Vibrio parahaemolyticus detection method based on toe switch

Abstract

The invention discloses a vibrio parahaemolyticus detection method based on toe switches, and belongs to the technical field of biological medicine. The toe switch provided by the invention is an RNA sequence which is designed according to a bacteria conserved sequence RNA and has a foot structure, and can be subjected to base complementary pairing with the vibrio parahaemolyticus conserved sequence RNA to activate the expression of a report protein; the toe switch is composed of two RNA chains which are Sensor RNA and Trigger RNA respectively, the Sensor RNA is a riboswitch, and the Trigger RNA is used for activating the riboswitch; the ribose switch designed by the invention has the characteristics of high dynamic range, high specificity and the like, and meanwhile, the toe switch has high universality through programmable design so as to respond to any RNA (Ribonucleic Acid) sequence.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to a Vibrio parahaemolyticus detection method based on a toe switch. Background Art

[0002] Vibrio parahaemolyticus (VP) belongs to the kingdom Bacteria, phylum Proteobacteria, class Gammaproteobacteria, order Vibrioles, family Vibrionaceae, and genus Vibrio. Vibrio parahaemolyticus is one of the most common Vibrio bacteria in the ocean, and is widely distributed in the seabed sediments of coastal waters, as well as in seafood such as fish, shrimp, and shellfish, and salted foods. People who accidentally eat seafood carrying Vibrio parahaemolyticus are prone to foodborne poisoning, causing patients to experience vomiting, diarrhea, gastrointestinal cramps, fever, and other gastroenteritis symptoms. In addition, Vibrio parahaemolyticus can easily cause outbreaks of gastroenteritis in farmed seafood, which can cause the death of a large number of farmed products in a short period of time.

[0003] Therefore, it is urgent to establish a rapid detection method, detect early and avoid the outbreak of the disease. At present, the detection methods of Vibrio parahaemolyticus mainly include traditional culture method, immunodiagnosis method and molecular diagnosis method, but the traditional culture method is limited by its long detection cycle, large workload and high requirements for staff's experimental skills, and its scope of application is limited. The immunodiagnosis method has high selectivity for reagents, low sensitivity and prone to cross-reaction. Nucleic acid diagnostic technology mainly includes two categories: conventional PCR amplification and isothermal amplification, but it needs to be realized with the help of expensive instruments and experienced technicians, which is not conducive to on-site detection. Therefore, it is a technical problem that the present invention urgently needs to solve to establish a specific detection method for Vibrio parahaemolyticus in remote and resource-poor areas without expensive instruments and shortage of professionals. Summary of the invention

[0004] Based on the technical problem to be solved by the present invention, the present invention adopts a Vibrio parahaemolyticus detection method based on a toe switch, the method comprising:

[0005] S1. Detect Vibrio parahaemolyticus by using virulence factors or genes expressing virulence factors in Vibrio parahaemolyticus as targets, use the thermolabile hemolysin gene of Vibrio parahaemolyticus as the source sequence for constructing the toe switch, and obtain the Vibrio parahaemolyticus source sequence;

[0006] S2, converting the secondary structure of the toehold switch element into DU+ symbolic language and inputting the Vibrio parahaemolyticus source sequence for screening, running the script, previewing the secondary structure of the nucleic acid sequence, and obtaining the overall defect value of different candidate sequences; using NUPACK software to design appropriate trigger and switch candidate sequences as toehold switch elements in the source sequence to obtain candidate sequences;

[0007] S3, preparing a Switch DNA sequence, wherein the Switch DNA sequence is SEQ ID NO: 1, including a T7 promoter sequence, a terminator sequence, a Vibrio parahaemolyticus specific binding sequence 1, a Vibrio parahaemolyticus specific binding sequence 2 and a green fluorescent protein sequence; the Switch DNA sequence is constructed on a plasmid, introduced into Escherichia coli, and a template DNA is obtained through plasmid extraction, DNA PCR amplification and purification;

[0008] S4, adding solution A, solution B, RNase inhibitor, and the DNA template in the PURExpress In Vitro Protein Synthesis reagent in sequence to obtain a cell-free detection system;

[0009] S5, constructing an RPA amplification system, including an upstream primer and a downstream primer, to obtain an RPA amplification detection system;

[0010] S6. Constructing a detection system for Vibrio parahaemolyticus in samples, including boiling the sample to be tested to extract the genomic DNA of Vibrio parahaemolyticus, adding it to the RPA amplification detection system reaction; adding it to a cell-free detection system for incubation; transferring it to a transparent bottom well plate, and using an ELISA reader to measure the fluorescence intensity of the area where the sample addition well is located.

[0011] Furthermore, the T7 promoter sequence is SEQ ID NO: 2; the terminator sequence is SEQ ID NO: 3; the sequence 1 specifically binding to Vibrio parahaemolyticus is SEQ ID NO: 4; the sequence 2 specifically binding to Vibrio parahaemolyticus is SEQ ID NO: 5; and the green fluorescent protein sequence is SEQ ID NO: 6.

[0012] Furthermore, in the RPA amplification system, the upstream primer sequence is SEQ ID NO:7; and the downstream primer sequence is SEQ ID NO:8.

[0013] Further, the detection method contains a recognition element;

[0014] Furthermore, the recognition element is a toe switch that specifically recognizes Vibrio parahaemolyticus.

[0015] Furthermore, the detection method uses a toe switch biosensor, including Switch RNA and Trigger RNA.

[0016] Furthermore, the virulence factors of Vibrio parahaemolyticus include heat-stable direct hemolysin, TDH-related hemotoxin and heat-labile hemolytic toxin.

[0017] Furthermore, the Switch DNA sequence was constructed on the pCOLADuet-1 plasmid and introduced into Escherichia coli Top10;

[0018] Furthermore, the plasmid is extracted by culturing the Escherichia coli TOP10 containing the plasmid overnight in LB medium; the plasmid is extracted using a plasmid extraction method of a plasmid extraction kit;

[0019] Furthermore, the PCR amplification of DNA uses a high-fidelity PCR kit;

[0020] Further, the purified DNA adopts a purification kit;

[0021] Furthermore, after the purified DNA is purified, the concentration is measured using Nanodrop and the DNA is frozen and stored.

[0022] Furthermore, the cell-free detection system comprises:

[0023] V 溶液A :V 溶液B :V RNA酶抑制剂 :V 400nM DNA模板 =15:20:1:5.

[0024] Furthermore, the Vibrio parahaemolyticus detection system boils the sample to be tested at 100° C. for 2 min to 10 min;

[0025] Furthermore, the extracted genomic DNA of Vibrio parahaemolyticus is added to the RPA amplification detection system and reacted at 37° C. for 10 min to 30 min; and the DNA is added to the cell-free detection system and incubated at 37° C. for 0.5 h to 4 h.

[0026] Furthermore, the microplate reader is in FL mode, and the excitation wavelength of the microplate reader program is set to 488 nm and the emission wavelength is set to 538 nm.

[0027] Compared with the prior art, the present invention proposes a toe switch-based Vibrio parahaemolyticus detection method, which has the advantages of simple operation, high sensitivity, and visualization, and has the following beneficial effects:

[0028] 1. The toe switch proposed in the present invention is an RNA sequence with a toehold structure designed based on the conserved sequence RNA of bacteria, which can undergo base complementary pairing with the conserved sequence RNA of Vibrio parahaemolyticus to activate the expression of reporter protein; the toe switch is composed of two RNA chains, namely Sensor RNA and Trigger RNA, Sensor RNA is a riboswitch, and Trigger RNA is used to activate the riboswitch; the Sensor RNA and Trigger RNA are transcribed from the Sensor DNA and Trigger DNA in vitro expression systems, respectively.

[0029] 2. The Trigger DNA sequence of the present invention is isothermally amplified from Vibrio parahaemolyticus using an upstream primer and a downstream primer with a pT7 promoter, and the sequence is transcribed in an in vitro expression system to obtain a Trigger RNA sequence; the Sensor DNA sequence is programmable and is designed based on the conservative sequence Trigger DNA of the selected Vibrio parahaemolyticus.

[0030] 3. The recognition of the sensor RNA and the conserved sequence RNA of Vibrio parahaemolyticus in the toe switch of the present invention depends on the chain displacement interaction of RNA-RNA. Through the principle of complementary base pairing, the inhibitory effect of the RNA aptamer toehold structure on the translation process is released, thereby promoting the expression of the reporter protein. According to experimental data, the riboswitch designed by the present invention has the characteristics of high dynamic range and high specificity. At the same time, the toe switch has high versatility through programmable design to respond to any RNA sequence.

[0031] 4. The cell-free transcription and translation system of the present invention can perform in vitro transcription and initiate protein synthesis in a short period of time. Combining the cell-free transcription and translation system with the toe switch designed by the present invention and applying it to the detection of pathogenic microorganisms can improve the convenience and timeliness of detection. Experimental data show that the detection of the conserved sequence of Vibrio parahaemolyticus can be achieved within 3 hours without relying on equipment and instruments.

[0032] 5. In actual application scenarios, the content of pathogenic microorganisms in the sample to be detected is low, and nucleic acid amplification is required to obtain a large number of target gene fragments. In actual applications, the present invention uses RPA isothermal amplification technology for amplification, which shortens the amplification time and has strong stability, and can achieve exponential amplification of target gene fragments at room temperature; the present invention couples the RPA isothermal amplification technology with the toe switch, combines it with a cell-free translation system, detects the conserved sequence of Vibrio parahaemolyticus, and achieves a detection sensitivity of 3CFU / μL. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 A detection principle diagram of an embodiment of the present invention is shown;

[0034] Figure 2 A graph showing fluorescence values ​​generated by each group of reaction systems according to an embodiment of the present invention is shown;

[0035] Figure 3 It shows a fluorescence image generated by each group of reaction systems in an embodiment of the present invention;

[0036] Figure 4 A fluorescence value ratio diagram generated by detecting trigger DNA with different concentrations according to an embodiment of the present invention is shown;

[0037] Figure 5 A fluorescence value ratio diagram generated by detecting trigger DNA with different concentrations according to an embodiment of the present invention is shown;

[0038] Figure 6 A fluorescence value ratio diagram generated by detecting different concentrations of VP according to an embodiment of the present invention is shown;

[0039] Figure 7 A specific detection diagram of an embodiment of the present invention is shown. DETAILED DESCRIPTION

[0040] The exemplary embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the exemplary embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0041] In the following examples, unless otherwise specified, the technical means adopted are conventional means well known to those skilled in the art, and the reagents and materials in the present invention are obtained from the market or other public channels.

[0042] The experimental materials and equipment involved in the present invention mainly include but are not limited to:

[0043] Reagents:

[0044] In Vitro Protein Synthesis Kit, Phusion Ultra-Fidelity DNA Polymerase, High-Fidelity PCR Kit, thermostable inorganic pyrophosphatase (TIPP), RNase Inhibitor, and AMV Reverse Transcriptase were purchased from NEB, USA; PCR Purification Kit was purchased from QIAquick; UTP, ATP, GTP, CTP, T7 RNA polymerase, RNASE H, and DNase I were purchased from Thermo Company, USA; TwistAmp Basic Kit Quick Guide was purchased from TwistDX; potassium chloride, magnesium chloride, and sorbitol were purchased from Yuanye (Shanghai, China); dithiothreitol (DTT), Tris-hcl, and PBS phosphate buffer were purchased from Solarbio (Beijing, China); DTZ was purchased from MedChemexpress;

[0045] instrument:

[0046] PCR amplifier (2720-TC), ultra-micro-spectrophotometer (NanoDrop 2000), and Qubit4 fluorimeter (Q33226) were purchased from Thermo Corporation, USA; multifunctional microplate reader (SpectraMax M5) was purchased from Molecular Devices; chemiluminescent gel imager (ChemiDoc XRS+) and high current electrophoresis instrument (Powerpac HC) were purchased from Bio-Rad.

[0047] The technical principle of the present invention mainly includes (see Figure 1): The toe switch-based detection method for Vibrio parahaemolyticus described in the present invention uses a toe switch containing a specific recognition of Vibrio parahaemolyticus as a recognition element. The toe switch is an RNA sequence with a toehold structure designed based on the conserved sequence RNA of bacteria, which can be complementary to the conserved sequence RNA of Vibrio parahaemolyticus to activate the expression of the reporter protein; the toe switch is composed of two RNA chains, namely Sensor RNA (trigger chain, i.e., the target to be detected) and Trigger RNA, Sensor RNA is a riboswitch, and Trigger RNA is used to activate the riboswitch; the Sensor RNA and Trigger RNA are transcribed from the Sensor DNA and Trigger DNA in vitro expression systems, respectively. Among them, the Trigger DNA sequence is isothermally amplified from Vibrio parahaemolyticus by the upstream primer and downstream primer with the pT7 promoter, and the sequence is transcribed in the in vitro expression system to obtain the Trigger RNA sequence; the Sensor DNA sequence is programmable and is designed according to the conserved sequence Trigger DNA of the selected Vibrio parahaemolyticus. The recognition between the sensor RNA and the conserved sequence RNA of Vibrio parahaemolyticus in the toe switch depends on the RNA-RNA chain displacement interaction. Through the principle of base complementary pairing, the inhibitory effect of the RNA aptamer toehold structure on the translation process is released, thereby promoting the expression of the reporter protein. The cell-free transcription and translation system can transcribe in vitro and initiate protein synthesis in a short time. Combining the cell-free transcription and translation system with the toe switch designed by the present invention and applying it to the detection of pathogenic microorganisms can improve the convenience and timeliness of detection.

[0048] A method for ultrasensitive detection of Vibrio parahaemolyticus is established by combining RPA amplification with a cell-free transcription and translation system. The present invention uses a toe switch biosensor, which includes two parts: Switch RNA (detection chain) and Trigger RNA. The Switch chain is designed according to the specific fragment of the target detection object, and the target gene fragment is amplified in large quantities in combination with RPA amplification to further reduce the detection limit. A large number of target gene fragments are obtained through nucleic acid amplification to achieve the detection of low-concentration targets. In this method, the detection system includes 6 μL of solution A, 8 μL of solution B, 0.4 μL of RNAse inhibitor, 2 μL of DNA template (400nM), and 3.6 μL of Trigger detection object. This method can specifically detect the target detection object at 37°C, solve the problem of no expensive instruments in remote and resource-poor areas, and reduce the demand for professionals to achieve specific detection of Vibrio parahaemolyticus.

[0049] Based on the above principle, the present invention proposes a Vibrio parahaemolyticus detection method based on a toe switch, comprising:

[0050] (1) Screening of Vibrio parahaemolyticus source sequences

[0051] Thermostabledirect hemolysin (TDH), TDH related remolysin (TRH) and thermolabile hemolysin (TLH) are important virulence factors of Vibrio parahaemolyticus. The present invention uses these three virulence factors or genes expressing virulence factors as targets to detect Vibrio parahaemolyticus, and uses the thermolabile hemolysin (tlh) gene of Vibrio parahaemolyticus as the source sequence for constructing a toe switch.

[0052] (2) Screening of candidate sequences

[0053] Convert the secondary structure of the toehold switch element into DU+ symbolic language and input the source sequence for screening. Run the script, preview the secondary structure of the nucleic acid sequence, and run the next step of design after checking to obtain the overall defect value of different candidate sequences. Use NUPACK software to design suitable trigger and switch candidate sequences as toehold switch elements in the source sequence.

[0054] (3) Preparation of DNA template

[0055] Switch DNA sequence (SEQ ID NO:1) (899bp):

[0056] TAATACGACTCACTATAGGGAGAAGCAAGCGGGAGTAATGCAGTTA

[0057] ATAGTTGATGGACTTTAGAACAGAGGAGATAAAGATGATCACACT

[0058] ATTAAACCTGGCGGCAGCGCAAAAGatgcgtaaAAtgagcaaaggagaagaacttttca

[0059] ctggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtccgtggagagggtgaagg

[0060] tgatgctacaaacggaaaactcacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtc

[0061] actactctgacctatggtgttcaatgcttttcccgttatccggatcacatgaaacggcatgactttttcaagagtgccat

[0062] gcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggacctacaagacgcgtgctgaagtcaag

[0063] tttgaaggtgatacccttgttaatcgtatcgagttaaagggtattgattttaaagaagatggaaacattcttggacacaa

[0064] actcgagtacaactttaactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttca

[0065] aaattcgccacaacgttgaagatggttccgttcaactagcagaccattatcaacaaaatactccaattggcgatggc

[0066] cctgtccttttaccagacaaccattacctgtcgacacaatctgtcctttcgaaagatcccaacgaaaagcgtgaccac

[0067] atggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaaCTCTACAAATAAtagcataaccccttggggcctctaaacgggtcttgaggggttttttg.

[0068] Among them,

[0069] ① T7 promoter sequence (SEQ ID NO: 2):

[0070] TAATACGACTCACTATA;

[0071] ②Terminator sequence (SEQ ID NO: 3):

[0072] Tagcataaccccttggggcctctaaacgggtcttgaggggttttttg;

[0073] ③Specific binding sequence 1 with Vibrio parahaemolyticus (SEQ ID NO: 4):

[0074] AGAAGCAAGCGGGAGTAATGCAGTTAATAGTGTGAT;

[0075] ④Specific binding sequence 2 with Vibrio parahaemolyticus (SEQ ID NO: 5):

[0076] ATCACACTATTA;

[0077] This sequence is reverse complementary to TAATAGTGTGAT in the above SEQ ID NO:4;

[0078] ⑤Green fluorescent protein sequence (SEQ ID NO:6):

[0079] atgcgtaaAAtgagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtccgtggagagggtgaaggtgatgctacaaacggaaaactcacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtcactactctgacctatggtgttcaatgcttttcccgttatccggatcacatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggacctacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaagggtattgattttaaagaagatggaaacattcttggacacaaactcgagtacaactttaactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacgttgaagatggttccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgtcctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaaCTCTACAAATAA。

[0080] The above DNA sequence was constructed on the _pCOLADuet-1 plasmid by homologous recombination and introduced into E. coli Top10; a certain concentration of template DNA was obtained through plasmid extraction, DNA PCR amplification and purification; the purified template was sent for sequencing. Among them, the plasmid was extracted by culturing E. coli TOP10 containing the above plasmid in LB medium overnight, and then the plasmid was extracted using the plasmid extraction method of the plasmid mini-extraction kit (TIANGEN, DP103); PCR amplified DNA and purified DNA, PCR amplified DNA using a high-fidelity PCR kit (BioLabs, 10104358), and the PCR product was purified using a purification kit (QIAGENDE, 28104); after purification, the concentration was measured using Nanodrop, diluted with double distilled water to a concentration of 400nM and stored at -20°C.

[0081] (4) Establishment of cell-free detection system

[0082] In a 200 μL centrifuge tube, 6 μL of solution A in the PURExpress In Vitro Protein Synthesis reagent, 8 μL of solution B in the PURExpress In Vitro Protein Synthesis reagent, 0.4 μL of RNase inhibitor, and 2 μL of DNA template (400 nM) were added in sequence to form a 16.4 μL cell-free detection system;

[0083] (5) Establishment of RPA amplification system

[0084] Refer to the instructions for RPA amplification reagents.

[0085] Upstream primer (SEQ ID NO:7): CGAGTAGCTGGTGCGATACCAACAGCGAAC;

[0086] Downstream primer (SEQ ID NO: 8): GCTAATACGACTCACTATAGGGGATGAAAA.

[0087] (6) Detection system of Vibrio parahaemolyticus in samples

[0088] The sample to be tested was boiled at 100°C for 5 min to extract the genomic DNA of Vibrio parahaemolyticus, and 3.2 μL was added to the RPA amplification detection system constructed in (5) and reacted at 37°C for 20 min; 3.6 μL was added to the cell-free detection system and incubated at 37°C for 2 h; 20 μL of the reaction system was transferred to a 384-well plate (transparent bottom) and the fluorescence intensity generated was measured using an ELISA reader; the ELISA reader FL mode was selected, and the excitation wavelength of the ELISA reader program was set to 488 nm and the emission wavelength to 538 nm, and the fluorescence intensity was measured in the area where the sample addition wells were located.

[0089] Example 1

[0090] The present invention proposes a construction and verification test of an in vitro cell-free detection system (toe switch).

[0091] Mainly include:

[0092] The present invention sets up 3 groups of reaction systems, namely:

[0093] Reaction system 1: control group, i.e., unfolded linear Switch;

[0094] Reaction system 2: a cell-free detection system containing only the Switch chain;

[0095] Reaction system 3: Add Trigger DNA to reaction system 2;

[0096] After 2 hours of reaction, the fluorescence value was measured using an enzyme reader and placed in a blue light device for observation.

[0097] result :

[0098] Please refer to Table 1. Figure 2 and Figure 3 The fluorescence value increased significantly after the addition of Trigger DNA (Vibrio parahaemolyticus). The 200μL centrifuge tube containing the final product was placed in a blue light lighting device. After the addition of the detection object Trigger DNA, green fluorescence visible to the naked eye was presented, proving the successful construction of the cell-free detection system based on the toe switch as the basic principle.

[0099] Table 1 Fluorescence values ​​generated by each reaction system

[0100]

[0101] Example 2

[0102] The present invention proposes a detection test of Trigger DNA with different concentrations using the detection method of the present invention.

[0103] Mainly include:

[0104] The established cell-free detection system was used to detect 0, 0.15nM, 1.5nM, 15nM, and 150nM Trigger DNA, and the changes in fluorescence values ​​were compared.

[0105] result :

[0106] See Table 2 and Figure 4 The test results show that this detection method has great application potential in actual qualitative detection. When RPA amplification is not used, it can be seen from the results that at least 1.50nM of Trigger DNA is required to stimulate Switch DNA to synthesize green fluorescent protein to produce green fluorescence.

[0107] Table 2 Fluorescence values ​​generated by detection of different concentrations of Trigger DNA

[0108]

[0109] Example 3

[0110] The present invention proposes a detection test of Trigger DNA with different concentrations after combining with RPA amplification.

[0111] Mainly include:

[0112] After RPA amplification, the established cell-free detection system was used to detect 0 and 10 -2 , 10 -1 , 10 -0.3 , 10 0 , 10 1 , 10 2 , 10 3 , 10 4 The nM Trigger DNA was amplified by RPA and then detected to compare the changes in fluorescence values.

[0113] result :

[0114] See Table 3 and Figure 5 The experimental results show that after combining with RPA amplification, the detection limit drops by 9 orders of magnitude, and at least 1aM of Trigger DNA is required to stimulate Switch DNA to synthesize green fluorescent protein to produce green fluorescence.

[0115] Table 3 Fluorescence values ​​generated by detection of different concentrations of Trigger DNA

[0116]

[0117] Example 4

[0118] The invention proposes a real-life Vibrio parahaemolyticus verification test.

[0119] Mainly include:

[0120] Vibrio parahaemolyticus cultured in the laboratory was used, diluted, counted, and boiled at 100°C for 5 minutes to extract the target genomic DNA. 3.2 μL was reacted in the RPA amplification system at 37°C for 20 minutes, and then 3.6 μL was added to the cell-free reaction system for detection, and the changes in fluorescence values ​​were compared.

[0121] result :

[0122] See also Figure 6 The concentration of Vibrio parahaemolyticus in the original solution needs to be at least 800 CFU / mL to open the switch chain and synthesize green fluorescent protein to produce green fluorescence.

[0123] Example 5

[0124] The present invention proposes a specificity verification test of a cell-free measurement system based on a toe switch principle.

[0125] Mainly include:

[0126] The detection system was used to detect the pre-treated bacterial liquids of Vibrio cholerae, Vibrio fluviatilis, Vibrio vulnificus, Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterobacter sakazakii, and Vibrio parahaemolyticus at a final concentration of 1 μM, and the changes in fluorescence values ​​were compared.

[0127] result :

[0128] See also Figure 7 Among the 10 bacteria, only the amplification product of Vibrio parahaemolyticus could be detected positively by the toe switch-based reaction system, while the amplification products of other bacteria were not detected, indicating that the toe switch-based cell-free system has good specificity in detecting Vibrio parahaemolyticus.

[0129] Therefore, the riboswitch designed by the present invention has the characteristics of high dynamic range, high specificity, etc., and the toe switch has high versatility to respond to any RNA sequence through programmable design. The cell-free transcription and translation system can be transcribed in vitro in a short time and start protein synthesis. The cell-free transcription and translation system is combined with the toe switch designed by the present invention and applied to the detection of Vibrio parahaemolyticus, which can improve the convenience and timeliness of detection. Without relying on equipment and instruments, the detection of conserved sequences of Vibrio parahaemolyticus can be achieved within 3 hours.

[0130] It should be noted that the term "comprises" or any other variation thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only these elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprises..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0131] The above are only embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included within the scope of the claims of the present application.

Claims

1. A method for detecting Vibrio parahaemolyticus based on a toe switch, characterized in that: The method includes: S1. Detect Vibrio parahaemolyticus by using virulence factors or genes expressing virulence factors in Vibrio parahaemolyticus as targets, use the thermolabile hemolysin gene of Vibrio parahaemolyticus as the source sequence for constructing the toe switch, and obtain the Vibrio parahaemolyticus source sequence; S2, converting the secondary structure of the toehold switch element into DU+ symbolic language and inputting the Vibrio parahaemolyticus source sequence for screening, running the script, previewing the secondary structure of the nucleic acid sequence, and obtaining the overall defect value of different candidate sequences; using NUPACK software to design appropriate trigger and switch candidate sequences as toehold switch elements in the source sequence to obtain candidate sequences; S3, preparing a Switch DNA sequence, wherein the Switch DNA sequence is SEQ ID NO: 1, including a T7 promoter sequence, a terminator sequence, a Vibrio parahaemolyticus specific binding sequence 1, a Vibrio parahaemolyticus specific binding sequence 2 and a green fluorescent protein sequence; the Switch DNA sequence is constructed on a plasmid, introduced into Escherichia coli, and a template DNA is obtained through plasmid extraction, DNA PCR amplification and purification; S4, adding solution A, solution B, RNase inhibitor, and the template DNA in sequence to obtain a cell-free detection system; S5, constructing an RPA amplification system, including an upstream primer and a downstream primer, to obtain an RPA amplification detection system; S6. Constructing a detection system for Vibrio parahaemolyticus in samples, including boiling the sample to be tested to extract the genomic DNA of Vibrio parahaemolyticus, adding it to the RPA amplification detection system reaction; adding it to a cell-free detection system for incubation; transferring it to a transparent bottom well plate, and using an ELISA reader to measure the fluorescence intensity of the area where the sample addition well is located.

2. The toe switch-based Vibrio parahaemolyticus detection method according to claim 1, characterized in that: The T7 promoter sequence is SEQ ID NO: 2; The terminator sequence is SEQ ID NO: 3; The sequence 1 specifically binding to Vibrio parahaemolyticus is SEQ ID NO: 4; The sequence 2 specifically binding to Vibrio parahaemolyticus is SEQ ID NO: 5; The green fluorescent protein sequence is SEQ ID NO:

6.

3. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: In the RPA amplification system, the upstream primer sequence is SEQ ID NO: 7; The downstream primer sequence is SEQ ID NO:

8.

4. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The detection method contains a recognition element; The recognition element is a toe switch that specifically recognizes Vibrio parahaemolyticus.

5. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The detection method uses a toe switch biosensor; Includes Switch RNA and Trigger RNA.

6. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The virulence factors of Vibrio parahaemolyticus include heat-stable direct hemolysin, TDH-related toxin hemotoxin and heat-labile hemolytic toxin.

7. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The Switch DNA sequence was constructed on the pCOLADuet-1 plasmid and introduced into E. coli Top10; The plasmid is extracted by culturing Escherichia coli TOP10 containing the plasmid overnight in LB medium; the plasmid is extracted using a plasmid extraction method of a plasmid extraction kit; The PCR amplification of DNA adopts a high-fidelity PCR kit; The purified DNA adopts a purification kit; After the purified DNA, the concentration was measured using Nanodrop and the DNA was frozen and stored.

8. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The cell-free detection system comprises: V 溶液A :V 溶液B :V RNA酶抑制剂 :V 400nM模板DNA =15:20:1:5。 9. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The Vibrio parahaemolyticus detection system boils the sample to be tested at 100° C. for 2 to 10 minutes; The extracted genomic DNA of Vibrio parahaemolyticus is added to the RPA amplification detection system and reacted at 37° C. for 10 min to 30 min; and the DNA is added to the cell-free detection system and incubated at 37° C. for 0.5 h to 4 h.

10. The method for detecting Vibrio parahaemolyticus based on a toe switch according to claim 1, characterized in that: The microplate reader was in FL mode, and the excitation wavelength and emission wavelength of the microplate reader were set to 488 nm and 538 nm, respectively.

Images