Genetically engineered bacterium for producing succinic acid by efficiently utilizing corn straw hydrolysate and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for producing succinic acid by efficiently utilizing corn straw hydrolysate and application of the genetically engineered bacterium, and belongs to the technical field of gene recombination and metabolic engineering. The invention discloses a genetically engineered bacterium. On the basis of a strain BW20, NADH supply is improved by inactivating a pyruvate dehydrogenase composite regulatory factor PdhR and overexpressing a transhydrogenase gene stA, succinic acid transport is promoted by oxygen responding to a metabolic switch, and supply of coenzyme A, acetyl phosphate and ATP is improved by refilling expression of a phosphate acetyl transferase gene Pta with a low-expression-intensity constitutive promoter. The conversion rate of succinic acid produced by fermentation of the genetically engineered bacterium in an anaerobic bottle reaches 1.05 g / g (total sugar), and the yield of succinic acid produced by metabolism of corn straw hydrolysate in aerobic-anaerobic two-stage fed-batch fermentation reaches 92.4 g / L. The genetically engineered bacterium disclosed by the invention can be used for efficiently metabolizing cellulose hydrolysate to produce succinic acid.

Description

Technical Field

[0001] The invention relates to the technical field of gene recombination and metabolic engineering, and more specifically to a genetic engineering bacterium for efficiently utilizing corn stalk hydrolyzate to produce succinic acid and its application. Background Art

[0002] Succinic acid, also known as succinic acid, is a dicarboxylic acid, colorless crystal, sour taste, soluble in water, slightly soluble in ethanol and ether, insoluble in chloroform and dichloromethane, with a molecular formula of C4H6O4 and a molecular weight of 118.1. It is a precursor of many important compounds. Succinic acid has a wide range of applications, including food additives, pharmaceutical synthesis, plastics, dyes, resins, pesticides, and many other aspects. In terms of food additives, succinic acid can be used as an acidulant, preservative, etc. In the field of pharmaceutical synthesis, succinic acid is an important raw material for a variety of drugs; in the field of plastics, succinic acid can be used to produce degradable plastics, such as polybutylene succinate (PBS), which is of great significance for reducing environmental pollution and promoting a circular economy.

[0003] Traditional succinic acid production mainly adopts chemical synthesis methods, mainly including the oxidation method of deep oxidation of paraffin to produce a series of carboxylic acid mixtures, followed by distillation and crystallization to obtain succinic acid, and the reduction method of chemical catalytic hydrogenation using maleic anhydride as raw material. The paraffin oxidation process is relatively mature, but the yield and purity are not high, and there is pollution. The maleic anhydride method requires hydrogenation reaction under the action of expensive metal catalysts, which has high production costs and is not conducive to large-scale production. In contrast, the production of succinic acid by microbial fermentation has the advantages of being green, efficient, and sustainable, while avoiding dependence on petrochemical raw materials. It is a low-cost, green production method. At present, many companies and research institutions are involved in the production of succinic acid by microbial fermentation. However, these companies and research institutions mainly use glucose as the raw material for biological fermentation. Although the yield and yield of succinic acid are high, there is a problem of "competing with people for food". Straw biomass comes from agricultural residues and is difficult to use directly due to its complex structure. However, it can be converted into glucose and xylose that can be fermented by microorganisms through a hydrolysis process. It is a non-grain bio-based raw material with great potential. In previous studies, an engineered Escherichia coli strain was constructed through system metabolic engineering, and the yield of succinic acid produced by corn straw hydrolysate using aerobic-anaerobic two-stage batch fermentation was 70.2 g / L, and the conversion rate in the anaerobic fermentation stage reached 0.97 g / g (total sugar). However, since the yield and conversion rate have not yet met production requirements, it is necessary to further improve the yield and conversion rate of the engineered bacteria.

[0004] In view of this, the present invention provides a genetically engineered bacterium for more efficiently utilizing corn straw hydrolyzate to produce succinic acid and its application, providing a technical reference for efficiently utilizing non-grain agricultural straw biomass to produce succinic acid. Summary of the invention

[0005] Based on the previously constructed engineering bacteria (patent number 202411026118.1, engineering strain BW20), the present invention further inactivates the pyruvate dehydrogenase complex regulator PdhR, overexpresses the endogenous transhydrogenase sthA to increase the NADH supply, uses the oxygen corresponding metabolic switch to promote the succinate transporter, and replenishes the expression of the phosphate acetyltransferase gene Pta through a constitutive promoter with low expression intensity to increase the supply of coenzyme A, acetyl phosphate and ATP, thereby obtaining the Escherichia coli engineering bacteria BW20-5 with further improved yield and yield. The yield of succinic acid produced by corn straw hydrolysate metabolism using "aerobic-anaerobic" two-stage batch feeding fermentation reached 92.4 g / L (total sugar), and the conversion rate reached 0.89 g / g (total sugar). The genetically engineered bacteria constructed by the present invention provide the possibility for further efficient use of corn straw hydrolysate to produce succinic acid.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid, wherein the genetically engineered bacterium is a recombinant Escherichia coli transformed with a chassis microorganism; The chassis microorganism transformation uses the engineered strain BW20 as the starting strain, knocks out the pyruvate dehydrogenase complex regulator PdhR gene, overexpresses the transhydrogenase sthA gene (PdhR and sthA are genes for increasing NADH supply); overexpresses the Escherichia coli endogenous succinate efflux protein gene yjjPB (yjjPB, including two subunits: putative succinate exporter YjjP and putative succinate exporter YjjB) gene cluster or the C4-dicarboxylate transporter gene dcuC (C4-dicarboxylate transporter); The expression regulatory element used for overexpression of the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA .

[0007] Furthermore, the gene sequence of the endogenous pyruvate dehydrogenase complex regulatory factor PdhR of Escherichia coli is shown in SEQ ID NO.1; The Escherichia coli endogenous transhydrogenase sthA gene sequence is shown in SEQ ID NO.8; The endogenous succinate efflux protein yjjPB gene cluster sequence is shown in 274-1568 bp in SEQ ID NO.16; The endogenous C4-dicarboxylate transporter gene dcuC sequence is shown in 274-1670 bp in SEQ ID NO.24; The oxygen responsive metabolic switch OMS glpA The sequence is shown in 1-273 bp of SEQ ID NO.16.

[0008] Furthermore, the genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid also include a constitutive promoter P with low expression intensity. J23114 Replenish the phosphate acetyltransferase Pta (phosphateacetyltransferase) gene to increase the supply of coenzyme A, acetyl phosphate and ATP.

[0009] Furthermore, the phosphate acetyltransferase Pta gene sequence is shown in SEQ ID NO.29; the constitutive promoter P J23114 The sequence is shown as SEQ ID NO.37.

[0010] Furthermore, a method for constructing a genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid comprises the following steps: (1) Using the engineered strain BW20 as the starting strain, the pyruvate dehydrogenase complex regulator PdhR gene was knocked out, and the transhydrogenase sthA gene was overexpressed; the endogenous succinate efflux protein yjjPB gene cluster of Escherichia coli or the C4-dicarboxylate transporter gene dcuC was overexpressed; The expression regulatory element used for overexpression of the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA ; and / or (2) Use a constitutive promoter P with low expression intensity J23114 Replenishment of the phosphate acetyltransferase Pta gene.

[0011] Furthermore, the genetically engineered bacteria or the method described are used in the production of succinic acid.

[0012] Furthermore, the genetically engineered bacteria or the method described are used to increase the yield of succinic acid.

[0013] Furthermore, a method for efficiently utilizing corn straw hydrolyzate to produce succinic acid is provided, wherein the genetically engineered bacteria or the genetically engineered bacteria constructed by the method are used for fermentation; the carbon source used for fermentation is the corn straw cellulose hydrolyzate.

[0014] The present invention utilizes an "aerobic-anaerobic" two-stage fermentation method, switches to anaerobic fermentation at the best time to perform fermentation production.

[0015] The main carbon sources in the corn stalk hydrolysate are glucose and xylose. The genetically engineered bacteria constructed by the present invention can use the cellulose hydrolysate as a carbon source, which provides the possibility for realizing the efficient use of cellulose hydrolysate to produce succinic acid.

[0016] The present invention provides a method for producing succinic acid by metabolizing straw cellulose hydrolyzate ( Figure 1 ): In Escherichia coli BW20, the endogenous pyruvate dehydrogenase complex regulator PdhR was eliminated; the endogenous transhydrogenase sthA was overexpressed to utilize the oxygen response metabolic switch OMS glpA Overexpression of the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC in Escherichia coli was achieved by using a constitutive promoter P J23114 Replenish endogenous phosphate acetyltransferase Pta.

[0017] The elimination of the endogenous pyruvate dehydrogenase complex regulator PdhR is to reduce the inhibition of the pyruvate dehydrogenase complex PDH and enhance the synthesis of NADH; the overexpression of the endogenous transhydrogenase sthA is to increase the activity of the pyruvate dehydrogenase complex PDH and enhance the synthesis of NADH; the utilization of the oxygen response metabolic switch OMS glpA The purpose of overexpressing the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC of Escherichia coli is to enhance the expression of yjjPB or dcuC only under anaerobic conditions, thereby increasing the succinate efflux capacity under anaerobic conditions without increasing the metabolic burden in the aerobic growth stage; J23114 The purpose of replenishing endogenous phosphate acetyltransferase Pta is to increase the supply of coenzyme A, acetyl phosphate and ATP required for cell growth and production, thereby promoting growth and production.

[0018] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses a genetically engineered bacterium for efficiently utilizing corn straw hydrolysate to produce succinic acid and its application, and specifically provides a recombinant Escherichia coli for more efficiently utilizing corn straw hydrolysate to produce succinic acid, by eliminating the endogenous pyruvate dehydrogenase complex regulatory factor PdhR; overexpressing the endogenous transhydrogenase sthA, overexpressing the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC of Escherichia coli using the oxygen corresponding metabolic switch OMSglpA, and supplementing the endogenous phosphate acetyltransferase Pta by using the constitutive promoter PJ23114 with low expression intensity; the production capacity of the strain is greatly improved, the conversion rate of the anaerobic fermentation production stage in the anaerobic bottle reaches 1.05 g / g (total sugar), the output of succinic acid produced by batch fed fermentation metabolism of corn straw hydrolysate reaches 92.3 g / L (total sugar), and the conversion rate reaches 0.89 g / g (total sugar) is the highest record of genetically engineered bacteria that metabolize corn straw hydrolysate to produce succinic acid, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0020] Figure 1 The accompanying drawing shows the transformation pathway for producing succinic acid by metabolizing corn straw hydrolyzate according to the present invention. DETAILED DESCRIPTION

[0021] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] LB liquid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L. The corresponding LB solid medium is supplemented with 2% agar.

[0023] Example 1 A method for constructing a genetically engineered bacterium that efficiently metabolizes corn straw hydrolyzate to produce succinic acid comprises the following steps: Using the Escherichia coli engineered strain BW20 as the starting strain, the endogenous pyruvate dehydrogenase complex regulator PdhR gene was knocked out, the endogenous transhydrogenase sthA gene was overexpressed, and the expression regulatory element used was the oxygen response metabolic switch OMS. glpA Overexpression of the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC in Escherichia coli and the low-intensity constitutive promoter P J23114 Replenishment of the phosphate acetyltransferase Pta gene.

[0024] (1) Knockout of the pyruvate dehydrogenase complex regulator PdhR gene (as shown in SEQ ID NO.1) (1-1) Step 1: Preparation of knockout fragment ΔqdhR-1000: Using Escherichia coli BW20 genomic DNA as a template, primers ΔqdhR-1 and ΔqdhR-2 were used to amplify a PCR product containing the upstream homology arm gene fragment F; primers ΔqdhR-3 and ΔqdhR-4 were used to amplify a PCR product containing the downstream homology arm gene fragment R.

[0025] The specific sequences of primers ΔqdhR-1 and ΔqdhR-2 are as follows: ΔqdhR-1: 5'-cgtgctgttgaccttccatcatg-3'; SEQ ID NO. 2.

[0026] ΔqdhR-2: 5'-gacttctgtcgaggagttcctgtcttaagccacttgcc-3'; SEQ ID NO. 3.

[0027] The specific sequences of primers ΔqdhR-3 and ΔqdhR-4 are as follows:

[0028] ΔqdhR-3: 5'-cttaagacaggaactcctcgacagaagtcgtgaagagagc-3'; SEQ ID NO. 4.

[0029] ΔqdhR-4: 5'-ttgcgtgcacggaagaagtg-3'; SEQ ID NO. 5.

[0030] PCR amplification system: Primestar enzyme (Takara) 25 µL, upstream and downstream primers 2 µL each, template 1 µL, ddH2O 20 µL.

[0031] PCR amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0032] After agarose gel electrophoresis and product recovery, the upstream homology arm gene fragment F and the downstream homology arm gene fragment R were obtained.

[0033] Using upstream homology arm gene fragment F and downstream homology arm gene fragment R as substrates, ΔqdhR-1 and ΔqdhR-4 as primers, PCR amplification was performed to obtain a PCR product containing the knockout fragment ΔqdhR-1000. The amplification system and amplification conditions were the same as above.

[0034] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the knockout fragment ΔqdhR-1000.

[0035] (1-2) Step 2: Preparation of knockout plasmid ΔqdhR-gRNA: Using E. coli BW20 genomic DNA as a template, ΔqdhR-gRNA-F and gRNA-R as primers, amplification was performed to obtain a PCR product containing the ΔqdhR-gRNA gene fragment. The amplification system and amplification conditions were the same as above.

[0036] The specific sequences of ΔqdhR-gRNA-F and gRNA-R are as follows: ΔqdhR-gRNA-F: 5'-GGACTAGTATAAGCGGCGATACCTTCCAgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 6.

[0037] gRNA-R: 5'-CCGctcgagtagggataacagggt-3'; SEQ ID NO. 7.

[0038] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the ΔqdhR-gRNA gene fragment.

[0039] The ΔqdhR-gRNA gene fragment and pEcgRNA plasmid were digested with endonucleases XhoI and SpeI at 37°C for 2 hours, respectively. The digestion products were recovered to obtain ΔqdhR-gRNA digestion fragments and digested pEcgRNA fragments, respectively.

[0040] ΔqdhR-gRNA gene fragment digestion system: ΔqdhR-gRNA gene fragment 40 µL, XhoI enzyme 1 µL, SpeI 1 µL, rCutSmart 5 µL, ddH2O 3 µL.

[0041] pEcgRNA plasmid restriction enzyme digestion system: pEcgRNA plasmid 40 µL, XhoI enzyme 1 µL, SpeI 1 µL, rCutSmart 5 µL, ddH2O 3 µL.

[0042] The ΔqdhR-gRNA digested fragment and the digested pEcgRNA fragment were ligated under the action of T4 DNA ligase at 22°C for 2 hours to obtain a ligation product.

[0043] T4 DNA ligase ligation system: 2 µL of ΔqdhR-gRNA digested fragment, 1 µL of T4 DNA ligase, 1 µL of T4 DNA ligase buffer, 1 µL of digested pEcgRNA fragment, and 5 µL of ddH2O.

[0044] 10 µL of the above ligation product was transferred into the commercial trans 10 competent medium (Quanshijin Company) according to the instructions, revived at 37°C for 1 hour, spread on LB solid medium plates containing 50 µg / mL spectinomycin, and cultured at 37°C for 12 hours to obtain single colonies.

[0045] The above single colony was inoculated into LB liquid culture medium containing 50 µg / mL spectinomycin and cultured for 12 hours. The plasmid was extracted and sequenced. The sequencing results showed that the knockout plasmid ΔqdhR-gRNA was the one with the qdhR gene knocked out.

[0046] (1-3) Step 3: Knockout of qdhR gene: Electroporate the plasmid pEcCas into BW20 host competent cells and resuscitate at 37℃, spread on LB plates containing 50 µg / mL kanamycin sulfate, and culture at 37℃ until a single colony grows. Inoculate the single colony carrying the pEcCas plasmid in an LB tube (with 50 µg / mL kanamycin sulfate resistance) and culture at 37℃ for 12 h.

[0047] Transfer 1 mL of bacterial solution from the above test tube to a vial containing 20 mL of LB liquid medium, add 50 µg / mL kanamycin sulfate and a final concentration of 10 mM arabinose, and culture at 37°C until the bacterial solution concentration reaches OD = 0.6~0.8.

[0048] The competent cells were prepared using the E. coli in the above bacterial solution. 100 ng ΔqdhR-gRNA knockout plasmid and 400 ng knockout fragment ΔqdhR-1000 were added to 100 µL of competent cells for electroporation. After electroporation, 1 mL of pre-cooled LB liquid culture medium was immediately added, and the cells were revived at 37 °C for 1 h. The cells were spread on double-resistance LB plates containing 50 µg / mL kanamycin sulfate and 50 µg / mL spectinomycin, and cultured at 37 °C until single colonies grew.

[0049] A single colony was picked for sequencing verification, and the sequencing results showed that the strain with the qdhR gene knocked out was the obtained strain with the qdhR gene knocked out.

[0050] (1-4) Step 4: Elimination of knockout plasmid ΔqdhR-gRNA and pEcCas: Pick 3 to 6 strains with knockout qdhR gene and place them in a test tube containing 3 mL LB liquid medium, add 50 µg / mL kanamycin sulfate and a final concentration of 20mM rhamnose, and culture for about 12 hours. Pipette 10 µL of the bacterial solution in the above test tube and transfer it to a test tube containing 3 mL of antibiotic-free LB liquid medium and culture for about 12 hours, then streak it on an LB plate containing 20g / L sucrose and culture at 37°C until a single colony grows.

[0051] The same colony was picked and spotted on non-antibiotic LB, monoclonal antibody LB containing 50 µg / mL kanamycin sulfate, and monoclonal antibody LB containing 50 µg / mL spectinomycin, and cultured overnight at 37°C. If only the non-antibiotic plate grew at the corresponding position, it indicated that the knockout plasmid ΔqdhR-gRNA and pEcCas contained in the bacterium had been eliminated, and it was named the engineered strain BW20-1.

[0052] (2) Based on the engineered strain BW20-1, the endogenous transhydrogenase sthA gene was overexpressed to obtain strain BW20-2.

[0053] (A1) Step 1: Preparation of sthA-1000, an integrated fragment of the overexpressed transhydrogenase sthA gene: Using Escherichia coli BW20-1 genomic DNA as a template, primers sthA-1 and sthA-2 were used to amplify a PCR product containing the upstream homologous arm gene fragment F; primers sthA-3 and sthA-4 were used to amplify a PCR product containing the gene to be integrated sthA (sequence as shown in SEQ ID NO.8); primers sthA-5 and sthA-6 were used to amplify a PCR product containing the downstream homologous arm gene fragment r.

[0054] The specific primer sequences are as follows: sthA-1: 5'-cgaatgcatgttgaagtacgcctg-3'; SEQ ID NO. 9.

[0055] sthA-2: 5'-ctttaatgaattcgctagcactgtacctaggactgagctagccgtcaaggctgcaacttaccgtgatagc-3'; SEQ ID NO. 10.

[0056] sthA-3: 5'-cctaggtacagtgctagcgaattcattaaagaggagaaaggtaccatgccacattcctacgattacgatgc-3'; SEQ ID NO. 11.

[0057] sthA-4: 5'-catcatccgcgcaagaatggatg-3'; SEQ ID NO. 12.

[0058] sthA-5: 5'-catccattcttgcgcggatgatgagccgttcatgatacaggagtag-3'; SEQ ID NO. 13.

[0059] sthA-6: 5'-gagatcaaggtaatatctcttcacttgcgg-3'; SEQ ID NO. 14.

[0060] PCR amplification system: Primestar enzyme (Takara) 25 µL, upstream and downstream primers 2 µL each, template 1 µL, ddH2O 20 µL.

[0061] PCR amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0062] After agarose gel electrophoresis and product recovery, the upstream homology arm gene fragment F, the sthA gene fragment M to be integrated and the downstream homology arm gene fragment r were obtained.

[0063] The upstream homology arm gene fragment F, the sthA fragment to be integrated and the downstream homology arm gene fragment r were used as substrates, and sthA-1 and sthA-6 were used as primers for PCR amplification to obtain a PCR product containing the overexpressed transhydrogenase sthA gene integration fragment sthA-1000. The amplification system and amplification conditions were the same as above.

[0064] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the gene integration fragment sthA-1000.

[0065] (A2) Step 2: Preparation of integration plasmid sthA-gRNA: Except for the upstream primer sthA-gRNA-F, the other steps for preparing the integration plasmid refer to the above (1-2) Step 2: Preparation of knockout plasmid ΔqdhR-gRNA. The sthA-gRNA-F primer sequence used to prepare the integration plasmid sthA-gRNA is as follows: 5'-GGACTAGTGATACGTCTTTGGTGTACCGgttttagagctagaaatagcaagtt-3'; SEQ ID NO.15.

[0066] (A3) Step 3: Integration of sthA gene into the E. coli genome: The gene integration steps are the same as those in step (1-3) above, step 3: knocking out the qdhR gene, except that the knockout plasmid ΔqdhR-gRNA and the knockout fragment ΔqdhR-1000 in step (1-3) above, are replaced with the integration plasmid sthA-gRNA and the integration fragment sthA-1000 used for the integration gene. The other operation steps are the same as those in step (1-3) above, step 3: knocking out the qdhR gene.

[0067] (A4) Step 4: Elimination of integrated plasmid sthA-gRNA and pEcCas: Refer to the fourth step above (1-4): Elimination of knockout plasmid ΔqdhR-gRNA and pEcCas, and eliminate the integrated plasmid sthA-gRNA and pEcCas. The E. coli that has eliminated the integrated plasmid sthA-gRNA and pEcCas was named the engineered strain BW20-2 and used for the next round of gene integration.

[0068] (3) Based on the engineered strain BW20-2, OMS is switched through oxygen-responsive metabolism glpA The endogenous E. coli succinate transporter yjjPB gene cluster was overexpressed. The primers used to prepare the gene integration fragment were yjjPB-1 and yjjPB-2 (using the genomic DNA of E. coli BW25113 as a template), yjjPB-3 and yjjPB-4 (using the synthesized SEQ ID NO.16 as a template, wherein 1-273 bp is the oxygen corresponding metabolic switch OMS glpA ) and yjjPB-5 and yjjPB-6 (using E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was yjjPB-gRNA-F. The strain overexpressing the endogenous E. coli succinate transporter yjjPB gene was named engineered strain BW20-3.

[0069] The specific primer sequences are as follows: yjjPB-1: 5'-ttgctcgtcataccacccgatgg-3'; SEQ ID NO. 17.

[0070] yjjPB-2: 5'-CTCATTAGGCACCGaagtagcctgaatgtccagacactacc-3'; SEQ ID NO. 18.

[0071] yjjPB-3:5'-caggctactt CGGTGCCTAATGAGTGAGCTAAC -3'; SEQ ID NO.19.

[0072] yjjPB-4: 5′-ggaacggtgatgtt tatagtaacacacggaggagaggaggc -3'; SEQ ID NO.20.

[0073] yjjPB-5: 5'-ccgtgtgttaactataaacatcaccgttcctggcatcc-3'; SEQ ID NO. 21.

[0074] yjjPB-6: 5'-ttaacgttgacacaggaacgacgg-3'; SEQ ID NO. 22.

[0075] yjjPB-gRNA-F: 5'-GGACTAGTGCGTCAACATCGATTCAGTGgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 23.

[0076] (4) Based on the engineered strain BW20-2, OMS is switched through oxygen-responsive metabolism glpA The endogenous E. coli C4-dicarboxylate transporter dcuC gene was overexpressed, and the genomic DNA of E. coli BW25113 was used as a template. The primers used to prepare the gene integration fragment were dcuC-1 and dcuC-2 (using the genomic DNA of E. coli BW25113 as a template), dcuC-3 and dcuC-4 (using the synthesized SEQ ID NO.24 as a template, in which 1-273 bp is the oxygen corresponding metabolic switch OMS glpA ) and dcuC-5 and dcuC-6 (using E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was dcuC-gRNA-F. The strain overexpressing the endogenous E. coli C4-dicarboxylate transporter dcuC gene was named engineered strain BW20-4.

[0077] The specific primer sequences are as follows: dcuC-1: Same as SEQ ID NO.17.

[0078] dcuC-2: 5'-CATTAGGCACCGaagtagcctgaatgtccagacactacc-3'; SEQ ID NO. 25.

[0079] dcuC-3: 5'-attcaggctactt CGGTGCCTAATGAGTGAGCTAAC -3'; SEQ ID NO.26.

[0080] dcuC-4: 5'-ggaacggtgatgtt GGTTATGCTAGttacttgcctgtgacc -3'; SEQ ID NO.27.

[0081] dcuC-5: 5'-aaCTAGCATAACCaacatcaccgttcctggcatccg-3'; SEQ ID NO. 28.

[0082] dcuC-6: Same as SEQ ID NO.22.

[0083] dcuC-gRNA-F: Same as SEQ ID NO.23.

[0084] (5) Based on the engineered strain BW20-3, the low expression intensity constitutive promoter P J23114 Replenishment of the phosphate acetyltransferase Pta gene.

[0085] Using E. coli BW25113 genomic DNA as a template, the primers used to prepare the gene integration fragment were Pta-1 and Pta-114-2 (using E. coli BW25113 genomic DNA as a template), Pta-114-3 and Pta-4 (using the synthesized SEQ ID NO.29 as a template), and Pta-5 and Pta-6 (using E. coli BW25113 genomic DNA as a template); the upstream primer used to prepare the integration plasmid was Pta-gRNA-F. The strain after overexpressing the phosphate acetyltransferase Pta gene was named the engineered strain BW20-5.

[0086] The specific primer sequences are as follows: Pta-1: 5'-aatccgaacactgtctgttgttcac-3'; SEQ ID NO. 30.

[0087] Pta-114-2: 5'-ctttaatgaattcgctagcattgtacctaggactgagctagccataaactccgttaattctttgtcatatcgcac-3'; SEQ ID NO. 31.

[0088] Pta-114-3:5'-ggtacaatgctagcgaattcattaaagaggagaaaggtacc gtgtcccgtattat tatgctgatccctaccg -3'; SEQ ID NO.32.

[0089] Pta-4: 5'-catattcacataccgtta ctgctgctgtgcagactgaatcg -3'; SEQ ID NO.33.

[0090] Pta-5: 5'-cagcagcagtaacggtatgtgaatatgctgacatgcc-3'; SEQ ID NO. 34.

[0091] Pta-6: 5'-gcaggagacatcacgtacttacgtac-3'; SEQ ID NO. 35.

[0092] Pta-gRNA-F: 5'-GGACTAGTCGAGATCCCAATAATCACGGgttttagagctagaaatagcaagtt-3'; SEQ ID NO. 36.

[0093] constitutive promoter J23114 The coding sequence is shown in SEQ ID NO.37.

[0094] Tttatggctagctcagtcctaggtacaatgctagc; SEQ ID NO. 37.

[0095] Example 2 Fermentation of recombinant Escherichia coli BW20-3 and BW20-4 in anaerobic bottles The seed culture medium was LBG liquid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, glucose 10 g / L.

[0096] Fermentation medium I: glucose 15 g / L, xylose 5 g / L, K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2•2H2O 30 mg / L, MgSO4•7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B1 4× 10 -4 g / L.

[0097] Preparation method of trace element solution: weigh 1 g FeSO4·7H2O, 1g MnSO4·H2O, 0.1g ZnSO4·7H2O, 0.2g CuSO4, 0.002g NiCl2·6H2O, add water to make the volume 100 mL, then add 100 µl concentrated hydrochloric acid to adjust the pH, then filter the bacteria through a membrane, and add 0.2% to the fermentation medium system.

[0098] The anaerobic fermentation of recombinant Escherichia coli BW20-3 or BW20-4 to produce succinic acid comprises the following steps: (1) Seed culture: Pick a single colony of Escherichia coli BW20-3 or BW20-4 and inoculate it into LBG liquid medium, culture it at 37°C, 200 rpm for 12 h, and then transfer it to fresh LBG liquid medium for secondary activation for 12 h. The activated strain BW20-3 or BW20-4 is used for growth test or fermentation.

[0099] (2) Seed expansion culture: The constant temperature shaking conditions were 37°C and 200 rpm. 50 mL of fermentation medium I was placed in a 250 mL baffled bottle and inoculated to a final concentration of OD 600 =0.5, three parallel experiments were performed for each strain, and aerobic culture was performed for 12 h.

[0100] (3) Anaerobic fermentation: The aerobic cultured bacteria were collected by centrifugation at 5000 rpm for 4 min. Then 50 ml of fermentation medium I was added and 15 g / L sodium bicarbonate was added to maintain the pH. The culture was transferred to an anaerobic bottle with a total volume of 100 mL and placed in a constant temperature shaker at 37°C and 200 rpm for 96 h.

[0101] Analytical method: UltiMate3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) was used to detect the components in the fermentation broth. The concentrations of sugars and organic acids in the fermentation broth were determined using a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 1.

[0102] Table 1

[0103] The results in Table 1 show that in the anaerobic bottle, strain BW20-3 produced 16.13% succinic acid, and the conversion rate in the anaerobic fermentation stage was 1.05 (total sugar); strain BW20-4 produced 15.57% succinic acid, and the conversion rate in the anaerobic fermentation stage was 1.03 (total sugar). Conversion rate in the anaerobic fermentation stage (%) = succinic acid production / total consumption of glucose and xylose x 100%.

[0104] Example 3 Production of succinic acid by fermentation of corn straw hydrolysate by recombinant Escherichia coli BW20-5 in a 5 L fermenter Preparation method of corn straw hydrolyzate: corn straw is crushed and screened with a 25-mesh sieve to obtain corn straw powder, corn straw powder is added to 1% NaOH solution to make the solid content of corn straw powder in the solution reach 10%, then treated at 100℃ for 1 h, and then filtered to obtain corn straw residue. The obtained corn straw residue is rinsed with tap water, and the rinsing is stopped when its pH is the same as the pH of tap water, and then the corn straw residue is dried at 50℃ for standby use. The dried corn straw residue is weighed and dissolved in 0.05 M phosphoric acid solution to make the solid content of corn straw residue in the solution reach 20%, and the third-generation HS cellulase (154 FPU / mL) produced by Novozymes is added with a final concentration of 40 FPU / g (corn straw residue), and then placed in a shaker, 50℃, 200 rpm, enzymolysis for 72 h, centrifuged at 4500 rpm for 15 min after the enzymolysis, and the supernatant is taken to obtain corn straw hydrolyzate.

[0105] Fermentation medium II: corn straw hydrolyzate (total sugar 20 g / L, including 12.8 g / L glucose and 7.2 g / L xylose), K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2•2H2O 30 mg / L, MgSO4•7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B1 4×10 -4 g / L.

[0106] The recombinant Escherichia coli BW20-5 was used to produce succinic acid by anaerobic fermentation in a 5 L fermenter, comprising the following steps: (1) Seed culture: Pick a single colony of Escherichia coli BW20-5 and inoculate it into LBG liquid medium. Culture it at 37°C and 200 rpm for 12 h. Transfer it to fresh LBG liquid medium for secondary activation for 12 h. Collect the activated strain BW20-5 by centrifugation and use it as seeds for anaerobic fermentation production.

[0107] (2) Fermentation culture: 2 L of fermentation medium II was placed in a 5 L fermenter and inoculated with a final concentration of OD 600 =1.0 The initial pH was 7.0, 37 °C, rotation speed was 200 rpm, and aerobic culture was carried out for 12 h. At this time, the dissolved oxygen in the fermentation reached the minimum value and began to rise. Aeration was stopped, stirring was fixed at 200 rpm, the temperature was increased to 38 °C and culture began. During the fermentation process, automatic flow addition was used to control the total sugar concentration between 10-20 g / L, and culture was continued until the end of fermentation.

[0108] (3) Analytical method: UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) was used to detect the components in the fermentation broth. The concentrations of sugars and organic acids in the fermentation broth were determined using a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 2.

[0109] Table 2

[0110] The results in Table 2 show that in a 5 L fermenter, the strain BW20-5 produced 92.4 g / L of succinic acid using the "aerobic-anaerobic" two-stage fermentation. The total sugar consumed in the entire "aerobic-anaerobic" two-stage process was 103.8 g / L, and the conversion rate reached 0.89 g / g (total sugar).

[0111] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid, characterized in that: The genetically engineered bacteria are recombinant Escherichia coli that have been transformed with chassis microorganisms; The chassis microorganism transformation uses the engineered strain BW20 as the starting strain, knocks out the pyruvate dehydrogenase complex regulator PdhR gene, overexpresses the transhydrogenase sthA gene; overexpresses the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC; The expression regulatory element used for overexpression of the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA .

2. The genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 1, characterized in that: The gene sequence of the pyruvate dehydrogenase complex regulatory factor PdhR is shown in SEQ ID NO.1; The transhydrogenase sthA gene sequence is shown in SEQ ID NO.8; The succinate efflux protein yjjPB gene cluster sequence is shown in 274-1568 bp in SEQ ID NO.16; The C4-dicarboxylate transporter gene dcuC sequence is shown in 274-1670 bp in SEQ ID NO.24; The oxygen responsive metabolic switch OMS glpA The sequence is shown in 1-273 bp of SEQ ID NO.

16.

3. The genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 1, characterized in that: It also includes the use of a constitutive promoter P with low expression strength J23114 Replenishment of the phosphate acetyltransferase Pta gene.

4. The genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 3, characterized in that: The phosphate acetyltransferase Pta gene sequence is shown in SEQ ID NO.29; the constitutive promoter P J23114 The sequence is shown as SEQ ID NO.

37.

5. A method for constructing a genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid, characterized in that: The following steps are involved: (1) Using the engineered strain BW20 as the starting strain, the pyruvate dehydrogenase complex regulator PdhR gene was knocked out, the transhydrogenase sthA gene was overexpressed, and the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC was overexpressed; The expression regulatory element used for overexpression of the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA ; and / or (2) Use a constitutive promoter P with low expression intensity J23114 Replenishment of the phosphate acetyltransferase Pta gene.

6. Use of the genetically engineered bacteria according to any one of claims 1 to 4 or the method according to claim 5 in producing succinic acid.

7. Use of the genetically engineered bacteria according to any one of claims 1 to 4 or the method according to claim 5 in increasing the yield of succinic acid.

8. A method for efficiently utilizing corn straw hydrolyzate to produce succinic acid, characterized in that: Fermentation is carried out using the genetically engineered bacteria described in any one of claims 1 to 4 or the genetically engineered bacteria constructed by the method described in claim 5; the carbon source used for fermentation is corn straw hydrolyzate.

Images