Application of small molecule compound R406 in preparation of product for preventing and treating Parkinson's disease

Abstract

The invention belongs to the technical field of medicine, and particularly relates to application of a small molecule compound R406 in preparation of a product for preventing and treating Parkinson's disease, screening based on small molecules and microarrays is carried out, the compound R406 can reduce the alpha-syn protein level in an autophagy-dependent mode, and in addition, the compound R406 can be used for preparing a product for preventing and treating Parkinson's disease. The R406 also reduces the level of alpha-syn phosphorylated serine 129 in a fiber-induced cell model pre-formed by alpha-syn, and prevents neuronal degeneration. In addition, experiments confirm that the R406 can relieve PD-related disease phenotypes in a human alpha-syn preformed fiber-induced cell model and a PD patient-derived organ-like model, and a new thought is provided for treatment of the Parkinson's disease.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and specifically relates to application of a small molecule compound R406 in preparing products for preventing and treating Parkinson's disease. Background Art

[0002] Parkinson's disease (PD) is a common neurodegenerative disease. The clinical symptoms of PD are mainly motor problems, such as resting tremor, limb rigidity, bradykinesia, and impaired voluntary movements. In addition, non-motor symptoms include cognitive impairment, anosmia, anxiety, depression, and sleep disorders. The typical pathological feature of PD is the formation of Lewy bodies (LBs) in the central nervous system, which are mainly composed of insoluble aggregates of α-synuclein (α-syn), which eventually lead to the gradual death and loss of dopaminergic neurons in the substantia nigra and other areas including the locus coeruleus, dorsal raphe nucleus, and dorsal nucleus of the vagus nerve.

[0003] α-Synuclein is a small protein (15 kDa) composed of 140 amino acids, encoded by the SNCA gene, which is highly conserved and has certain neurospecificity. Under physiological conditions, α-synuclein exists in a random coil conformation and is mainly localized in the presynaptic and perinuclear regions of the central nervous system. Its rich proline content and negatively charged residues in the carboxyl terminal structure are essential for maintaining the solubility of the protein. At present, the exact physiological function of α-synuclein is still unclear, but it is known to play a role in the release of synaptic vesicles from the presynaptic membrane of neurons. The aggregation of pathological α-synuclein is considered to be a key pathogenic factor of PD, which can cause mitochondrial damage, increase cellular oxidative stress, and ultimately lead to the death and loss of dopaminergic neurons. Studies have shown that the duplication of the copy number of the SNCA gene encoding α-synuclein can lead to PD. In the case of doubled SNCA copy number, triploids show more severe disease symptoms than diploids, indicating a positive correlation between the expression level of α-synuclein and the severity of PD.

[0004] Currently, the main drugs for the initial treatment of PD include levodopa preparations, dopamine receptor agonists, monoamine oxidase inhibitors type B (MAOB-I) and catechol-O-methyltransferase inhibitors (COMT-I). These treatments mainly focus on dopamine replacement therapy strategies. Over time, patients will develop drug resistance, and after resistance occurs, methods such as deep brain stimulation will also be used to treat PD. However, these treatments can only relieve disease symptoms but cannot change the progression of PD.

[0005] To date, research has focused on reducing α-synuclein levels through gene therapy. For example, technologies such as RNA interference (RNAi) or antisense oligonucleotides (ASOs) can effectively silence the mRNA of the SNCA gene, resulting in a significant reduction in α-synuclein levels and alleviating disease phenotypes in model animals. Other studies have screened effective small guide RNAs (sgRNAs) targeting the SNCA intron 1 region by fusing the inactivated Cas9 protein (dCas9) with DNA methyltransferase 3A (DNMT3A). Cell experiments have confirmed that the use of CRISPR interference (CRISPRi) technology enhanced the methylation level of CpG dinucleotides in the SNCA intron 1 region, effectively reducing the transcription level of the SNCA gene. However, these gene therapies still face problems such as difficult drug delivery and high treatment costs, and need to be further optimized. Therefore, small molecule compounds that can reduce α-synuclein are more likely to cross the blood-brain barrier, are cost-effective, and have low immunogenicity.

[0006] Autophagy is a key “cleaning” system in cells that degrades misfolded proteins and damaged organelles. Studies have reported that small molecule compounds such as hedyotis acid and α-redonin can enhance the clearance of α-synuclein by promoting overall autophagy. In addition, these compounds have been shown to improve behavioral deficits in PD mice induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). However, because cellular autophagy may degrade other proteins and other biomacromolecules that are not desired to be degraded, directly increasing autophagy levels may lead to complex and unexpected consequences.

[0007] The inventors previously proposed a new strategy, ATTEC (autophagosome binding compound), which connects the target protein to the autophagosome characteristic protein LC3 and selectively degrades the target protein without affecting overall autophagy. This strategy was successfully applied to the degradation of mutant HTT protein that causes Huntington's disease. However, the prior art has not conducted any research on other proteins, such as the important target protein α-synuclein, and further on the treatment of Parkinson's disease. Summary of the invention

[0008] The purpose of the present invention is to provide an application of a small molecule compound R406 in the preparation of a product for preventing and treating Parkinson's disease. The compound R406 can alleviate the disease phenotype of PD cells induced by PFFs and PD cells in organoid models, providing a new idea for the treatment of Parkinson's disease.

[0009] The objective of the present invention is achieved through the following technical solutions: The present invention provides an application of a small molecule compound R406 in preparing a medicine for preventing and treating Parkinson's disease.

[0010] Furthermore, the small molecule compound R406 can reduce the level of α-synuclein in an autophagy-dependent manner, thereby slowing down the progression of Parkinson's disease.

[0011] Furthermore, the small molecule compound R406 can also reduce the level of α-syn phosphorylated serine 129 in a cell model induced by α-synuclein preformed fibers and prevent neuronal degeneration.

[0012] Furthermore, the small molecule compound R406 can also enhance the binding between α-synuclein and LC3B protein.

[0013] Furthermore, the dosage forms of the drug include tablets, capsules, oral preparations and injections.

[0014] The present invention also provides a medicine for preventing and treating Parkinson's disease, wherein the small molecule compound R406 is the only active ingredient.

[0015] Furthermore, the drug also includes a pharmaceutically acceptable carrier.

[0016] Beneficial effects: The present invention identified the small molecule compound R406 from a library of 3,375 candidate drugs through unbiased screening based on small molecules-microarrays. This compound R406 can bind to α-synuclein and the autophagic protein LC3B at the same time, which may enhance the connection between α-synuclein and autophagosomes, thereby promoting its autophagic degradation. The data showed that R406 effectively reduced the levels of α-synuclein and α-synuclein phosphorylated at serine 129 at nanomolar concentrations in HEK293 cells, primary cultured neurons, and iPSC-induced organoid models derived from PD patients. Mechanistically, it was demonstrated that R406 enhanced the interaction between LC3B and α-synuclein, and its degradation depended on autophagy. Finally, we found that R406 could alleviate the disease phenotype of PD cells in PFFs-induced PD cells and organoid models. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1The process and result diagram of screening α-synuclein-LC3B binding molecular compounds in the present invention, wherein A is a diagram of the screening design, SMM is replicated on an isocyanate-functionalized glass substrate, and recombinant purified proteins indicated by flow, including LC3B, α-synuclein and MBP, are subjected to OI-RD screening, and non-specific binding is washed by a buffer containing BSA before and after flowing each test protein, and compounds binding to each protein can be identified by subtracting the images after flow from the images before flow, as shown by bright circles, and compounds that show positive signals in the differential images of LC3B and α-synuclein but do not bind to MBP are selected as hit compounds; B is a representative screening result (from two replicated SMM chips), showing ten positive hits (marked with solid red rectangles), and the compounds are annotated according to their positions in the microplate used to print SMM; Figure 2 Figure 2 is a protein purification diagram for screening in the present invention, wherein AC is the SDS-PAGE of expression and purification of LC3B, α-synuclein and MBP used for screening, DE is a representative Western blot of positive compounds screened in HEK293 cells against α-synuclein, and F is a two-dimensional compound structure of R406; Figure 3 Figure 2 is a diagram showing that R406 reduces α-synuclein levels at the cellular level in the present invention, wherein A is a representative Western blot and quantification of α-synuclein levels in HEK293 cells treated with R406, one-way ANOVA and Dunnett's post hoc test; *P<0.05, **P<0.01, B is a representative Western blot and quantification of α-synuclein levels in primary cultured neurons treated with R406, C is a qPCR measurement of SNCA mRNA levels in primary cultured neurons treated with DMSO or R406, one-way ANOVA and Dunnett's post hoc test, D is the cell activity of primary cultured neurons measured by CellTiter-glo assay, Figure 2No toxicity was observed within the concentration range shown in AB, one-way ANOVA with Dunnett's post hoc test, E, representative Western blot and quantification of α-synuclein in syk knockdown HEK293 cells, two-tailed unpaired t-test, ****p<0.0001, F, representative Western blot and quantification of P53 levels in primary cultured neurons treated with the indicated concentrations of the SYK antagonist p505-15, which did not affect α-synuclein levels, one-way ANOVA with Dunnett's post hoc test, for all panels, n indicates the number of independent plating wells from different batches, data are mean ± SEM and analyzed by two-tailed unpaired t-test or one-way ANOVA with Dunnett's post hoc test; Figure 4 Figure 1 is a graph showing the association between the degradation of α-synuclein by R406 and autophagy in the present invention, wherein A is a representative Western blot and quantitative analysis, showing primary cultured neurons treated with R406 with or without the autophagy inhibitor CQ, two-tailed unpaired t-test, ****p<0.0001; B is a representative Western blot and quantitative analysis, showing HEK293 cells treated with R406 with or without the autophagy inhibitor CQ, two-tailed unpaired t-test, *p<0.05; C is a representative Western blot and quantitative analysis of α-synuclein in primary cultured neurons with ATG5 gene knockdown, two-tailed unpaired t-test, **p<0.01, ****p<0.0001; D is a representative Western blot of α-synuclein in HEK293 cells with ATG5 gene knockdown. blot and quantification, two-tailed unpaired t-test, ****p<0.0001; EF is a representative Western blot and quantification of HEK293 cells treated with autophagy activator rapamycin or R406 treated with EBSS, two-tailed unpaired t-test, **p<0.01, ****p<0.0001, for all panels, n indicates the number of independent seeding wells from different batches; data are mean ± SEM, and statistical parameters are shown in the figures; Figure 5The figure is the effect of R406 on autophagy in the present invention, wherein A is a representative Western blot and quantification of LC3B in HEK293 cells treated with R406, and the standardized LC3B-II / LC3B-I was used as an indicator of autophagy, one-way ANOVA and Dunnett's post hoc test, B is the level of SQSTM1 (P62) in HEK293 cells treated with R406 or DMSO by Western blot, one-way ANOVA and Dunnett's post hoc test, C is HEK293T cells stably expressing GFP-LC3B were treated with 2 μl vehicle (0.1% DMSO) and 300nM R406 for 24 hours; chloroquine (CQ, 20 μM) treatment was used as a control, and after 24 hours, the cells were fixed and images were acquired by confocal microscopy, for all groups, n represents the number of independent inoculation wells from different batches; data are mean ± SEM, and statistical parameters are shown in the figure; Figure 6 Graph showing the effect of R406 on the interaction between α-synuclein and LC3B in the present invention, wherein A is a schematic diagram of the BiFC experiment, BD is the BiFC experiment detection showing that R406 treatment significantly increased the interaction between α-synuclein-VN155 and LC3B-VC155, but there was no increase between the control groups VN155 and VC155 or VN155 and LC3B-VC155, two-tailed unpaired t-test, ****p<0.0001, EF is the binding-dissociation curve of the surface-immobilized compound R406 with LC3B (E) or α-synuclein (F) at the specified purified protein concentration, in the binding-dissociation curve, the vertical dotted line marks the beginning of the binding and dissociation phases of the binding event, the red dotted curve is globally fitted by the Langmuir reaction model, and each bottom of the figure is The fitting parameters are listed at the bottom. GH are the binding-dissociation curves of surface-immobilized protein LC3B with α-synuclein or α-synuclein and R406 at different purified protein concentrations. In the binding-dissociation curves, the vertical dashed lines mark the beginning of the binding and dissociation phases of the binding event. The red dashed curve is globally fitted by the Langmuir reaction model. The fitting parameters are listed at the bottom of each figure. I is a representative in vitro pull-down experiment (from 3 independent experiments) showing that R406 significantly enhances the LC3B-α-synuclein interaction. J is a representative co-immunoprecipitation experiment (from 3 independent experiments) showing that R406 significantly enhances the LC3B-α-synuclein interaction in HEK293 cells. For all groups, n represents the number of independent inoculation wells from different batches. Data are mean ± SEM, and statistical parameters are shown in the figures. Figure 7Figure 1 is a protein purification diagram for in vitro pull-down experiments in the present invention, wherein A is the SDS-PAGE of the expression and purification of the recombinant MBP-LC3B protein used in the in vitro pull-down experiment, and B is a representative electron microscope image of PFFs; Figure 8 The figure is the effect of R406 on pS129-α-synuclein and PFFs-induced PD cell model in the present invention, wherein A is a representative DAPI staining and immunostaining of pS129-α-synuclein and Tau, showing that pS129-α-synuclein induced by PFFs can be reduced by R406, one-way ANOVA and Dunnett's post hoc test; **P<0.01, B is a representative image of primary neurons induced by PFFs treated with R406 or DMSO, two-way ANOVA and Dunnett's post hoc test; ****P<0.0001, for all groups, n represents the number of independent inoculation wells from different batches; data are mean ± SEM, and statistical parameters are shown in the figure; Fig. 9 The figure shows the effect of the structural analogs of R406 on α-synuclein, where AB is a representative Western blot and quantification of α-synuclein levels in primary cultured neurons treated with R406-AN1 and R406-AN2, two-tailed unpaired t-test; **P<0.01, ***P<0.001, CD is a representative Western blot and quantification of α-synuclein levels in HEK293 cells treated with R406-AN1 and R406-AN2, one-way ANOVA and Dunnett's post hoc test, *P<0.05, EF is the two-dimensional compound structure of R406-AN1 and R406-AN2, for all groups, n represents the number of independent inoculation wells from different batches; data are mean ± SEM, and statistical parameters are shown in the figure; Fig.10Figure 3 is the effect of R406 on α-synuclein and PD-related phenotypes in the midbrain organoid model from PD patients, where A shows hiPSCs induced to differentiate into midbrain organoids, B shows immunostaining of midbrain organoid sections in the WT group and PD group using SOX2, DCH, FOXA2 and Nestin antibodies, C shows representative images of midbrain organoids showing that R406 reduced α-synuclein levels, two-tailed unpaired t-test; *P<0.05, D shows representative images of midbrain organoids showing that R406 reduced ROS levels, two-tailed unpaired t-test; **P<0.01, E shows representative TH staining images of midbrain organoids showing that R406 rescued the loss of dopamine neurons, two-tailed unpaired t-test; **P<0.01, for all groups, n represents the number of independent inoculation wells from different batches; data are mean ± SEM, and statistical parameters are shown in the figure. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] Example 1 Screening of compounds that can reduce α-synuclein levels 1. Experimental Materials All compounds used in this example were commercially available and quality controlled by the supplier using LS-MASS and NMR. Compounds include R406 (Selleck, catalog number S1533), Fostamatinib (R788) (Selleck, catalog number S2625), Fostamatinib (R788) disodium (Selleck, catalog number S2206), Dofetilide (Selleck, catalog number S1658), Resminostat (Selleck, catalog number S2693), Erythromycin (Selleck, catalog number S1635), UPF 1069 (Selleck, catalog number S8038), Travogen (Selleck, catalog number S2534), Piceatannol (Selleck, catalog number S3026), OSU-03012 (Selleck, catalog number S1106), Pimobendan (Selleck, catalog number S1550), KU-60019 (Selleck, catalog number S1570), Chloroquine (CellSignaling Technology, catalog number 14774), Bafilomycin A1 (Baf-A1) (Selleck, catalog number S1413) and Rapamycin (Selleck, catalog number S1039). These compounds were first dissolved in DMSO (Sigma, catalog number D8418) to make 10-50 mmol / L stock solutions and then diluted to 1000-fold working concentrations. Drugs were added to cell cultures to give a final DMSO concentration of 0.1% in the culture medium. For human midbrain organoids, R406 treatment was performed on day 24 of induction. After two weeks of treatment, samples were collected for immunofluorescence analysis.

[0025] Commercially available antibodies included anti-TH (Pel-Freez, catalog number P40101), anti-OTX2 (R&D Systems, catalog number AF1979), anti-FOXA2 (SantaCruz, catalog number sc-374376), anti-NESTIN (SantaCruz, catalog number sc-21247), anti-CORIN (R&D Systems, catalog number MABA2209), anti-TH (Pel-Freez, catalog number P40101), and anti-α-synuclein (abcam, catalog number ab138501). Fluorescent secondary antibodies included donkey anti-mouse IgG (H+L) high cross (Thermo Fisher Scientific, catalog number A-21202), goat anti-rabbit IgG (H+L) high cross (Thermo Fisher Scientific, catalog number A11037), and anti-mouse (Thermo Fisher Scientific, catalog number A21202), anti-rat (Thermo Fisher Scientific, catalog number A48270), anti-rabbit (Thermo Fisher Scientific, catalog number A10040), and anti-goat (Thermo Fisher Scientific, catalog number AOPO1105).

[0026] 2. Experimental Methods 2.1 Printing of compounds on microarrays The inventors performed a high-throughput screen to identify SMMs that bind to both LC3B and α-synuclein. The microarray contained 3375 compounds, including 1053 natural compounds from traditional Chinese medicine, 1527 Food and Drug Administration (FDA)-approved drugs, and 795 known inhibitors. Each compound was printed twice in a vertical direction on a homemade phenylisocyanate-functionalized glass substrate using a contact microarray printer (SmartArrayer 136, CapitalBio Corporation, Beijing, China). The compounds were dissolved in DMSO at a concentration of 10 mM. Biotin-bovine serum albumin (Biotin-BSA) at a concentration of 7.6 μM in 1× PBS and biotin-(PEG)2-NH2 at a concentration of 5 mM in DMSO were also printed as inner and outer borders of the SMMs as position markers and positive controls. After printing, the microarrays were dried at 45 °C for 24 h to promote the covalent binding of the nucleophilic groups of the small molecules to the isocyanate groups on the functionalized substrate. Finally, the microarrays were stored in a freezer at -20 °C.

[0027] 2.2 SMM screening of potential molecular glues To facilitate high-throughput screening of target proteins, a liquid cartridge was used to load the SMMs. The SMMs were then washed in situ using a flowing stream of 1× PBS to remove any excess unbound small molecules. After the washing step, the SMMs were scanned using a label-free OI-RD scanning microscope, allowing visualization of the small molecules immobilized on the glass substrate. Prior to screening, the SMMs were blocked with 7.6 μM BSA in 1× PBS for 30 min. The SMMs were then incubated with 680 nM LC3B, followed by 690 nM α-synuclein monomers, each incubation lasting 2 h. Another SMM was incubated with a control protein, MBP, at a concentration of 500 nM for 2 h. OI-RD images were captured before and after each protein incubation process. The obtained OI-RD difference images (images after incubation minus images before incubation) were then analyzed. The vertical double bright spots on the difference image indicate compounds that bind to the target protein.

[0028] 2.3 OI-RD measurement of compound-protein binary binding kinetics To measure the binding kinetics between compound R406 and the target protein, an SMM microarray of six identical sub-microarrays was prepared by printing compound R406 (10 mM in DMSO) on an isocyanate-functionalized glass substrate. The glass substrate was then assembled into a liquid cartridge with a separate liquid chamber for each sub-microarray. Before the binding reaction, the substrate was cleaned in situ with HEPES to remove any excess unbound sample. The substrate was then blocked with 7.6 μM BSA in HEPES for 10 min. To measure the binding kinetics, HEPES was flowed through the microarray for 10 min. Afterwards, HEPES was replaced with the probe solution for 30 min to initiate the binding phase of the reaction. Subsequently, the target solution was replaced with HEPES again to allow the dissociation of the probe for 30 min. The LC3B concentrations used were 1 μM, 2 μM, and 4 μM, and the control protein MBP was at 4 μM. The concentrations of α-synuclein were 0.2 μM, 0.4 μM, and 0.8 μM, and the control protein MBP was 0.8 μM. Binding curves of the compounds to the target protein were obtained on separate fresh sub-microarrays and recorded by OI-RD microscopy. The reaction kinetic rate constants were extracted by globally fitting the binding curves using a one-to-one Langmuir reaction model.

[0029] 2.4 Ternary binding kinetics measured by OI-RD The binding kinetics of LC3 to α-synuclein in the presence or absence of compound R406 were investigated using protein microarrays. The microarrays contained MBP-LC3 and BSA, printed at concentrations of 9.2 μM and 7.6 μM, respectively. Each glass substrate contained six identical protein sub-microarrays, and each protein was printed 18 times in a single sub-microarray. The printed protein microarrays were assembled into a liquid cartridge, and the substrates were washed in situ with HEPES to remove excess unbound sample. They were then blocked with 7.6 μM BSA in HEPES for 10 min. For binary binding kinetic measurements, three concentrations of sumo-α-synuclein (1 μM, 2 μM, and 4 μM) and a control protein sumo at a concentration of 4 μM were flowed over four separate fresh sub-microarrays. In the ternary binding experiment, three concentrations of sumo-α-synuclein (1 μM, 2 μM, and 4 μM) and a control protein sumo at a concentration of 4 μM were pre-incubated with 40 μM R406 for 2 h and then flowed over four separate fresh protein microarrays. Both binary and ternary binding kinetics were recorded using scanning OI-RD microscopy. Reaction kinetic rate constants were extracted by global fitting of the binding curves using a one-to-one Langmuir reaction model.

[0030] 2.5 Recombinant protein expression and purification The coding sequences for LC3B and α-synuclein were commercially synthesized and codon-optimized for E. coli. The sequences were cloned into the pMal-c2x-derived vector HMHT and the pGEX-6P1-derived vector pGHT (Cat. No. 28954648; Cytiva, Uppsala, Sweden). HMHT contains a His8 tag, an MBP tag, and a TEV protease cleavage site. pGHT contains a His8 tag, a GST tag, and a TEV protease cleavage site. After sequence verification, the plasmids (MBP-LC3B, MBP-α-synuclein, GHT-LC3B, GHT-α-synuclein) were transformed into E. coli BL21 (DE3) pLysS for expression. When the OD600 of the bacteria reached 0.8, isopropylthio-β-galactoside (IPTG) was added to induce expression. Expression was carried out at 200 rpm / min and 18°C ​​for 18 h. The cells were collected by centrifugation and resuspended in NiA buffer (150 mmol / L NaCl, 5% glycerol, 20 mmol / L imidazole nitrite and 150 mmol / L Tris buffer, pH 7.5). The cells were disrupted using high pressure and the protein was collected by centrifugation. After centrifugation, the supernatant was gently mixed with Ni-NTA resin (Cytiva, Marlborough, MA, USA). The resin was washed with NiC buffer (1 mol / L NaCl, 5% glycerol, 20 mmol / L imidazole nitrite and 150 mmol / L Tris buffer, pH 7.5) and eluted with NiB buffer (1 mol / L NaCl, 5% glycerol, 20 mmol / L imidazole nitrite and 150 mmol / L Tris buffer, pH 7.5). The collected samples were further purified by size exclusion chromatography using a Superdex 200 Increase 10 / 300GL column (Cytiva, Marlborough, MA, USA). To obtain tag-free proteins, NiB-eluted proteins were cleaved with TEV protease and reloaded onto Ni-NTA resin. The tag-free proteins were eluted with NiA buffer and further purified by size exclusion chromatography.

[0031] 2.6 Bimolecular fluorescence complementation (BiFC) The Venus protein is split into two fragments, the N-terminus (VN155) and the C-terminus (VC155). When the two fluorescent fragments are close to each other, they have the ability to self-assemble, thereby emitting a yellow fluorescent signal. Alpha-synuclein fused with VN155 (α-synuclein-VN155) and LC3B fused with VC155 (LC3B-VC155) were synthesized and connected using an endoplasmic reticulum entry site (IRES). The sequences were cloned into a eukaryotic expression vector and overexpressed in HEK293T cells for 24 hours, followed by treatment with 10 μM R406 and the autophagy inhibitor Bafilomycin A1 (BafA1, 50 nM) for 24 hours.

[0032] 2.7 Cell culture and transfection HEK293 cells were originally obtained from the American Type Culture Collection (ATCC, Manassas, VA) and stably expressed α-synuclein in a 37°C, 5% CO2 humidified incubator. The cell culture medium consisted of DMEM supplemented with 10% (vol / vol) fetal bovine serum (Thermo Scientific, catalog number 10082-147) and 1% penicillin-streptomycin (Thermo Scientific, catalog number 15140122). Plasmids or siRNA were transfected into cells using Lipofectamine 3000 reagent (Thermo Scientific, catalog number L3000015) according to the manufacturer's instructions.

[0033] 2.8 Differentiation of human midbrain organoids Human mesencephalic organoids (hMOs) were formed using pluripotent stem cell (hPSC) lines that were passaged no more than 60 times. First, hPSCs were dissociated into smaller fragments from intact clones using EDTA (STEMCELL, catalog number 07174) and then cultured in minimal 8 medium (Gibco, catalog number A15169-01) for one day. Subsequently, the medium was changed to DMEM / F12 (Gibco, catalog no. C11330500BT), 1× N2 supplement, 1× B27 without vitamin A, 1% minimal essential medium-non-essential amino acids (NEAA) (Gibco, catalog no. 11140), and supplemented with SB431542 (10 μM, Tocris, catalog no. 1614), DMH1 (10 mM, Tocris, catalog no. 4126), SHH (C25II, 500 ng / ml, R&D Systems, catalog no. 464-SH), and CHIR99021 (Tocoos, catalog no. 4423). On day 9, epithelial colonies were formed and floated. At this time, the supplemental factors were changed to SAG (2 µM, Calbiochem, catalog number 566660), SHH (C25II, 100 ng / ml), CHIR99021 (0.4 µM), and 100 ng / ml FGF8b (PeproTech, catalog number 100-25). After 4 days of culture in the above medium, SHH and CHIR99021 were removed. The cells were cultured for an additional 6 days. On day 19, SAG was replaced with SHH, and hMOs were cultured for an additional 15 days. Plates contained final differentiation medium consisting of DMEM / F12, N2, B27, NEAA, brain-derived neurotrophic factor (10 ng / ml, PeproTech, catalog number 450-02-100), glial cell-derived neurotrophic factor (10 ng / ml, PeproTech, catalog number 450-10), ascorbic acid (200 µM, Sigma, catalog number A8960), cAMP (1 µM, Sigma, catalog number D0260), transforming growth factor β3 (1 ng / ml, R&D Systems, catalog number 243-B3), and compound E (1 µM, Calbiochem, catalog number 530509).

[0034] 2.9 Primary neuron culture Primary neurons were isolated from newborn rats and mice within 24 hours of birth. Cerebral cortex and hippocampal tissues were dissected from the animals. Tissues were then digested using trypsin (Sigma, catalog number T1005). Enzymatic digestion was terminated by adding DMEM medium (Thermo Scientific, catalog number 11965) supplemented with fetal bovine serum. Cells were then filtered through a cell strainer and plated onto poly-lysine hydrobromide (Sigma, catalog number P2636) coated culture plates. After three hours, the medium was replaced with fresh neuronal medium A containing 2% B27 supplement (Thermo Scientific, catalog number 17504044), 1% penicillin-streptomycin, and 1% glutamine solution (Thermo Scientific, catalog number 35050061). Neuronal medium was changed every other day and a half.

[0035] 2.10 Preparation of α-synuclein preformed fibrils (PFFs) Purified α-synuclein was transferred by dialysis to PBS buffer (137 mmol / L NaCl, 2.7 mmol / L KCl, 10 mmol / L Na2HPO4 and 1.8 mmol / L KH2PO4, pH 7.4). The protein was then concentrated using a 10 kDa ultracentrifugal filter (Millipore, catalog number UFC9010) to reach a final concentration of 5 mg / ml. The sample was then placed on an orbital shaker at 37°C and shaken at 1000 rpm for seven days to generate preformed fibrils (PFFs).

[0036] 2.11 Electron Microscope The α-synuclein PFFs sample was added to the copper grid coated with carbon film. The sample stayed on the copper grid for 3-5 minutes. The excess liquid was absorbed by filter paper. The copper grid was then stained using 2% phosphotungstic acid solution for 2 minutes. Finally, the sample was dried at room temperature and photographed using a Thermo Scientific™ Talos L120C transmission electron microscope.

[0037] 2.12 Quantitative real-time PCR Cells and primary neurons were lysed on ice for 45 min. Total cellular RNA was extracted using the Rapure Total RNA Micro Kit (Magen, catalog number R4012-03) following standard operating procedures. The concentration of RNA in different samples was measured using a NanoDrop spectrophotometer (Thermo Scientific, NanoDrop One / OneC). According to the measured RNA concentration, the RNA samples were diluted to the same concentration in different samples. The normalized RNA samples were reverse transcribed into cDNA using the FastKing RT Kit (Tiangen Biotech, catalog number KR116) following the manufacturer's instructions. SYBR® qPCR Mix (Toyobo, catalog number QPX-201) was mixed with gene-specific primers and cDNA template. The qPCR reaction was performed on a qPCR system (Agilent Technologies, Mx3000P) with the following program: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s. Data were collected using AriaMx software. The primers used were as follows: syk forward primer: CGTATGAGCCAGAACTTGCACC, reverse primer: CTTTCGGTCCAGGTAAACCTCC; αsyn forward primer: GCCAAGGAGGGAGTTGTGGCTGC, reverse primer: CTGTTGCCACACCATGCACCACTCC; hprt forward primer: CCTGGCGTCGTGATTAGTG, reverse primer: TGATTAATAAACACCCTTTCCA.

[0038] 2.13 In vitro pull-down assay 120 μg of purified MBP-LC3B protein and 120 μg of MBP protein were each incubated with 60 μL of BeyoMag™ Anti-MBP Magnetic Beads (Beyotime, catalog number P2123). The binding reaction was performed at 4°C for 1 hour to ensure that the protein was bound to the beads. The beads were washed with PBST (137 mmol / L NaCL, 2.7 mmol / L KCl, 10 mmol / L Na2HPO4, 1.8mmol / L KH2PO4 and 0.1% Tween20, pH 7.4) and evenly distributed into 6 separate 1.5ml microcentrifuge tubes. The corresponding small molecule stock solution was added to each tube to achieve final concentrations of 0 nM, 50 nM, 500 nM, 5 μM and 50 μM. After incubating the protein and small molecule at room temperature for 1 hour, 20 μg of purified α-synuclein was then added to the sample. The sample was then placed at 4°C with rotation overnight to mix thoroughly. The next day, the complexes were removed and washed with PBST buffer. They were then mixed with 1× loading buffer and vortexed. After that, the mixture was heated at 95°C for 10 minutes to fully dissolve the proteins that had bound to the magnetic beads. Then, the mixture was centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was collected and used for Western blot analysis.

[0039] 2.14 Cell imaging with IncuCyte After 7 days of primary neuron culture, PFFs and drug treatments were added and the samples were placed in an incubator for interval imaging using IncuCyte technology (Essen Bioscience, IncuCyte ZOOM). Each well was divided into 16 fields of view and imaged every 6 hours under phase contrast settings. Changes in axon length for each well were analyzed using Neurotrack software, which is able to identify neuronal cell bodies and axons, allowing for the assessment of axonal damage based on the ratio of axon length to cell body size. Changes in this ratio over time were plotted to compare treatment and control groups to determine if the drug was neuroprotective.

[0040] 2.15 Immunofluorescence and imaging Primary neurons were cultured on round coverslips coated with poly-lysine (Biosharp, catalog number BS-20-RC). Immunocytochemical staining was performed after primary neurons were treated with PFFs and drugs for 8 days. Samples were fixed with 4% formaldehyde (Biotend, catalog number RE202001) for 15 minutes, and then blocked and permeabilized with 2% bovine serum albumin (BSA, Sigma, catalog number V900933) and 1% Triton X-100 for 30 minutes. The liquid on the surface of the coverslip was removed, and primary antibodies against phosphorylated α-synuclein (Ser129) (Abcam, catalog number ab51253) and anti-Tau (Cell Signaling Technology, catalog number 4019T) were added. Samples were incubated overnight at 4°C. The next day, the coverslips were removed and washed three times with PBS. A mixed secondary antibody solution of Alexa Fluor 488 (Abcam, catalog number Ab150073) and Alexa Fluor 594 (Abcam, catalog number Ab150080) was applied and incubated in the dark for 1 hour. After staining with DAPI (Beyotime, catalog number C1005) for 15 minutes, the samples were mounted and imaged. Fluorescence imaging of coverslips was performed using Zeiss LSM 880 and high-throughput screening (PerkinElmer, Operetta CLS). Based on the imaging results, the levels of pS129-α-synuclein in different samples were quantified and analyzed using ImageJ.

[0041] To determine whether the small molecule R406 affects the level of autophagy, plasmid GFP-LC3B was transfected into HEK293T cells. After 24 hours of plasmid expression, small molecule R406 (300nM) and DMSO were added, and as a positive control for protein degradation blockade in autophagy, 20 μM CQ (which causes LC3B-II aggregation) was added and cultured for 24 hours. The cells were washed with cold PBS and 4% formaldehyde for 20 minutes, then stained with DAPI and photographed with a confocal laser microscope. For organoids, hMOs were washed three times with 1× PBS and then fixed in 4% formaldehyde (PFA) (Beyotime Biotechnology, P0099) for four hours. After washing with PBS to remove PFA, the samples were treated with 30% (weight / volume) sucrose solution overnight at 4°C for dehydration. Subsequently, the tissues were stored in optimal cutting temperature (OCT) compound (Sakura, catalog number 4583), and each section was cut to 12 µm thick for immunostaining. Standard procedures were performed for immunostaining of tissue cryosections. Cryosections were washed three times with 1× PBS. Then, cryosections were blocked with a 1× PBS solution containing 5% donkey serum and 1% Triton X-100 for one hour. After that, primary antibodies were incubated overnight at 4°C. The next day, cryosections were washed three times with 1× PBS, then incubated with secondary antibodies for 1 hour at room temperature and stained with Hochest (life, catalog number H1339) for 10 minutes.

[0042] 2.16 Immunoprecipitation HEK293T cells were cultured in 10 cm dishes, transfected with α-synuclein and LC3B-HA plasmids, and then R406 and 50 nM BafA1 (to block protein degradation in autophagy) were added. After 24 h, cells were washed three times with cold 1× PBS. 1% TritonX-100 was added to the cells and lysed at 4°C for 45 min. Soluble fractions were obtained by centrifugation at 12,000 rpm for 15 min at 4°C. 50 μL of antimagnetic beads were added to the centrifugation supernatant and incubated overnight at 4°C with constant rotation. Immunoprecipitation was performed three times with a wash buffer containing 50 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 0.5% Tween-20 (pH 7.2). Immunoprecipitated proteins were eluted with 50 μL 1× SDS loading buffer at 95°C for 5 min. SDS-PAGE was performed.

[0043] 2.17 Statistics To ensure that the statistical power was greater than 0.8, power analysis of each test was performed before the experiment using the estimated value of PASS 16 (https: / / www.ncss.com / software / pass / ). Statistical comparisons between two groups were performed using unpaired two-tailed t-tests. For comparisons between multiple groups, one-way ANOVA was used, followed by post hoc tests for specific comparisons: Dunnett's test when compared with a single control group and Bonferroni's test when compared between different groups. For data collected at different time points, two-way ANOVA was used for statistical comparisons. GraphPad Prism 7 and Microsoft Excel 2021 were used to perform data analysis.

[0044] 3. Experimental Results 3.1 Identification of potential α-synuclein-LC3B binding compounds The inventors performed a high-throughput small molecule screening, using nucleophile-isocyanate reactions to copy 3,375 compounds onto an isocyanate-functionalized glass substrate. This library includes 1,527 FDA-approved drugs, 795 known target inhibitors, and 1,053 natural products, which form covalent bonds with the glass substrate, purify LC3B protein, α-synuclein, and MBP protein, and then flow them through the chip in sequence. When proteins bind to small molecules on the chip, their binding signals can be detected using a specialized microscope (such as Figure 1 Through screening, 10 hit compounds were identified that can bind to α-synuclein and LC3B simultaneously but not to MBP (as shown in Figure 2A). Figure 1 The effects of the above compounds on α-synuclein were tested in HEK293 cells, and it was found that one of the compounds, R406, was able to reduce the level of α-synuclein (as shown in Figure 2B). Figure 2 The two-dimensional structure of R406 is shown in Figure 2 Middle F.

[0045] 3.2 R406 reduces α-synuclein levels at the cellular level via a SYK-independent posttranscriptional mechanism To evaluate the effect of R406 on α-synuclein levels, we first tested the effect of R406 in HEK293 cells. The data showed that R406 significantly reduced α-synuclein levels (e.g. Figure 3Similar results were obtained in primary cultures of rat cortical neurons, where R406 also significantly reduced α-synuclein levels. These results suggest that R406 can reduce α-synuclein levels in different cell models (e.g. Figure 3 (shown in B).

[0046] To demonstrate the mechanism by which R406 affects α-synuclein, the expression of the SNCA gene, which encodes α-synuclein, was evaluated. SNCA mRNA levels were tested under treatment with different concentrations of R406. q-PCR results showed that R406 did not affect SNCA mRNA transcript levels (e.g. Figure 3 The inventors also evaluated different concentrations of R406 and found that it had no toxic effect on neurons (as shown in Figure 3 Given that R406 is known to inhibit spleen tyrosine kinase (SYK), a non-receptor protein tyrosine kinase expressed in a variety of cells including T cells, B cells, epithelial cells, fibroblasts, endothelial cells, platelets, etc., the role of SYK was further investigated by knocking down the syk gene using small interfering RNA (siRNA) to reduce SYK protein expression, mimicking the inhibitory effect of R406. The findings showed that the reduction in SYK protein levels did not alter α-synuclein levels (e.g. Figure 3 In addition, treatment with the SYK inhibitor p505-15 did not reduce α-synuclein protein levels (as shown in Figure 5E). Figure 3 Thus, these data suggest that the effect of R406 in reducing α-synuclein levels is independent of SYK kinase inhibition.

[0047] 3.3 R406 degradation of α-synuclein depends on autophagy The inventors blocked autophagy by using the autophagy inhibitor CQ and found that CQ inhibited the degradation of α-synuclein by R406 treatment in primary cultured neurons and HEK293 cells (e.g. Figure 4 AB in the middle). This suggests that the mechanism may work through the autophagy pathway. To further elucidate the role of autophagy, we knocked down the ATG5 gene, which is a key upstream regulator of autophagosome formation, and observed that knocking down the ATG5 gene significantly reduced the formation of LC3B-II protein and inhibited the effect of R406 on reducing α-synuclein levels (as shown in Figure 2A). Figure 4 In addition, cells were treated with serum-free EBSS or rapamycin, both of which promote the formation of autophagosomes. It was found that under conditions of increased autophagy, the degradation of α-synuclein by R406 was further enhanced (as shown in Figure 2A). Figure 4 The above data suggest that R406 may degrade α-synuclein through the autophagy pathway.

[0048] 3.4 R406 has no effect on the function of autophagy itself R406 does not affect autophagy by degrading α-synuclein. The inventors incubated cells with different concentrations of R406 and observed no change in LC3-II protein levels (e.g. Figure 5 In addition, the inventors evaluated the key autophagy substrate protein SQSTM1 (also known as P62) and found that its level remained unchanged (as shown in Figure 5 In addition, the inventors transiently transfected GFP-LC3B plasmid into HEK293T cells and found that the LC3B spots reflecting the number of autophagosomes did not change significantly (as shown in Figure 2A). Figure 5 Based on these findings, it was concluded that R406 does not alter autophagy.

[0049] 3.5 R406 increases the binding between α-synuclein and LC3B protein To further clarify the mechanism by which R406 reduces α-synuclein, the inventors conducted a bimolecular fluorescence complementation (BiFC) experiment. First, the α-synuclein-VN155-IRES-LC3B-VC155 plasmid was constructed. When the two proteins are combined, they emit a yellow fluorescent signal (such as Figure 6 After the plasmids were transfected into cells, it was observed that R406 significantly increased the fluorescence signals of α-synuclein-VN155 and LC3B-VC155 (as shown in Figure 2A). Figure 6 BC), but there was no increase in the signal between VN155 and VC155 or between VN155 and LC3B-VC155 after R406 treatment (as shown in Figure 6 In addition, using OI-RD assay, it was found that R406 could independently bind to α-synuclein and LC3B protein (as shown in Figure 2D). Figure 6 EF), we also examined the basal binding levels of α-synuclein and LC3B and noted a significant increase in the binding between the two proteins after R406 treatment, with a ~4-fold decrease in the dissociation constant (Kd) (Fig. Figure 6 In addition, maltose binding protein (MBP) pull-down experiments were performed using purified MBP-LC3 and α-synuclein (as shown in Figure 2 BC and Figure 7 The results showed that R406 significantly enhanced the binding between α-synuclein and LC3B in a concentration-dependent manner (as shown in Figure 2A). Figure 6 It was further verified that R406 increased the binding between α-synuclein and LC3B protein in cells (as shown in Figure 6These findings suggest that R406 enhances the binding between α-synuclein and LC3B, thereby increasing the likelihood that α-synuclein will be degraded via the autophagic pathway.

[0050] 3.6 R406 reduced pS129-α-synuclein levels and significantly alleviated the disease phenotype in the PFFs-induced PD cell model To further explore the effect of R406 on PD cells, a PD cell model was constructed using PFFs (e.g. Figure 7 Immunofluorescence experiments showed that PFFs treatment induced the production of more toxic pS129-α-synuclein, while R406 treatment significantly reduced the level of this protein (as shown in Figure 2B). Figure 8 The morphology of neurons was also analyzed, and it was found that R406 significantly rescued neuronal degeneration (as shown in Figure 2A). Figure 8 These data suggest that R406 alleviates the PD cell phenotype by promoting the degradation of pS129-α-synuclein.

[0051] 3.7 Structural analogs of R406 also reduce α-synuclein levels Based on the molecular structure of R406, two structural analogs, R406-AN1 and R406-AN2, were identified and found to be able to reduce α-synuclein levels in HEK293 cells and primary cultured neurons (e.g. Fig. 9 The two-dimensional structures of R406-AN1 and R406-AN2 are shown in Fig. 9 Medium EF medium.

[0052] 3.8 R406 reduces α-synuclein levels and alleviates PD-associated phenotypes in PD patient-derived midbrain organoid models To evaluate the potential effects of R406 on phenotypes associated with PD, a midbrain organoid model containing dopaminergic neurons derived from induced pluripotent stem cells (iPSCs) from PD patients was constructed (Fig. Fig.10 After incubation with R406, it was observed that the compound significantly reduced α-synuclein levels, as evidenced by immunofluorescence results (see Figure 4A). Fig.10 Previous studies have shown that reactive oxidative stress (ROS) is generated in neurons of PD patients, and ROS levels in organoid models have also been measured. The results showed that ROS levels in iPSC-derived organoids treated with R406 were significantly reduced compared with DMSO treatment, indicating that the compound has a protective effect on neurons (e.g. Fig.10 In addition, a significant reduction in the loss of dopamine neurons was observed after incubation with R406 (Fig. Fig.10 These findings suggest that the small molecule compound R406 can effectively alleviate PD-related phenotypes in organoid models.

[0053] In summary, the small molecule compound R406 was identified from a library of 3,375 candidate drugs through unbiased screening based on small molecules-microarrays. This compound R406 can bind to α-synuclein and the autophagic protein LC3B simultaneously, which may enhance the connection of α-synuclein to autophagosomes, thereby promoting its autophagic degradation. The above data show that R406 effectively reduces the levels of α-synuclein and α-synuclein phosphorylated at serine 129 at nanomolar concentrations in HEK293 cells, primary cultured neurons, and PD patient-derived iPSC-induced organoid models. Mechanistically, it was demonstrated that R406 enhances the interaction between LC3B and α-synuclein, and its degradation depends on autophagy. Finally, it was found that R406 can alleviate the disease phenotype of PD cells in PFFs-induced PD cells and organoid models.

[0054] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of a small molecule compound R406 in the preparation of drugs for preventing and treating Parkinson's disease.

2. The use according to claim 1, characterized in that The small molecule compound R406 can reduce the level of α-synuclein in an autophagy-dependent manner, thereby slowing down the progression of Parkinson's disease.

3. The use according to claim 1, characterized in that The small molecule compound R406 can also reduce the level of α-syn phosphorylated serine 129 in a cell model induced by α-synuclein preformed fibers and prevent neuronal degeneration.

4. The use according to claim 1, characterized in that The small molecule compound R406 can also enhance the binding between α-synuclein and LC3B protein.

5. The use according to claim 1, characterized in that The dosage forms of the drug include tablets, capsules, oral preparations and injections.

6. A drug for preventing and treating Parkinson's disease, characterized in that: The small molecule compound R406 is the only active ingredient in the drug.

7. The drug according to claim 6, characterized in that The medicament further includes a pharmaceutically acceptable carrier.

Images