SNP (Single Nucleotide Polymorphism) molecular marker related to meat percentage character of procambarus clarkii and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to the meat percentage character of procambarus clarkia and application of the SNP molecular marker, genetic typing is performed on the procambarus clarkia through whole genome association analysis, whole genome association analysis is performed on the meat percentage of the procambarus clarkia, and the SNP marker remarkably related to the meat percentage character is screened out and comprises one or more of SNP1-SNP10. By detecting the SNP marker, the procambarus clarkii with high growth speed and high meat percentage can be effectively predicted and bred, the breeding efficiency and accuracy of the procambarus clarkii are remarkably improved, a new variety of the procambarus clarkii with high yield and high quality is bred, and the SNP marker has a wide application prospect in the aspect of molecular breeding of the procambarus clarkii with the meat percentage character.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of aquatic animals, and particularly relates to a SNP molecular marker related to the meat yield trait of Procambarus clarkii and an application thereof. Background Art

[0002] Procambarus clarkii, commonly known as crayfish, is an important freshwater economic aquaculture shrimp in my country. Procambarus clarkii aquaculture in my country began in the late last century. After more than 20 years of development, the aquaculture area of ​​Procambarus clarkii in my country reached 28 million mu in 2022, and the total output reached 2.8907 million tons, accounting for 8.79% of the total freshwater aquaculture output in China, ranking fourth among freshwater aquaculture species in my country (Zhang et al., 2024). Procambarus clarkii is an important aquaculture species, and its growth rate and meat yield directly affect its economic value. With the development of genotyping technology, molecular marker-assisted selection breeding has become one of the main methods to improve breeding efficiency. At present, research on molecular markers related to crustacean aquatic animals mainly focuses on growth traits, such as body length of white shrimp (Wang et al., 2020), weight-related SNP markers (Lyu et al., 2021), and weight-related SNP markers of Macrobrachium rosenbergii (Haldar et al., 2021), etc. However, there are few studies on meat yield traits, which cannot meet the needs of high-quality and efficient breeding. Summary of the invention

[0003] The main purpose of the present invention is to provide a SNP molecular marker related to the meat yield trait of Procambarus clarkii, and by detecting the SNP marker, it is possible to effectively predict and breed Procambarus clarkii with high growth rate and high meat yield.

[0004] Another object of the present invention is to provide the use of the SNP molecular marker associated with the meat yield trait of Procambarus clarkii in molecular marker-assisted selection breeding of Procambarus clarkii.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, a SNP molecular marker related to the meat yield trait of Procambarus clarkii is provided, comprising one or more of the following SNP1 to SNP10:

[0007] SNP1: located at position 2044017 of the reference sequence NC_059637.1, when the genotype is T / C, it is associated with the high meat yield trait;

[0008] SNP2: located at position 2811781 of the reference sequence NC_059641.1, when the genotype is T / A, it is associated with the trait of high meat yield;

[0009] SNP3: located at position 15095358 of the reference sequence NC_059583.1, when the genotype is A / C, it is associated with the trait of high meat yield;

[0010] SNP4: located at position 15095371 of the reference sequence NC_059583.1, when the genotype is C / T, it is associated with the high meat yield trait;

[0011] SNP5: located at position 15095372 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the trait of high meat yield;

[0012] SNP6: located at position 16436323 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the trait of high meat yield;

[0013] SNP7: located at position 18359132 of the reference sequence NC_059588.1, when the genotype is G / A, it is associated with the trait of high meat yield;

[0014] SNP8: Located at position 23482715 of the reference sequence NC_059588.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0015] SNP9: located at position 23872620 of the reference sequence NC_059586.1, when the genotype is A / G, it is associated with the trait of high meat yield;

[0016] SNP10: Located at position 23903204 of the reference sequence NC_059586.1, when the genotype is T / G, it is associated with the trait of high meat yield.

[0017] Preferably, the SNP molecular markers associated with the meat yield trait of Procambarus clarkii are screened and identified by genome-wide association analysis (GWAS), and the SNP molecular markers include one or more of SNP1 to SNP10.

[0018] The second aspect of the present invention provides the use of the SNP molecular marker associated with the meat yield trait of Procambarus clarkii in the early breeding of Procambarus clarkii with high meat yield.

[0019] The third aspect of the present invention provides the use of the SNP molecular marker associated with the meat yield trait of Procambarus clarkii in molecular marker-assisted selection (MAS) breeding of Procambarus clarkii.

[0020] A fourth aspect of the present invention provides a method for identifying the meat yield trait of Procambarus clarkii, comprising the following steps:

[0021] (1) extracting genomic DNA of the crayfish to be identified;

[0022] (2) PCR amplification technology is used to detect the SNP molecular markers related to the meat yield trait of Procambarus clarkii, wherein:

[0023] The primers used to amplify the SNP1 molecular marker are specifically:

[0024] F: CAATCGAACTTCTTCAGGTGTC; R: CCAGCCATGTTGAACAGAAA;

[0025] The primers used to amplify the SNP2 molecular marker are specifically:

[0026] F: AGCAAGTCCATTCCATCCAG; R: GCGTCTCGGGTAAACAAACA;

[0027] The primers used to amplify the SNP3 molecular marker are specifically:

[0028] F: AGTTGTGCTTGTGGATGTCG; R: TGGAATGCGTTAGGAAGTGA;

[0029] The primers used to amplify the SNP4 molecular marker are specifically:

[0030] F: GTTCTCCTCTGATGTTTGTTGG; R: TGGAATGCGTTAGGAAGTGA;

[0031] The primers used to amplify the SNP5 molecular marker are specifically:

[0032] F: TCTCCTCTGATGTTTGTTGGG; R: TGGAATGCGTTAGGAAGTG;

[0033] The primers used to amplify the SNP6 molecular marker are specifically:

[0034] F: ACATCACTTCCTAATGCGTTCC; R: AGATTACCAATGAGGAGGCG;

[0035] The primers used to amplify the SNP7 molecular marker are specifically:

[0036] F: AAGTCAACGGAGAGGCAAAG; R: TGTTGCGTCGGTTCTCTTCT;

[0037] The primers used to amplify the SNP8 molecular marker are specifically:

[0038] F: ACGTAGAAACCGATCCTGATG; R: GACCCTGTGTTACTGGTATTGG

[0039] The primers used to amplify the SNP9 molecular marker are specifically:

[0040] F: TACGAAGAATGCCAGAAGACAG; R: GAAAACGGAACCACTGACCA;

[0041] The primers used to amplify the SNP10 molecular marker are specifically:

[0042] F: GTAAGCGACATGCTCACGAA; R: TTCACCTATTCTGTTCCTGGCG.

[0043] (3) determining the meat yield characteristics of the Procambarus clarkii to be identified based on the test results;

[0044] SNP1: When the genotype is T / C, it is associated with the trait of high meat yield;

[0045] SNP2: When the genotype is T / A, it is associated with the trait of high meat yield;

[0046] SNP3: When the genotype is A / C, it is associated with the trait of high meat yield;

[0047] SNP4: When the genotype is C / T, it is associated with the trait of high meat yield;

[0048] SNP5: When the genotype is A / G, it is associated with the trait of high meat yield;

[0049] SNP6: When the genotype is A / G, it is associated with the trait of high meat yield;

[0050] SNP7: When the genotype is G / A, it is associated with the trait of high meat yield;

[0051] SNP8: When the genotype is A / G, it is associated with the trait of high meat yield;

[0052] SNP9: When the genotype is A / G, it is associated with the trait of high meat yield;

[0053] SNP10: When the genotype is T / G, it is associated with the trait of high meat yield.

[0054] A fifth aspect of the present invention provides a method for breeding Procambarus clarkii with high meat yield, comprising the following steps:

[0055] (a) Selecting parent individuals carrying favorable SNP genotypes;

[0056] (b) obtaining offspring individuals through hybridization;

[0057] (c) Perform SNP genotype screening on the offspring individuals and select individuals carrying favorable genotypes for breeding as high-meat-yield crayfish.

[0058] Preferably, the favorable genotype is a specific allele combination of the SNP molecular marker.

[0059] In a sixth aspect of the present invention, a kit for detecting high meat yield Procambarus clarkii is provided, which comprises primers for detecting the SNP molecular markers of Procambarus clarkii, as shown in the following table:

[0060]

[0061] Preferably, the primers or probes are used for PCR, real-time fluorescence quantitative PCR, SNP chip or high-throughput sequencing technology.

[0062] Compared with the prior art, the present invention has the following beneficial effects:

[0063] 1. The SNP molecular markers of the present invention can improve breeding efficiency and breeding effect through MAS breeding. For example, PCR amplification and gene sequencing technology are used to detect the genotype of Procambarus clarkii, and Procambarus clarkii individuals with excellent growth and meat yield traits are screened. They are used as parents for breeding, which can improve the meat yield of the offspring group.

[0064] 2. In combination with the traditional phenotypic selection method, the SNP molecular markers related to the meat yield trait of Procambarus clarkii in the present invention are used for molecular marker-assisted selection breeding, which can significantly improve the breeding efficiency and accuracy of Procambarus clarkii, and breed new varieties of Procambarus clarkii with high yield and high quality, which has broad application prospects in the molecular breeding of Procambarus clarkii meat yield trait. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 This is the Manhattan-QQ plot of the fleshing rate traits of chromosomes 1 to 23 in the whole genome association analysis of Procambarus clarkii in the example. After taking the intersection of multiple models, there is a total of 1 SNP on the threshold line, including 1 on chromosome 1.

[0066] Figure 2 This is the Manhattan-QQ plot of the fleshing rate traits of chromosomes 24 to 47 in the whole genome association analysis of Procambarus clarkii in the example. After taking the intersection of multiple models, there are 3 SNPs on the threshold line, 3 of which are on chromosome 25.

[0067] Figure 3This is the Manhattan-QQ plot of the meat yield traits of chromosomes 48 to 70 in the whole genome association analysis of Procambarus clarkii in the example. After taking the intersection of multiple models, there are 5 SNPs on the threshold line, including 1 each on chromosomes 57, 62, 63, 64, and 67.

[0068] Figure 4 This is the Manhattan-QQ plot of the fleshing rate traits of chromosomes 71 to 93 in the whole genome association analysis of Procambarus clarkii in the embodiment. After taking the intersection of multiple models, there is a total of 1 SNP on the threshold line, including 1 on chromosome 73. DETAILED DESCRIPTION

[0069] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described in conjunction with the drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0070] Example 1 Genomic DNA extraction and genome resequencing

[0071] S01. DNA extraction and quality testing:

[0072] (1) The muscle tissues of 150 adult Procambarus clarkii were collected, ground in an ice bath using an automatic tissue homogenizer, and placed in a 1.5 mL centrifuge tube, and 200 μL of buffer GA was immediately added;

[0073] (2) Add 20 μL of Proteinase K solution, mix well, and place in a 56°C constant temperature water bath until the tissue is completely digested. Centrifuge briefly every 30 minutes to mix well to remove water droplets on the inner wall of the tube cap;

[0074] (3) Add 200 μL of buffer GB, mix thoroughly by inversion, and place at 70°C for 10 min. Vortex mix every 3 min until the solution becomes clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0075] (4) Add 200 μL of anhydrous ethanol, gently invert and mix the sample, let it stand at room temperature for 5 min, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0076] (5) Transfer the solution obtained in the previous step into adsorption column CR2 (the adsorption column is placed in a collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column back into the collection tube;

[0077] (6) Add 500 μL of buffer GD to the adsorption column CR2, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and return the adsorption column to the collection tube;

[0078] (7) Add 600 μL of rinse solution PW to the adsorption column CR2, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, put the adsorption column back into the collection tube, and repeat this operation once;

[0079] (8) Centrifuge at 12,000 rpm for 2 min, discard the waste liquid, and place the adsorption column CR2 at room temperature for 5 min until the residual rinse liquid is dried;

[0080] (9) Transfer the adsorption column CR2 into a clean centrifuge tube, add 50 μL of elution buffer TB to the middle of the adsorption membrane, let it stand at room temperature for 3 min, centrifuge at 12,000 rpm for 2 min, collect the solution into a centrifuge tube, obtain the sample genomic DNA, and use agarose gel electrophoresis to detect the DNA quality.

[0081] S02. Genome resequencing and genotyping:

[0082] (1) constructing a DNA sequencing library using the DNA sample extracted above, and performing genome sequencing using a high-throughput platform;

[0083] (2) Perform quality control on the sequencing data of Procambarus clarkii, align the quality-controlled data to the reference genome of Procambarus clarkii using BWA, and perform SNP typing;

[0084] (3) The obtained VCF files were used for quality control of SNP loci, and individuals with missing rates exceeding 10% and SNP loci with non-binary variants were eliminated;

[0085] (4) The SNP data were filled and 24 SNP molecular marker sites were screened for subsequent analysis.

[0086] Example 2 Genome-wide association analysis of growth traits of Procambarus clarkii

[0087] 1. SNP molecular marker quality control

[0088] According to the reliable SNP molecular marker sites selected after the above genotype filling, the filled SNPs were quality controlled respectively, and the SNPs with the minimum allele frequency less than 0.05 and deviating from the Hartmann-Wenzhou equilibrium (P=1E-5) were eliminated for genome-wide association analysis.

[0089] 2. Genome-wide association analysis of growth and meat yield traits of Procambarus clarkii

[0090] The experimental population used for the whole genome association analysis was from Wuhu Shengdian Leisure Ecological Park Co., Ltd., Fanchang District, Wuhu City, Anhui Province, including 150 adult shrimps. LINUX and R language were used to conduct whole genome association analysis on SNP molecular markers and the meat yield of Procambarus clarkii.

[0091] According to the results of GWAS, the P value of each SNP site is calculated as -log(P), and calculated according to the significant threshold line calculation formula -log(1 / SNP number). When the -log(P) value of each SNP site is not less than 5, it indicates that there is a significant association between the SNP and the trait.

[0092] 3. Analysis of the results of genome-wide association analysis of growth and meat yield traits of Procambarus clarkii

[0093] The GWAS results showed that significant SNP sites were identified for the meat yield of Procambarus clarkii; the QQ plot results showed that most of the sites in the lower left corner of the plot were on the diagonal line, indicating that the selected model was accurate, and the sites in the upper right corner that exceeded the diagonal line and the confidence interval were highly significant with the target trait. In addition, the QQ plots of different models selected in this analysis were basically consistent, indicating that the analysis results were reliable.

[0094] After integrating the analysis results, 10 SNPs were found to be significantly associated with meat yield, namely:

[0095] SNP1: located at position 2044017 of the reference sequence NC_059637.1, when the genotype is T / C, it is associated with the high meat yield trait;

[0096] SNP2: located at position 2811781 of the reference sequence NC_059641.1, when the genotype is T / A, it is associated with the trait of high meat yield;

[0097] SNP3: located at position 15095358 of the reference sequence NC_059583.1, when the genotype is A / C, it is associated with the trait of high meat yield;

[0098] SNP4: located at position 15095371 of the reference sequence NC_059583.1, when the genotype is C / T, it is associated with the high meat yield trait;

[0099] SNP5: located at position 15095372 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the trait of high meat yield;

[0100] SNP6: located at position 16436323 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the trait of high meat yield;

[0101] SNP7: located at position 18359132 of the reference sequence NC_059588.1, when the genotype is G / A, it is associated with the trait of high meat yield;

[0102] SNP8: Located at position 23482715 of the reference sequence NC_059588.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0103] SNP9: located at position 23872620 of the reference sequence NC_059586.1, when the genotype is A / G, it is associated with the trait of high meat yield;

[0104] SNP10: Located at position 23903204 of the reference sequence NC_059586.1, when the genotype is T / G, it is associated with the trait of high meat yield.

[0105] Among them, the primers used to detect the SNP molecular markers of Procambarus clarkii are shown in Table 1:

[0106] Table 1

[0107]

[0108]

[0109] 4. Identification of candidate genes

[0110] Using the sequences within 250bp upstream and downstream of the genomic region where the above-mentioned SNP marker is located, the candidate genes were annotated and identified online through the KOBAS database, and a candidate gene LOC123773676 (tight junction protein ZO-1-like) that was significantly correlated with the meat yield of Procambarus clarkii was identified. This gene is mainly related to the cytoskeleton and molting.

[0111] 5. Application of molecular marker-assisted breeding

[0112] The screened SNP molecular markers are applied to the breeding of Procambarus clarkii. By detecting the genotype of the SNP markers, the meat yield trait of Procambarus clarkii is determined, thereby selecting high-quality new varieties of Procambarus clarkii.

[0113] Table 2: Candidate SNP loci for the meat yield trait of Procambarus clarkii identified based on GWAS

[0114]

[0115]

[0116] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the meat yield trait of Procambarus clarkii, characterized in that: It includes one or more of SNP1 to SNP10, wherein: SNP1: located at position 2044017 of the reference sequence NC_059637.1; SNP2: located at position 2811781 of the reference sequence NC_059641.1; SNP3: located at position 15095358 of the reference sequence NC_059583.1; SNP4: located at position 15095371 of the reference sequence NC_059583.1; SNP5: located at position 15095372 of the reference sequence NC_059583.1; SNP6: located at position 16436323 of the reference sequence NC_059583.1; SNP7: located at position 18359132 of the reference sequence NC_059588.1; SNP8: located at position 23482715 of the reference sequence NC_059588.1; SNP9: located at position 23872620 of the reference sequence NC_059586.1; SNP10: Located at position 23903204 of the reference sequence NC_059586.

1.

2. The SNP molecular marker associated with the meat yield trait of Procambarus clarkii according to claim 1, characterized in that: The SNP molecular markers associated with the meat yield trait of Procambarus clarkii are screened and identified through whole genome association analysis, and the SNP molecular markers include one or more of SNP1 to SNP10.

3. Use of the SNP molecular marker associated with the meat yield trait of Procambarus clarkii according to claim 1 or 2 in the early breeding of Procambarus clarkii with high meat yield.

4. Use of the SNP molecular marker associated with the meat yield trait of Procambarus clarkii according to claim 1 or 2 in molecular marker-assisted selection breeding of Procambarus clarkii.

5. A method for identifying the meat yield of Procambarus clarkii, characterized in that: The following steps are involved: (1) extracting genomic DNA of the crayfish to be identified; (2) The SNP molecular markers described in claim 1 are detected using PCR amplification technology, wherein the primer sequences used to amplify the SNP1 to SNP10 molecular markers are shown in the following table: (3) Determine the meat yield characteristics of the Procambarus clarkii to be identified based on the test results, including: SNP1: When the genotype is T / C, it is associated with the trait of high meat yield; SNP2: When the genotype is T / A, it is associated with the trait of high meat yield; SNP3: When the genotype is A / C, it is associated with the trait of high meat yield; SNP4: When the genotype is C / T, it is associated with the trait of high meat yield; SNP5: When the genotype is A / G, it is associated with the trait of high meat yield; SNP6: When the genotype is A / G, it is associated with the trait of high meat yield; SNP7: When the genotype is G / A, it is associated with the trait of high meat yield; SNP8: When the genotype is A / G, it is associated with the trait of high meat yield; SNP9: When the genotype is A / G, it is associated with the trait of high meat yield; SNP10: When the genotype is T / G, it is associated with the trait of high meat yield.

6. A method for breeding crayfish with high meat yield, characterized in that: The following steps are involved: (a) Selecting parent individuals carrying favorable SNP genotypes; (b) obtaining offspring individuals through hybridization; (c) Perform SNP genotype screening on the offspring individuals and select individuals carrying favorable genotypes for breeding as high-meat-yield crayfish.

7. The method for breeding Procambarus clarkii with high meat yield according to claim 6, characterized in that: The favorable genotype is a specific allele combination of the SNP molecular marker.

8. A kit for detecting high meat yield crayfish, characterized in that: It includes primers for detecting SNP molecular markers of Procambarus clarkii, as shown in the following table.

9. The kit for detecting high meat yield crayfish according to claim 8, characterized in that: The primers are used for PCR, real-time fluorescence quantitative PCR, SNP chip or high-throughput sequencing.

Images