Application of rice OsRNU7 gene

Abstract

The invention discloses an application of a rice OsRNU7 gene. The registration number of the nucleotide sequence of the OsRNU7 gene in Genbank is LOC4337677, and the registration number of the nucleotide sequence of the OsRNU7 gene is LOC4337677. RNA-seq is utilized to discover that the OsRNU7 shows response to the external nitrogen supply level, and fluorescent quantitative PCR (Polymerase Chain Reaction) proves that the OsRNU7 is induced by high nitrogen. The OsRNU7 is knocked out, so that the nitrogen absorption rate, the plant height and the yield of the rice are reduced, and the comprehensive performance is that the nitrogen fertilizer utilization efficiency is reduced. The function of the OsRNU7 gene for positively regulating the utilization efficiency of the rice nitrogen fertilizer is defined, and a technical route for improving the utilization efficiency of the rice nitrogen fertilizer by increasing the expression of the OsRNU7 in rice is provided.

Description

Technical Field

[0001] The invention belongs to the technical field of plant gene engineering and discloses an application of OsRNU7 for regulating rice nitrogen fertilizer utilization efficiency and yield. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world, so the safe and efficient production of rice plays a vital role in the world's food security. In the early 1960s, the breeding of semi-dwarf wheat and rice varieties successfully solved the contradiction between "high yield and lodging", improved the harvest index, greatly increased the yield of crops, and greatly alleviated the food crisis caused by the rapid population growth. It was called the first "Green Revolution". The "Green Revolution" varieties inhibited the metabolism or signaling pathway of gibberellin (GA), endowed crops with semi-dwarf characteristics, and greatly improved the fertilizer tolerance and harvest index of crops. However, this also caused the nitrogen absorption capacity of the roots of semi-dwarf varieties to decrease, and the response to nitrogen was weakened, resulting in a decrease in their nitrogen use efficiency (NUE). Therefore, although the yield of semi-dwarf varieties is high, their high yield depends on the large input of nitrogen fertilizer.

[0003] Although a number of genes that can improve rice NUE have been identified, there is still a long way to go to achieve the goal of breeding truly "green and high-yield" rice varieties. It is still necessary to continuously explore new genetic resources and analyze and identify the regulatory networks in plant development and nutrient metabolism. Summary of the invention

[0004] The purpose of the present invention is to provide an application of rice OsRNU7 gene in view of the above-mentioned deficiencies in the prior art.

[0005] Another object of the present invention is to provide a potential method for improving nitrogen fertilizer use efficiency of rice.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The use of rice OsRNU7 gene in regulating rice nitrogen fertilizer utilization efficiency and / or yield is characterized in that the nucleotide sequence of the OsRNU7 gene is shown in SEQ ID NO.1.

[0008] OsRNU7 responds to the external nitrogen supply level, and its expression level is induced by high nitrogen concentration.

[0009] Knocking out or silencing the OsRNU7 gene can reduce the nitrogen uptake rate, plant height and yield of rice.

[0010] Knocking out or silencing the OsRNU7 gene can reduce nitrogen fertilizer use efficiency and / or yield of rice.

[0011] Overexpression of the OsRNU7 gene can improve the nitrogen fertilizer utilization efficiency and / or yield of rice.

[0012] Beneficial effects:

[0013] The present invention subjected the wild-type material WYJ7 to high and low nitrogen treatments, and found through RNA-seq experiments that the OsRNU7 gene in rice showed a response to the nitrogen supply level in the outside world, and proved through fluorescent quantitative PCR that OsRNU7 had a clear tendency to be induced by high nitrogen. Therefore, the mutant material OsRNU7 was constructed, and the wild-type material and the mutant material were subjected to high nitrogen treatment. 15 N isotope-labeled nitrogen absorption rate measurements and field phenotypic surveys found that knocking out the OsRNU7 gene would reduce the nitrogen absorption rate, plant height and yield of rice, clarifying the function of the OsRNU7 gene in positively regulating the nitrogen fertilizer utilization efficiency of rice, and providing a technical route to improve the nitrogen fertilizer utilization efficiency of rice by increasing the expression of OsRNU7 in rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Shown is the transcript abundance of OsRNU7 under different nitrogen concentrations.

[0015] Figure 2 The mutation type of the OsRNU7 gene of the mutant material osrnu7 is shown. The structure of the OsRNU7 gene is shown in the figure, exons are represented by black boxes, introns are represented by lines, and the nucleic acid sequence below the gene structure is the target sequence.

[0016] Figure 3 Comparative analysis of important agronomic traits of wild-type WYJ7 and mutant material osrnu7. (a) Field phenotype of osrnu7 transgenic material; (b) plant height; (c) tillering; (g) yield per plant; (h) nitrogen absorption rate. DETAILED DESCRIPTION

[0017] In the following examples, WYJ7 is the abbreviation of Wuyunjing 7.

[0018] Example 1: OsRNU7 responds to changes in external nitrogen supply levels

[0019] In order to preliminarily verify whether the OsRNU7 gene responds to the external nitrogen supply level, the japonica rice material WYJ7 cultured under four nitrogen concentrations (0.15N, 0.1875mM NH4NO3; 0.3N, 0.375mM NH4NO3; 0.6N, 0.75mM NH4NO3; 1N, 1.25mM NH4NO3) was used to extract its total RNA for reverse transcription, and then the transcription level of OsRNU7 was detected by fluorescent quantitative PCR, and its expression level was analyzed whether it changed with the change of external N concentration. The specific detection method was as follows: total RNA was extracted from different plant tissues using TRIzol reagent, and full-length cDNA was reverse transcribed using a cDNA synthesis kit (TransGen, AT341). RT-PCR reaction was then performed according to the instructions (TransGen, AQ601), and the reaction conditions were: first step, 94 ° C pre-denaturation for 3 min; second step, 98 ° C denaturation for 15 s; third step, 58 ° C annealing for 15 s; fourth step, 72 ° C extension for 20 s; second step, third step and fourth step for 45 cycles; fifth step, melting curve analysis. Each RT-qPCR test included at least three biological replicates. Rice ACTIN1 gene (OsActin1, LOC_Os03g50885) was used as an internal reference. The relevant RT-qPCR primer sequences are shown in Table 1.

[0020] Table 1

[0021] Primers Forward primer sequence (5'-3') Reverse primer sequence (5'-3') OsActin1 AGCAGCATGAAGATCAAGGTGGTC CCTTGGCAATCCACATCTGCTG OsRNU7 GTAACGAAGAGCCTGCACCT GCTCAGAAATGCAGAAGCAGC

[0022] The results showed that OsRNU7 responded to the nitrogen supply level in the environment, and its expression level was induced by high nitrogen concentration ( Figure 1 ).

[0023] Example 2: Construction of rice OsRNU7 gene mutant osrnu7

[0024] In order to verify that OsRNU7 is a key site that can regulate the nitrogen absorption rate of rice, we used the CRISPR-Cas9 system to construct the knockout material of OsRNU7. First, the OsRNU7 target sequence was designed through the CRISPR-P website, and the rice U6+U3 promoter transcription unit was used as a template (SEQ ID NO.2) for PCR amplification. The PCR product was recovered by gel and connected to the TKC vector that had been completely digested by Spe I (Yubing He; Min Zhu; Lihao Wang; Qiaoyan Wang; Rongchen Wang; Yunde Zhao; Improvements of TKC Technology Accelerate Isolation of Transgene-Free CRISPR / Cas9-Edited Rice Plants. Rice Science; 2019, 26(2): 109-117). Finally, Escherichia coli was transformed to obtain positive transformants and sent for sequencing. The constructed OsRNU7 knockout vector was transformed by Agrobacterium tumefaciens to insert the target gene into the genome of Agrobacterium tumefaciens. With the help of Agrobacterium tumefaciens infection of plants, the transfer and integration of foreign genes into plant cells was achieved, and it was introduced into japonica rice WYJ7 to obtain the OsRNU7 gene mutant osrnu7. The primer sequences for constructing the osrnu7 knockout vector are shown in Table 2.

[0025] Table 2

[0026]

[0027] Sequencing analysis revealed that OsRNU7 lacked a base A in the second exon, which ultimately caused premature termination ( Figure 2 ).

[0028] Example 3: Comparative analysis of agronomic traits such as nitrogen absorption rate and yield of mutant osrnu7

[0029] In the field yield test, the wild type WYJ7 and the mutant material osrnu7 were planted in the field (nitrogen application rate was 210 kg / ha), and various important agronomic traits were observed and counted.

[0030] Specific statistical methods: Plant height statistics: After the rice matures, 15 plants are taken in the field to measure the plant height. Number of spikelets: After the rice matures, 12 spikelets on the main tillers are taken in the field, and the number of spikelets on each spike is directly counted and recorded. Single plant yield statistics: After the rice is fully mature, 12 single plants in the plot are taken for threshing. The harvested seeds are dried at a constant temperature of 37°C and then weighed to obtain the single plant yield data. Three repeated tests are required.

[0031] The statistical results showed that the mutant osrnu7 had reduced plant height, increased tillering, and weakened plant growth, which ultimately led to a decrease in single-plant yield ( Figure 3 ad).

[0032] Subsequently, we investigated the expression of wild-type WYJ7 and mutant osrnu7. 15 The nitrogen absorption rate was tested. The specific method for determining the nitrogen absorption rate was as follows: the seeds of WYJ7 and OsRNU7 were disinfected with 20% sodium hypochlorite solution for 30 minutes. After that, they were placed in a 37°C incubator and soaked in water for 24 hours. The water was drained and the seeds were transferred to a 28°C incubator for germination. After the seeds turned white, they were transferred to a hollow 96-well plate and cultured for 7 days. The seedlings with the same growth potential were selected and transferred to 40L nutrient solution (1.25mM NH4NO3, 0.5mM NaH2PO4·2H2O, 0.75mM K2SO4, 1mM CaCl2, 1.667mM MgSO4·7H2O, 40μM Fe-EDTA(Na), 19μMH3BO3, 9.1μM MnSO4·H2O, 0.15μM ZnSO4·7H2O, 0.16μM CuSO4, and 0.52μM (NH4)3Mo7O 24 4H2O, pH 5.5). When treated with different nitrogen concentrations, the 1N (1.25mM NH4NO3) in the standard nutrient solution needs to be replaced with 0.6N (0.75mM NH4NO3), 0.3N (0.375mM NH4NO3) and 0.15N (0.1875mM NH4NO3). The culture was continued for 4 weeks and the pH value was adjusted every 2 days.

[0033] After 4 weeks of cultivation, the rice roots were immersed in 0.1 mM CaSO4 for 1 min and then transferred to a medium containing 2.5 mM K 15 NO3 nutrient solution for 5 minutes, and finally transferred to 0.1mM CaSO4 for 1 minute. Use filter paper or gauze to absorb the moisture of the roots, cut the roots, dry them, grind them, and measure 15 N content (completed by Li Yuzhong's laboratory at the Chinese Academy of Agricultural Sciences, using the Isoprime 100 instrument). The results showed that the nitrogen absorption rate of the mutant osrnu7 was significantly reduced ( Figure 3 e).

Claims

1. Application of rice OsRNU7 gene in regulating nitrogen fertilizer utilization efficiency and / or yield of rice, characterized in that: The nucleotide sequence of the OsRNU7 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: OsRNU7 responds to the external nitrogen supply level, and its expression level is induced by high nitrogen concentration.

3. The use according to claim 1, characterized in that: Knocking out or silencing the OsRNU7 gene can reduce the nitrogen uptake rate, plant height and yield of rice.

4. The use according to claim 1, characterized in that: Knocking out or silencing the OsRNU7 gene can reduce nitrogen fertilizer use efficiency and / or yield of rice.

5. The use according to claim 1, characterized in that: Overexpression of the OsRNU7 gene can improve the nitrogen fertilizer utilization efficiency and / or yield of rice.

Images