buns with old dough fermentation flavor.

[0027] The present application uses an electronic nose to measure the performance of steamed buns, which can show that the steamed buns made by the above method are highly reproducible, have stable performance and are practical.

[0028] The present application does not clearly limit the mixing ratio of flour and water in step S1. Generally, 400 to 500 g of water needs to be added to 1000 g of flour.

[0029] In step S2 of the present application, the dough can be made into a steamed bun-shaped dough by a process of pressing the dough (10 to 15 times) → shaping → forming, and the mass of the steamed bun-shaped dough can be 80 to 100 g.

[0030] In some embodiments, in step S1, the amount of the composite leavening agent used per gram of flour is such that the number of viable bacteria is (0.5-1.5)×10 9 cfu.

[0031] In some specific embodiments, in step S1, the amount of the composite leavening agent used in each gram of flour is such that the number of viable bacteria of Kazakhstan yeast JM1503 is 10 8 cfu, the number of viable lactic acid bacteria is 10 9 cfu.

[0032] In the present application, by controlling the usage amount of the composite leavening agent within the above range, the dough can be fully fermented in a short time, and the prepared steamed buns have excellent flavor, taste, gloss and color.

[0033] In some embodiments, in step S3, the proofing temperature is 30-40° C., the humidity is 70-90%, and the time is 0.5-1.0 h.

[0034] When the composite leavening agent of the present application is used to prepare steamed buns with an old-fashioned fermented flavor, there is no need to ferment the old dough for 8-10 hours a day in advance, and only one proofing is required, which greatly improves production efficiency.

[0035] Beneficial technical effects of the present application: The Kazakh yeast JM1503 provided in the present application is a new strain isolated from an old dough sample of an industrial workshop in Shijiazhuang, Hebei Province, and has good safety; the strain has a strong fermentation ability and excellent gas and alcohol production capabilities. At the same time, the composite leavening agent containing the strain can replace the old dough leavener through the mutual cooperation of various strains, so that the steamed buns prepared by the composite leavening agent not only have the old dough fermentation flavor, but also improve the taste, gloss and color of the steamed buns, and most importantly, save the time of making steamed buns, and no longer need to ferment the old dough for 8-10 hours a day in advance, which greatly improves the production efficiency. At the same time, by using a composite leavening agent, steamed buns can be reproduced in batches, which is more conducive to industrial promotion and production, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a microscopic electron microscope photograph of strain JM1503.

[0037] Figure 2 This is a scanning electron microscope photograph of strain JM1503.

[0038] Figure 3 This is a photograph of the appearance of the steamed bun prepared in Example 3.

[0039] Figure 4 This is a photo of the appearance of the steamed bun prepared in Comparative Example 7.

[0040] Figure 5 The electronic nose detection results of the steamed buns prepared in Example 3 and Comparative Examples 1-7 are shown.

[0041] Figure 6 PCA graph of the steamed bread electronic nose prepared in Example 3 and Comparative Examples 1-7.

[0042] Figure 7 This is a photograph of the interior of the steamed bun prepared in Example 3.

[0043] Figure 8 This is a photograph of the interior of the steamed bun prepared in Comparative Example 7.

[0044] Fig. 9 It is a radar chart of sensory evaluation of the steamed bread prepared in Example 3 and Comparative Examples 1-7.

[0045] Biological deposit information Kazakh yeast (Kazachstania humilis) JM1503, the deposit number is CGMCC No. 32117, the depository is the General Microbiology Center of China Culture Collection Administration (abbreviated as: CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing), and the deposit time is September 29, 2024. DETAILED DESCRIPTION

[0046] In order to make the present application easier to understand, the present application will be further described in detail below in conjunction with the examples, which are merely illustrative and are not intended to limit the scope of application of the present application. The raw materials or components used in the present application can be obtained through commercial routes or conventional methods unless otherwise specified.

[0047] Example 1: Isolation, screening and identification of Kazakhstan yeast JM1503 1. Dilution and smear culture of samples The old dough sample was taken from an industrial workshop in Shijiazhuang, Hebei Province. 25 g of the sample was weighed, added with 225 ml of sterile saline, homogenized, and made into 10 -1 Take 1ml of sample 10 -1 The sample solution is injected into a test tube containing 9 ml of sterile diluent, and a 1 ml sterile pipette is used to blow and suck repeatedly. -2 Prepare a 10-fold serial dilution of the sample solution to 10 -6 . Use a pipette to draw 10 -4 ~10 -6 1 ml of the sample homogenate was applied to Bengal red agar medium and incubated at 28°C for 2 to 3 days. -4 ~10 -6 Set up 2 parallel dilutions for each assay.

[0048] 2. Screening and separation of Kazakh yeast JM1503 Observe the morphology of the strains grown on the plate, pick single colonies according to their color, morphology and size, and separate them by streaking 3 to 4 times. When the microscopic examination shows that the pure substance is pure, the pure culture is obtained, and it is transferred to the Bengal red solid slant medium for storage. The electron microscope photos and scanning electron microscope photos of the strain JM1503 are shown in the figure below. Figure 1 and Figure 2 As shown. Figure 2 It can be seen that the Kazakh yeast JM1503 is ellipsoidal, has a smooth surface, no cilia or flagella, and has spores.

[0049] 3. Identification of Kazakhstan yeast JM1503 The DNA of the strain was extracted according to the instructions of the Ezup column fungal genomic DNA extraction kit (B518259), and its purity was tested by 1.5% agarose gel electrophoresis and stored at 4°C. Then, the 16SrRNA gene sequence in the extracted DNA was amplified by PCR, and the obtained amplified product was commissioned to Sangon Biotech (Shanghai) Co., Ltd. for 16SrRNA sequencing. The test results and identification sequence are as follows: CTGCGGAAGGATCATTAAAGAAATGATTGGGGGAGCCCGCCTGCGCTTAGCTGCGCGGT GGCGCTCCGCCTCTTACACACAGTGGAGTAATTATTTATTCTTGGGCCGAGCGCAAGCTC AGCTCGCCAAACACAAACAACTATTTTTTACTATACAAATGTCATCAAATCTGCTTACGCA GTAACCAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAA CGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCT CAAGCACCTGTGCTTGGTTGTGGGTGACACTCTCTCGAGTTAGCTTGAAATTGCTGGCC GCACTGCGGTGGAGCAGTTGGCTTGTCTGTCGTGCACGGTGCCTCGGCGCCGGGCGTG GCTGGCATGCGATTGTCGTACTAGGTTTTACCAATTCGGCAGGAGCGTGCTGGGCAGAG AGACAATACAACCGCCCTCCCCCTGGCTAACAGTACTCTTTAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATC (SEQ ID NO: 1).

[0050] The 16S rRNA sequencing results of the strain were compared with the National Center for Biotechnology Information database by BLAST comparison analysis. The strain had the highest homology with Kazachstania humilis isolate LB4, reaching 99.833%. According to the identification results of the cell morphology, physiological and biochemical characteristics of the strain, and referring to the Bergey's Manual of Systematic Bacteriology, the strain was finally identified as Kazachstania (Kazakhstan yeast genus), specifically Kazachstania humilis, and named Kazakhstan yeast JM1503. The strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on September 29, 2024. The address of the depository unit is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, and the deposit number is CGMCC No.32117.

[0051] Example 2: Detection of fermentation performance of Kazakhstan yeast JM1503 1. Gas production capacity determination The three pure yeast strains (Kazakhstan yeast JM1503, Kazakhstan yeast JM1513 and Kazakhstan yeast 1505) isolated from the old dough samples were inoculated into YPD liquid culture medium, 20 ml of culture solution was added to the sampling bottle, 3 parallels were set for each sample, the water bath temperature was set at 28°C, the total amount of gas was collected every 5 minutes, and the total gas production and maximum gas production rate of the sample were obtained for 72 hours. The results are shown in Table 1.

[0052] 2. Determination of alcohol production capacity TTC (2,3,5-triphenyltetrazolium chloride) is a colorimetric agent. Since yeast contains deaminase, the metabolic products of yeast will show different colors under the action of TTC. After covering a layer of TTC colorimetric agent on the yeast colony cultured on YPD for 2 days, different colors will be displayed. The strain with strong alcohol production ability will be dark red and pink. The activity of respiratory enzymes in yeast, that is, the alcohol production ability of yeast, can be judged by the difference in color. The isolated yeast strains (Kazakhstan yeast JM1503, Kazakhstan yeast JM1513 and Kazakhstan yeast 1505) were diluted and spread on the plate of TTC lower medium, cultured at 28℃ for 3 days, and the pre-prepared sterile TTC upper medium that had been cooled to about 45℃ was slowly poured onto the YPD medium to cover all the colonies. Move to a dark place at 28℃ for color development, take out after 2-3 hours, and quickly compare the colony colors. The test results are shown in Table 1, where the larger the TTC number, the better the alcohol production capacity.

[0053] Table 1 From the test results in Table 1, it can be seen that the fermentation capacity of Kazakhstan yeast JM1503 is the best in terms of comprehensive gas production capacity and alcohol production capacity.

[0054] Example 3: Preparation of flavored steamed bread fermented with old dough using a composite leavening agent The composite starter used in this embodiment is composed of Kazakhstan yeast JM1503 and lactic acid bacteria, the lactic acid bacteria are composed of Lactobacillus plantarum and Weissella spp., and the ratio of the live bacteria count of Kazakhstan yeast JM1503 to lactic acid bacteria is 1:10, and the ratio of the live bacteria count of Lactobacillus plantarum to Weissella spp. is 2:1.

[0055] Steamed bread preparation process 1000g of flour, 450g of water and the composite leavening agent were mixed and kneaded into dough; when kneading the dough, the amount of the composite leavening agent used per gram of flour was such that the number of viable bacteria of Kazakhstan yeast JM1503 was 10 8 cfu, the number of viable lactic acid bacteria is 10 9 cfu. The dough is pressed (12 times) → shaped → formed into a dough blank in the shape of a steamed bun, and the mass of each dough blank is 90g. All the dough blanks are proofed at a temperature of 37°C and a humidity of 85% for 40 minutes to obtain dough blanks for steamed buns after proofing. The dough blanks for steamed buns after proofing are steamed in a pot, and after the water is boiled, they are steamed for 20 minutes, and the fire is turned off and simmered for 5 minutes to make steamed buns.

[0056] Comparative Example 1: Preparation of steamed bread using a leavening agent The starter used in this comparative example consists of Wickerhamomyces anomalus and lactic acid bacteria; the lactic acid bacteria consists of Lactobacillus plantarum and Weissella edodes, and the ratio of the viable bacteria count of Wickerhamomyces anomalus to that of lactic acid bacteria is 1:10, and the ratio of the viable bacteria count of Lactobacillus plantarum to that of Weissella edodes is 2:1.

[0057] Steamed bread preparation process Same as Example 3.

[0058] Comparative Example 2: Preparation of flavored steamed bread fermented with old dough using a composite leavening agent The composite leavening agent used in this embodiment is composed of saccharomyces cerevisiae and lactic acid bacteria, the lactic acid bacteria are composed of Lactobacillus plantarum and Weissella sinensis, and the ratio of the live bacteria count of saccharomyces cerevisiae to lactic acid bacteria is 1:10, and the ratio of the live bacteria count of Lactobacillus plantarum to Weissella sinensis is 2:1.

[0059] Steamed bread preparation process Same as Example 3.

[0060] Comparative Example 3: Preparation of flavored steamed bread fermented with old dough using a composite leavening agent The composite starter used in this embodiment is composed of Kazakhstan yeast JM1513 and lactic acid bacteria, the lactic acid bacteria are composed of Lactobacillus plantarum and Weissella vegetative, and the ratio of the live bacteria count of Kazakhstan yeast JM1513 to lactic acid bacteria is 1:10, and the ratio of the live bacteria count of Lactobacillus plantarum to Weissella vegetative is 2:1.

[0061] Steamed bread preparation process Same as Example 3.

[0062] Comparative Example 4: Preparation of flavored steamed bread fermented with old dough using a composite leavening agent The composite starter used in this embodiment is composed of Kazakhstan yeast JM1505 and lactic acid bacteria, the lactic acid bacteria are composed of Lactobacillus plantarum and Weissella vegetative, and the ratio of the number of live bacteria of Kazakhstan yeast JM1505 yeast to lactic acid bacteria is 1:10, and the ratio of the number of live bacteria of Lactobacillus plantarum and Weissella vegetative is 2:1.

[0063] Steamed bread preparation process Same as Example 3.

[0064] Comparative Example 5: Preparation of steamed bread using a leavening agent The starter used in this comparative example is composed of Kazakhstan yeast JM1503 and lactic acid bacteria; the lactic acid bacteria is Lactobacillus plantarum, and the ratio of the number of live bacteria of Kazakhstan yeast JM1503 to that of lactic acid bacteria is 1:10.

[0065] Steamed bread preparation process Same as Example 3.

[0066] Comparative Example 6: Preparation of steamed bread using a leavening agent The leavening agent used in this comparative example is composed of Kazakhstan yeast JM1503 and lactic acid bacteria; the lactic acid bacteria is Weissella sinensis, and the ratio of the number of live bacteria of Kazakhstan yeast JM1503 to that of lactic acid bacteria is 1:10.

[0067] Steamed bread preparation process Same as Example 3.

[0068] Comparative Example 7: Preparation of old dough steamed bread Add appropriate amount of water and flour to the old leavener and knead the dough. The dough is proofed at 30℃ for 10 hours to obtain the proofed old leavener. Mix 1000g flour, 450g water, 1g alkaline noodles, 3g Angel yeast and 500g fermented old leavener and make dough. The dough is pressed (12 times) → shaping → forming to form a dough blank in the shape of steamed buns, and the weight of each dough blank is 90g. All the dough blanks are proofed at a temperature of 37℃ and a humidity of 85% for 1 hour to obtain the dough blanks for steamed buns after proofing. The dough blanks for steamed buns after proofing are steamed in a pot. After the water is boiled, steam for 20 minutes, turn off the heat and simmer for 5 minutes to make steamed buns.

[0069] Test Example 1: Determination of the color of steamed bread The test method is as follows: Cool the steamed buns to room temperature for one hour, select multiple sites on the surface of the steamed buns and use a colorimeter to measure the chromaticity of the steamed bun crust, break the steamed buns apart, measure the chromaticity of the steamed bun filling, repeat three times, and record the values. The color difference indexes are represented by L*, a*, and b*: L* represents the brightness of the sample. If L* is a positive value, the sample is white, and if L* is a negative value, the sample is dark; a* represents the red-green value. If a* is a positive value, the sample is reddish, and if a* is a negative value, the sample is greenish; b* represents yellow-blue. If b* is a positive value, the sample is yellowish, and if b* is a negative value, the sample is bluish. The chromaticity test results of the steamed buns prepared in Example 3 and Comparative Examples 1-7 are shown in Table 2. The appearance photos of the steamed buns prepared in Example 3 and Comparative Example 7 are shown in Table 2, respectively. Figure 3 and 4 shown.

[0070] Table 2: Steamed bread color test results Color is an intuitive indicator of the quality of steamed bread and a key factor in consumption and popularity. The ideal color of steamed bread should be milky white and shiny. From the test results in Table 2, it can be seen that the L* value of the outer skin of the steamed bread prepared in Example 3 and Comparative Examples 1-6 is greater than the L* value of the old-style steamed bread prepared in Comparative Example 7, indicating that the steamed bread prepared by the bacterial powder leavening agent is light in color, with higher brightness and better glossiness than the old-style steamed bread. Figure 3 and Figure 4 It can be seen that compared with the old-dough steamed bread prepared using old yeast, the old-dough steamed bread prepared using the composite leavening agent containing Kazakhstan yeast JM1503 provided in the present application has better gloss and color, and the color is whiter and brighter.

[0071] Test Example 2: Detection of steamed bread flavor The steamed bread flavor was analyzed by electronic nose, and the specific method was as follows: 5 g steamed bread sample was accurately weighed, crushed and added to a 20 ml headspace injection bottle, heated in a 40°C water bath for 30 min, equilibrated at room temperature for 15 min, and measured using an electronic nose. The information of 14 sensors of the electronic nose is shown in Table 3. The electronic nose detection results of the steamed bread prepared in Example 3 and Comparative Examples 1-7 are shown in Tables 4 and Figure 5 shown.

[0072] Table 3: Sensor performance description Sensor Name Performance Description S1 Ammonia, amines S2 Hydrogen sulfide, sulfide S3 hydrogen S4 Ethanol, organic solvents S5 Alcohols, ketones, aldehydes, aromatic compounds S6 Methane, biogas, natural gas S7 Combustible gas S8 VOC S9 Liquefied gas, natural gas, coal gas S10 Liquefied gas, flammable gas S11 Alkanes, ethanol, natural gas, smoke S12 Ethanol, organic solvents S13 Smoke, cooking odors S14 Methane, gas Table 4: Steamed bun electronic nose detection results As can be seen from Table 4, the response value of sensor S8 is the largest, indicating that there are more VOCs in the steamed buns. VOC refers to the general term for a class of active volatile organic compounds, mainly including benzene (benzene, toluene, xylene, etc.), ammonia, alkanes, esters, etc.; at the same time, sensors S11 and S5 also have large response values, indicating that there are more alkanes, alcohols, esters and aldehydes and ketones in the steamed buns. Further, the 14 sensor response values ​​of the steamed buns prepared in Example 3 are closest to the old steamed buns prepared in Comparative Example 7 in the radar chart, indicating that the flavor difference between the steamed buns prepared in Example 3 and the old steamed buns is the smallest.

[0073] PCA is an algorithm that simplifies and reduces the dimension by linearly transforming the original data vector while retaining the main information. By plotting the first and second principal components as the horizontal and vertical coordinates, the characteristic information of each sample can be intuitively understood. If the volatile components and content of the samples are more similar, they will be in a closer position on PCA, and the size of the difference can be measured by the distance between different samples.

[0074] The PCA graph was drawn using the first principal component and the second principal component of the steamed bread detected by the electronic nose in Example 3 and Comparative Examples 1-7. The results are as follows: Figure 6 As shown. Figure 6 It can be seen that the total contribution rate of the two principal components is 98.18%, which is higher than 95%, indicating that the two principal components contain all the original information of the sample. Comparative Examples 1, 3, 5, and 6 are farthest from Comparative Example 7, indicating that their old-faced flavor is the worst; Comparative Examples 2, 4, and 7 have intersections with Example 3 in principal components 1 and 2, indicating that the steamed bread prepared in Comparative Examples 2, Comparative Examples 4, and Example 3 has a similar flavor to the old-faced steamed bread, and Example 3 has a higher overlap with Comparative Example 7 in principal components, indicating that the volatile components of the steamed bread prepared in Example 3 are closest to the old-faced steamed bread.

[0075] Test Example 4: Determination of steamed bread texture After the steamed bread was cooled to room temperature for one hour, it was tested using a texture analyzer. It was placed parallel to the stage of the texture analyzer for texture profile analysis (TPA), with hardness, elasticity, adhesion, stickiness, and chewiness as evaluation indicators. The P36 pressure plate probe was used for evaluation, with a test rate of 60 mm / min, a compression deformation of 50%, and an initial force of 1 N. All samples were tested three times and the results were averaged.

[0076] Studies have shown that hardness and chewiness are negatively correlated with the quality of steamed bread. The smaller the value, the softer and more refreshing the steamed bread is. Elasticity and cohesion are positively correlated with the quality of steamed bread. The texture test results of the steamed bread prepared in Example 3 and Comparative Examples 1-7 are shown in Table 5. Since the gas production capacity of the Kazakhstan yeast JM1513 used in Comparative Example 3 is too low, the steamed bread prepared in Comparative Example 3 is a "dead dough steamed bread" and the steamed bread is too hard, which exceeds the measurement range of the texture analyzer. Therefore, the texture test results of the steamed bread prepared in Comparative Example 3 cannot be detected.

[0077] The internal photos of the steamed buns prepared in Example 3 and Comparative Example 7 are shown in FIG. Figure 7 and 8 shown.

[0078] Table 5: Test results of steamed bread texture From the test results in Table 5, it can be seen that the hardness and chewiness of the steamed bread prepared in Example 3 are moderate, which are significantly better than the old steamed bread prepared in Comparative Example 7. At the same time, the stickiness and maximum adhesion are lower than the old steamed bread prepared in Comparative Example 7, indicating that the composite leavening agent provided in this application can make the internal structure of the steamed bread softer and more elastic. This is because the acid produced by lactic acid bacteria fermentation can promote the growth and fermentation of yeast, increase the amount of carbon dioxide in the dough, and the organic acid produced can soften the gluten and improve the ductility and expansion of the dough.

[0079] Test Example 5: Sensory Evaluation of Steamed Buns The steamed buns were subjected to sensory evaluation after cooling for 1 hour. The sensory evaluation team consisted of 10 well-trained professionals, including 5 men and 5 women. The team members tasted and scored different samples in a suitable laboratory. The evaluation standards were based on GB / T35991-2018 "Grain and Oil Inspection Wheat Flour Steamed Bun Processing Quality Evaluation", as shown in Table 6. The steamed buns prepared in Example 3 and Comparative Examples 1-7 were subjected to sensory evaluation. The results of the evaluation by the evaluation team are shown in Table 7. A sensory evaluation radar chart was drawn based on the evaluation results, as shown in Table 7. Fig. 9 As shown. Since the gas production capacity of the Kazakh yeast JM1513 used in Comparative Example 3 is too low, the steamed bread prepared in Comparative Example 3 is a "dead dough steamed bread" and the steamed bread is too hard, so the steamed bread prepared in Comparative Example 3 was not subjected to sensory evaluation.

[0080] Table 6: Sensory evaluation standards for steamed bread Table 7: Sensory evaluation results of steamed bread From Table 7 and Fig. 9 The test results show that the sensory evaluation score of the steamed bread prepared by the compound leavening agent of the present application is higher than that of the steamed bread prepared by the old dough (78.03 points) in comparative example 7. The steamed bread prepared by the compound leavening agent has higher elasticity and surface color scores than the steamed bread prepared by the old dough. This may be because lactic acid bacteria fermentation causes the dough to produce organic acids such as lactic acid, which promotes protein degradation, thereby increasing protein swelling and solubility, making the dough have better ductility and expansion. The specific volume, internal structure and taste of the old dough steamed bread are higher. The larger specific volume of the old dough steamed bread may be due to the influence of the metabolic characteristics of a large amount of Lactobacillus sanfrancisco in the old dough. Lactobacillus sanfrancisco metabolizes hexose to produce lactic acid, ethanol, CO 2 The addition of substances such as sugars will increase the volume of the dough and cause certain changes in the internal structure of the dough.

[0081] It should be noted that the embodiments described above are only used to explain the present application and do not constitute any limitation to the present application. The present application is described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present application may be modified as specified within the scope of the claims of the present application, and the present invention may be revised without departing from the scope and spirit of the present application. Although the present application described therein relates to specific methods, materials and embodiments, it does not mean that the present application is limited to the specific examples disclosed therein. On the contrary, the present application can be extended to all other methods and applications with the same functions.

Claims

1. A Kazakh yeast JM1503, characterized in that: The Kazakh yeast ( Kazachstania humilis ) JM1503 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No. 32117 and the deposit date of September 29, 2024.

2. The Kazakh yeast JM1503 according to claim 1, characterized in that The nucleotide sequence of 16S rRNA of the Kazakh yeast JM1503 is shown in SEQ ID NO:

1.

3. Use of the Kazakh yeast JM1503 as claimed in claim 1 or 2 in preparing steamed bread and / or bread with old-fashioned fermentation flavor.

4. A composite leavening agent for producing old dough fermentation flavor, characterized in that: The composite fermentation agent includes the Kazakh yeast JM1503 as described in claim 1 or 2.

5. The composite leavening agent according to claim 4, characterized in that The composite leavening agent also includes lactic acid bacteria, which include Lactobacillus plantarum and Weissella sinusitis.

6. The composite leavening agent according to claim 5, characterized in that The ratio of the number of live bacteria of Kazakhstan yeast JM150 to that of lactic acid bacteria in the composite fermentation agent is 1: (8-12).

7. The composite leavening agent according to claim 5 or 6, characterized in that: The ratio of the number of live bacteria of Lactobacillus plantarum and Weissella sinusitis in the lactic acid bacteria is (1.5~2.5):

1.

8. A method for preparing steamed bread with fermented dough flavor, characterized in that: The method comprises the following steps: S1, mixing flour, water and the composite leavening agent according to any one of claims 4 to 7, and kneading into dough; S2, forming the dough into a steamed bun-shaped dough blank and allowing it to rise; S3, steaming the dough in the shape of steamed buns after proofing to obtain steamed buns with old dough fermentation flavor.

9. The method according to claim 8, characterized in that In step S1, the amount of the composite leavening agent used per gram of flour is such that the number of viable bacteria is (0.5-1.5)×10 9 cfu.

10. The method according to claim 8 or 9, characterized in that: In step S3, the proofing temperature is 30-40° C., the humidity is 70-90%, and the time is 0.5-1.0 h.

Images