Geranyl and geranyl diphosphate synthetase for high yield of beta-carotene and application

Abstract

The invention discloses geranyl and geranyl diphosphate synthetase for high yield of beta-carotene and application of the geranyl and geranyl diphosphate synthetase. Specifically, the invention discloses a method for producing beta-carotene, and the method comprises the following steps: overexpressing a CrtE gene, a CarRP gene and a CarB gene in a chassis strain; wherein the CrtE gene is a CrtE gene from Sulfolobus sp. And / or Sulfolobus sp. Acidophilus (Sulfolobus sp. Acidophilus), and the CrtE gene is a CrtE gene from Sulfolobus sp. Acidophilus (Sulfolobus sp. Acidophilus) and / or Sulfolobus sp. Acidophilus. According to the method, the lycopene substrate inhibition effect can be effectively relieved, and the yield of beta-carotene in a chassis strain is effectively increased.

Description

Technical Field

[0001] The invention relates to the field of biosynthesis, and in particular to a geranylgeranyl diphosphate synthase for high-yield beta-carotene and its application. Background Art

[0002] β-Carotene is a tetraterpenoid compound with biological activities such as antioxidant activity. It is widely used in food, medicine, cosmetics and other fields. Its heterologous synthesis chassis are mainly yeast and Escherichia coli, and yeast is recognized as a safer expression strain than Escherichia coli.

[0003] The heterologous expression genes of β-carotene include geranylgeranyl diphosphate synthase (CrtE), phytoene synthase / lycopene cyclase bifunctional enzyme (CarRP / CrtYB), and phytoene dehydrogenase (CarB / CrtI). Among them, geranylgeranyl diphosphate synthase CrtE is one of the key genes for heterologous synthesis of β-carotene. In addition, in the biosynthesis of β-carotene, lycopene cyclase has a substrate inhibition effect, and when the lycopene production increases, it will inhibit the synthesis of downstream product β-carotene.

[0004] At present, the relevant biosynthesis methods include the following. The first method is, for example, as shown in patent application CN202410102011.4, using Saccharomyces cerevisiae as the chassis strain, overexpressing CrtE, CrtI, CrtYB, tHMG1, IDI1 and ispA genes to obtain an engineered strain with high β-carotene production. In the second method, researchers found (for example, Ma Y et al., Nat Commun. 2022 Jan 31;13(1):572.) that by modifying and mutating lycopene cyclase and establishing a geranylgeranyl diphosphate synthase-mediated metabolic flux limiter, the inhibitory effect of lycopene substrate can be effectively relieved, thereby achieving the purpose of increasing β-carotene production. The third method is to install the synthetic gene in a plasmid vector for expression. This is the mainstream method for heterologous expression of β-carotene. For example, Wang Siyi et al. (Journal of Microbiology, 2023, 43(4):10-17) constructed a constitutive expression vector pY-ES2-Kan-CrtI-CrtYB-BTS1 and transformed it into Saccharomyces cerevisiae MKP-o to obtain a genetically engineered strain of Saccharomyces cerevisiae that produces β-carotene.

[0005] However, there are still some defects in the current synthesis methods that need to be solved. First, although the β-carotene synthesis gene can be quickly verified by assembling it into a plasmid vector for expression, it is necessary to use a defective culture medium or antibiotics to ensure that the plasmid is not lost, which not only affects the growth activity of the strain, but also is not conducive to downstream fermentation and purification research. Secondly, the direct precursor of yeast synthesis of β-carotene is geranylgeranyl diphosphate (GGPP), but the β-carotene content without over-expression of geranylgeranyl diphosphate synthase (CrtE) is extremely low, so CrtE is one of the key rate-limiting enzymes for heterologous expression of β-carotene. However, the enzyme activity of CrtE from different sources used in existing studies varies greatly, resulting in uneven downstream β-carotene synthesis yields. Therefore, it is crucial to select a suitable CrtE gene for heterologous expression. In addition, in the process of β-carotene biosynthesis, lycopene cyclase has a substrate inhibition effect, and when lycopene production increases, it will inhibit the synthesis of downstream product β-carotene. Although Ma Y et al. have proposed two improvement plans, namely enzyme mutation and suitable CrtE homologous enzyme, it is still necessary to further explore CrtE homologous enzymes with better activity to solve the substrate inhibition effect and further increase β-carotene production.

[0006] Therefore, there is an urgent need to develop a method for efficiently producing β-carotene in this field. Summary of the invention

[0007] The purpose of the present invention is to provide a method for efficiently producing β-carotene. Specifically, the present invention provides a geranylgeranyl diphosphate synthase with high β-carotene production and its application. The present invention aims to explore a geranylgeranyl diphosphate synthase (CrtE) that relieves the inhibitory effect of lycopene substrate and produces high β-carotene, and uses CRISPR-Cas9 gene editing technology to insert the CrtE, CarRP and CarB genes required for heterologous synthesis of β-carotene into the genome of Saccharomyces cerevisiae, thereby obtaining an engineered strain with stable expression and high β-carotene production.

[0008] In one aspect, the present invention provides a method for producing β-carotene, the method comprising: overexpressing CrtE gene, CarRP gene and CarB gene in a chassis strain.

[0009] In one embodiment, the CrtE gene is a CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius; more preferably, the CrtE gene is from Sulfolobus.

[0010] In one embodiment, the CrtE gene sequence from Sulfolobus is as shown in SEQ ID NO: 58, and / or the CrtE gene sequence from Sulfolobus acidocaldarius is as shown in SEQ ID NO: 55.

[0011] In one embodiment, the CrtE gene sequence has a sequence identity greater than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% compared to SEQ ID NO: 55 or 58.

[0012] In one embodiment, the CarRP gene and CarB gene are CarRP gene and CarB gene from Blakeslea trispora.

[0013] In one embodiment, the CarRP gene sequence is as shown in SEQ ID NO: 62, or has a sequence identity of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more to SEQ ID NO: 62.

[0014] In one embodiment, the CarB gene sequence is as shown in SEQ ID NO: 63, or has a sequence identity of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more to SEQ ID NO: 63.

[0015] In one embodiment, the overexpression is achieved by introducing heterologous CrtE gene, CarRP-Bt and CarB-Bt genes into the chassis strain through gene editing method.

[0016] In one embodiment, the gene editing method comprises performing gene editing using a system selected from the group consisting of a CRISPR-Cas9 system, ZFN (zinc finger nuclease), and TALEN (transcription activator-like effector nuclease).

[0017] In one embodiment, the chassis strain is a yeast strain or an E. coli strain.

[0018] In one embodiment, the chassis strain is a yeast strain; further preferably, the yeast strain is yeast strain 2369R, BY4741 or BY4742.

[0019] In one embodiment, the gene editing method is to perform gene editing using the CRISPR-Cas9 system.

[0020] In one embodiment, in the gene editing method, the CarRP gene is inserted between the RPO21 and SCM3 genes of chromosome IV of the yeast strain 2369R, the CarB gene is inserted between the IPI3 and PBR1 genes of chromosome XIV of the yeast strain 2369R, and / or the CrtE gene is designed to be inserted between the LSB6 and GSH1 genes of chromosome X of the yeast strain 2369R.

[0021] In one embodiment, in the gene editing method, the CRISPR-Cas9 system is used to recognize the genome sequence SEQ ID NO: 59 of the yeast strain 2369R to insert the CarRP gene, recognize the genome sequence SEQ ID NO: 60 of the yeast strain 2369R to insert the CarB gene, and / or recognize the genome sequence SEQID NO: 61 of the yeast strain 2369R to insert the CrtE gene.

[0022] In one aspect, the present invention provides a chassis strain for producing β-carotene, wherein the CrtE gene, the CarRP gene and the CarB gene are overexpressed in the chassis strain, and the β-carotene yield in the chassis strain is at least 5 times higher than the lycopene yield.

[0023] In one embodiment, the CrtE gene is a CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius; more preferably, the CrtE gene is from Sulfolobus.

[0024] In one embodiment, the CrtE gene sequence from Sulfolobus is as shown in SEQ ID NO: 58, and / or the CrtE gene sequence from Sulfolobus acidocaldarius is as shown in SEQ ID NO: 55.

[0025] In one embodiment, the CarRP gene and CarB gene are the CarRP gene and CarB gene from Blakeslea trispora.

[0026] In one embodiment, the β-carotene production in the chassis strain is at least 10 times, at least 15 times, at least 20 times, at least 25 times, or at least 30 times higher than the lycopene production.

[0027] In one embodiment, the chassis strain is a yeast strain or an E. coli strain.

[0028] In one embodiment, the chassis strain is a yeast strain; further preferably, the yeast strain is yeast strain 2369R, BY4741 or BY4742.

[0029] In one embodiment, the chassis strain is yeast strain 2369R, and wherein the CarRP gene is introduced between the RPO21 and SCM3 genes of chromosome IV, the CarB gene is introduced between the IPI3 and PBR1 genes of chromosome XIV, and / or the CrtE gene is introduced between the LSB6 and GSH1 genes of chromosome X.

[0030] In one aspect, the present invention provides a use of a CrtE gene for producing β-carotene, wherein the CrtE gene is a CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius.

[0031] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0032] The reagents and raw materials used in the present invention are commercially available.

[0033] In a specific embodiment, the present invention provides a CrtE gene that can produce high β-carotene and relieve the inhibitory effect of lycopene substrate, and then uses CRISPR / Cas9 gene editing technology to co-express the screened CrtE, CarRP-Bt and CarB-Bt genes to obtain a yeast engineered strain that produces high β-carotene.

[0034] The present invention provides a novel reference scheme for increasing the synthetic yield of β-carotene. The specific positive and progressive effects of the present invention are:

[0035] a. Effectively remove the inhibitory effect of lycopene substrate and break the limitation of β-carotene biosynthesis: Existing studies have shown that lycopene substrate inhibition exists in β-carotene biosynthesis, which is not conducive to the increase of β-carotene production. The CrtE enzyme provided by the present invention can remove the inhibitory effect of lycopene substrate, thereby promoting the efficient synthesis of β-carotene. This provides a new CrtE enzyme selection scheme for the study of heterologous expression of β-carotene or other carotenoids.

[0036] b. Providing an enzyme combination for high-yield β-carotene: The present invention uses a combination of the screened CrtE gene, CarRP-Bt, and CarB-Bt genes to obtain a higher yield of β-carotene, which not only provides a new gene combination for yeast to synthesize β-carotene, but also further promotes the industrialization process of β-carotene biosynthesis.

[0037] c. The genetic performance of the engineered strain obtained by the method of the present invention is stable, which is beneficial to the large-scale fermentation of β-carotene: The present invention adopts CRISPR-Cas9 gene editing technology to insert the β-carotene synthesis gene into the yeast genome, so that the genetic performance of the engineered strain is stable, and its activation culture does not require the addition of defective culture medium or antibiotics, which is beneficial to the industrial research of large-scale fermentation of β-carotene.

[0038] d. GOMC-CrtE-Su and GOMC-CrtE-Sa genes were used for heterologous expression of β-carotene for the first time: The present invention used bioinformatics tools to mine the GOMC-CrtE-Su gene and experimentally verified its advantages in heterologous expression of β-carotene for the first time. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Pathway diagram for the synthesis of β-carotene by Saccharomyces cerevisiae.

[0040] Figure 2 This is the evolutionary tree of CrtE genes from different sources.

[0041] Figure 3 The carotenoid contents of the engineered strains are shown. DETAILED DESCRIPTION

[0042] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0043] Experimental methods

[0044] The synthesis pathway of β-carotene in the Saccharomyces cerevisiae chassis is as follows Figure 1 As shown in the figure, the synthesis pathway uses geranylgeranyl diphosphate (GGPP) in the mevalonate (MVA) pathway of Saccharomyces cerevisiae as the direct precursor, and produces phytoene through the bifunctional enzyme phytoene synthase / lycopene cyclase (CarRP / CrtYB), then produces lycopene through phytoene dehydrogenase (CarB / CrtI), and finally produces β-carotene by the bifunctional enzyme CarRP / CrtYB.

[0045] The present invention screens and mines geranylgeranyl diphosphate synthase that can produce high β-carotene and has no lycopene substrate effect from the Global Ocean Microbiome Catalogue (GOMC, IDMDB0000002) database, and simultaneously selects the CarRP gene (CarRP-Bt) and CarB gene (CarB-Bt) both derived from Blakeslea trispora for co-expression, thereby obtaining an engineered strain that can produce high β-carotene and has no lycopene substrate inhibition effect.

[0046] The specific experiment is implemented through the following steps:

[0047] Step 1: Mining the GOMC database for CrtE homologous enzymes with potential high β-carotene production

[0048] The present invention screens homologous sequences based on the amino acid sequences of CrtE-Af, CrtE-Sa, and CrtE-Pa enzymes from known Archaeoglobus fulgidus, Sulfolobus acidocaldarius, and Pantoea ananatis, sets thresholds of similarity >35% and coverage >80% for structural alignment, and finally screens out 119 CrtE homologous enzyme sequences in the GOMC database.

[0049] Step 2: Construction of the initial chassis strain expressing β-carotene

[0050] The amino acid sequences of the CarRP gene (CarRP-Bt, ID: AAO46893.1) and CarB gene (CarB-Bt, ID: AAX20903.1) of Blakeslea trispora were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov), and codon optimization was performed using the GenScript development tool website (https: / / www.genscript.com.cn / tools / gensmart-codon-optimization) to obtain gene expression sequences.

[0051] CarRP gene (SEQ ID NO: 62)

[0052]

[0053] CarB gene (SEQ ID NO: 63)

[0054]

[0055] The CarRP-Bt and CarB-Bt genes were inserted into the genome of the artificial chromosome yeast strain 2369R using CRISPR / Cas9 gene editing technology, thereby constructing the initial chassis cells for heterologous expression of β-carotene. Among them, the present invention uses lithium chloride acetate (LiAc)-mediated chemical transformation method to perform yeast gene editing, and the relevant experimental process is as follows:

[0056] 1. Take the frozen bacterial solution, streak it on a YPD plate, and invert and culture for 3 days;

[0057] 2. Take a single colony and add it to 3mL YPD liquid culture medium, shake at 30°C, 220rpm overnight;

[0058] 3. Inoculate the bacteria into 50 mL of YPD medium at an initial OD600 of 0.2;

[0059] Cultivate at 430°C, 220 rpm for about 4.5 h until OD = 0.8~1.

[0060] 5. Centrifuge the bacterial solution at 4500rpm for 5min and remove the supernatant;

[0061] 6. Add 20 mL 1xTE solution to resuspend and centrifuge at 4500 rpm for 5 min;

[0062] 7. Add 2 mL of solution 1 (1.7 mL ddH2O, 200 uL 10× lithium acetate, 100 uL 1×TE) and incubate at 30°C for 10 min to obtain competent cells;

[0063] 8. Take 100 μL competent cells and 20 μL ssDNA, mix them, add about 3 μg donor DNA fragment, about 500 ng gRNA, and solution 2 (600 uL 50% PEG4000, 75 uL 1M lithium acetate, 75 uL 10×TE), and vortex to mix;

[0064] 9. Place in a 30°C incubator for 30 min, add 88 μL DMSO and mix well;

[0065] 10. Heat shock at 42°C in a water bath for 20 min, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0066] 11. Add 1 mL of YPD liquid medium, resuspend by pipetting, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0067] 12. Add 1 mL of YPD liquid medium, pipette to resuspend, and shake at 30°C, 220 rpm for 60 min.

[0068] 13. Centrifuge at 13000rpm for 1min and discard the supernatant;

[0069] 14. Add 1 mL 1xTE to resuspend, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0070] 15. After adding 100 μL 1xTE, spread the bacterial solution on SD-URA solid plates for screening and culture for 3-4 days.

[0071] Step 3: Overexpression of CrtE homologous enzymes from different sources

[0072] Six CrtE homologous enzymes were expressed, of which three were from known literature and three from the GOMC database. The CrtE genes from known literature sources include CrtE-Af (from Archaeoglobus fulgidus), CrtE-Pa (from Pantoea ananatis), and CrtE-Sa (from Sulfolobus acidocaldarius). Based on bioinformatics tools, the CrtE genes with potential high β-carotene production from the GOMC database include GOMC-CrtE-Ar (Archaeoglobus), GOMC-CrtE-Ps (Pseudomonas), and GOMC-CrtE-Su (Sulfolobaceae).

[0073] Step 4: Shake flask fermentation of engineered strains

[0074] a. Streak and culture the engineered strain on a YPD plate for 3 days;

[0075] b. Pick a single colony and culture it in 3 mL YPD liquid medium at 30°C and 220 rpm overnight;

[0076] c. Inoculate into 50 mL YPD liquid culture medium with initial OD600 = 0.1;

[0077] d. Ferment the mixture in a shake flask at 30°C and 220 rpm for 3 days to obtain a fermentation solution.

[0078] Step 5: Carotenoid content detection

[0079] 1. Bacteria collection: a. Take 1 mL of bacterial solution and centrifuge at 1000g for 10 min at 4°C, and discard the supernatant; b. Quickly immerse the bacteria in liquid nitrogen for 30 seconds and thaw on ice; c. Take 1 mL of 4°C pre-cooled 1x PBS buffer to wash the bacteria; d. Centrifuge at 1000g for 10 min and discard the supernatant; e. Centrifuge at 12000rpm for 1 min, aspirate the excess liquid, and obtain the bacteria to be tested by mass spectrometry;

[0080] 2. Pre-treatment of bacterial samples: a. Add 200ug 0.5mm glass beads and 1mL acetone to the bacteria to resuspend the bacteria; b. Vortex for 20min in the dark until the cells are colorless; c. Centrifuge at 13000rpm for 10min and take 10uL supernatant; d. Blow dry with nitrogen and add 100uL methanol to dissolve before testing.

[0081] 3. Carotenoid detection method and parameters: The present invention adopts LC-MS / MS detection, the mass spectrometry condition is FullScan positive mode, the scanning range is 500-650m / z; the chromatographic condition is that the mobile phase is MEOH:ACN 95:5 (0.1%FA), the chromatographic column model is ACQUITY UPLC BEH C18 Column 130Å, 1.7 µm, 2.1 mm X 100 mm, the column temperature is 35°C, the injection volume is 5uL, and the isocratic elution conditions of 0-6min and 0.5mL / min are adopted.

[0082] Strains, plasmids, primers and gene sequence information used in the technical solution of the present invention

[0083] (1) Information on strains, plasmids and primers

[0084] Table 1 Information on strains used in this study

[0085]

[0086] Table 2 Information of plasmids used in this study

[0087]

[0088]

[0089] Table 3 Primer or gRNA sequence information used in this study

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] The CrtE-Af gene sequence is as follows (SEQ ID NO: 53):

[0100] ATGTTGAAAGAAGAAATTGCTAAAAGAGCTGAAATTATTAATAAAGCTATTGAAGAATTGTTGCCAGAGAGGGAGCCAATTGGTTTGTACAAGGCTGCTAGGCACTTGATTAAGGCTGGTGGTAAGAGGCTGAGGCCGGTTATTTCTTTGTTGGCTGTCGAAGCTTTGGGTAAGGATTATAGAAAAATTATTCCGGCGGCGGTTTCTATTGAAACTATACATAATTTCACTTTGGTTCATGATGATATAATGGATAGAGATGAAATGAGGAGGGGTGTCCCTACTGTTCACAGGGTCTACGGTGAGGCAACTGCTATTTTGGCTGGTGACACTTTGTTTGCTGAAGCTTTTAAGTTGTTGACAAAATGTGATGTTGAATCTGAAGGTATTAGAAAGGCTACAGAAATGTTATCTGATGTTTGCATTAAAATTTGTGAAGGTCAATACTATGATATGTCATTTGAGAAAAAAGAATCA GTTTCAGAAGAAGAGTATTTGAGAATGGTTGAATTGAAAACAGGTGTCTTGATTGCTGCTTCAGCTGCTTTGCCAGCTGTCTTGTTCGGTGAATCTGAAGAAATTGTCAAAGCTTTATGGGACTACGGTGTCTTGTCTGGAATTGGTTTTCAAATTCAAGATGATTTGTTAGATTTGACAGAAGAAGAAACTGGTAAAGATTGGGGTTCTGATTTGTTGAAGGGTAAGAAAACTTTGATTGTTATAAAAGCTTTTGAAAAAGGTGTTAAATTGAAAACTTTTGGTAAAGAAAAGGCTGATGTTTCTGAAATTAGAGACGATATTGAAAGTTGAGAGAATGCGGTGCTATTGACTACGCTGCATCTATGGCTAGGAAGATGGCTGAGGAGGCTAAGAGAAAGTTGGAAGTTTTGCCTGAATCTAAAGCTAAAGAAACATTGTTAGAATTGACAGATTTTTTAGTTACTAGAAAGAAATAA

[0101] The CrtE-Pa gene sequence is as follows (SEQ ID NO: 54):

[0102] ATGACTGTCTGTGCTAAGAAGCACGTCCATTTAACCAGAGATGCTGCTGAACAATTGTTGGCTGACATTGACAGACGTCTAGACCAATTATTACCTGTCGAAGGTGAAAGAGATGTTGTTGGTGCTGCTATGAGAGAAGGTGCTTTGGCTCCAGGTAAGAGAATCAGACCAATGTTGTTGTTACTCACTGCTCGTGATTTAGGTTGTGCCGTTTCCCACGACGGTTTATTGGACTTGGCCTGCGCTGTTGAAATGGTTCACGCCGCATCCTTGATCTTGGATGACATGCCATGTATGGACGACGCTAAGTTGAGAAGAGGCAGACCAACCATTCACTCTCACTACGGTGAACACGTTGCTATCTTGGCTGCCGTTGCTCTTTTGTCCAAGGCTTTCGGTGTCATTGCTGATGCCGATGGTCTAACTCCACTGGCCAAGAACAGAGCTGTCTCCGAATTGAGTAATGCCATCGGTATGCAAGGTTTGGTCCAAGGTCAATTCAAGGATTTGTCTGAAGGTGACAAGCCAAGATCTGCTGAAGCCATTTTGATGACCAACCACTTTAAGACCTCTACCTTGTTCTGTGCTTCCATGCAAATGGCTAGCATTGTTGCTAACGCTTCTTCCGAAGCTAGAGACTGTTTGCACAGATTCTCTTTGGATTTGGGTCAAGCTTTCCAATTGCTAGATGATTTGACTGATGGTATGACTGACACTGGTAAGGACTCTAACCAAGATGCTGGTAAGTCTACTTTGGTTAACTTGTTGGGTCCAAGAGCTGTTGAAGAAAGATTGAGACAACATTTGCAATTGGCTTCTGAACATTTGTCTGCCGCTTGTCAACACGGTCACGCTACCCAACACTTCATCCAAGCTTGGTTCGACAAAAAATTGGCCGCTGTCTCATAA

[0103] The CrtE-Sa gene sequence is as follows (SEQ ID NO: 55):

[0104] ATGTCATATTTCGATAATTACTTCAACGAAATCGTTAACTCCGTCAACGATATCATCAAGTCTTACATCTCCGGCGATGTTCCAAAGTTGTACGAAGCTTCCTACCACTTGTTTACCTCTGGTG GTAAGAGATTACGTCCATTGATCTTAACTATCTCTTCCGATTTGTTCGGTGGTCAAAGAGAAAGAGCTTATTACGCCGGTGCTGCTATTGAAGTTTTACACACTTTCACCTTGGTCCATGATGA CATCATGGACCAAGATAACATCAGAAGAGGTTTGCCAACTGTTCACGTCAAGTACGGTTTGCCTTTGGCGATCTTGGCTGGTGACTTGTTGCACGCTAAGGCCTTCCAATTGTTGACTCAAGCTTTGCGTGGTTTGCCATCTGAAACCATTATAAAGGCTTTCGACATCTTCACCAGATCTATCATTATCATTTCTGAAGGTCAAGCTGTTGACATGGAGTTCGAAGACAGAATTGACATCAAAGAAC AAGAATACTTGGACATGATTTCCAGAAAGACCGCTGCCTTATTTTCTGCTTCTTCTTCTATTGGTGCCTTGATTGCTGGTGCTAACGACAATGATGTCAGATTGATGTCTGATTTCGGTACCAACTTGGGTATCGCTTTCCAAATCGTCGATGACATTTTAGGTCTAACTGCTGACGAAAAGGAATTAGGTAAGCCAGTTTTCAGCGACATTCGTGAAGGTAAGAAAACTATTTTGGTTATCAAGACT TTGGAATTGTGTAAGGAAGACGAAAAGAAGATTGTCTTGAAGGCTCTCGGTAACAAGTCTGCCTCCAAGGAAGAATTGATGTCCTCTGCTGATATTATTAAGAAGTACTCCTTGGACTACGCATACAACTTGGCCGAAAAATACTACAAGAACGCTATCGATTCTTTGAACCAAGTTTCCTCTAAAAGTGACATTCCAGGTAAGGCTTTGAAGTACCTAGCCGAATTTACCATCAGAAGAAGAAAGTAA

[0105] The GOMC-CrtE-Ar gene sequence is as follows (SEQ ID NO: 56):

[0106]

[0107] The GOMC-CrtE-Ps gene sequence is as follows (SEQ ID NO: 57):

[0108] ATGCAAACTCAAAACTCTCCAGTTCCATTGCCACAATGTGATTCTCTATTAAGATTGAGAAGACAAGTTGACGAAAGATTAGCCTTGCGTTTGCCATTCCCAGAATCTGAATTGGACAAGGTTTCTTTAGCTTTGAGAGAAGGTACTTTGGCCCCAGGTAAGAGATTAAGACCATTGTTGTTATTGCTTGCCTTGTCTGACTTGGGTATTGACCCAGACATTGGTTTGGACTTGGCTTGTGCCCTAGAAATGATTCATGCTGCATCATTGTTCTTGGATGACATGCCATGTATGGACAATGCTTCCTTGAGAAGAGGTCAACCAACCATCCATTTGAGATTCGGTGAAGATGTTGCTGTTTTGGCTTCTGTCGCTTTGTTGTCCCACGCTTACGGTATCACTGCTACTGCTCCAAGACTAACTCCTCGTCAAAGAAACGATGCCGTCGCCATCTTGGCTAGATCCGTCGGTGCTCAAGGCTTGGTCAGAGGTCAATTCCGTGATTTGCACGGTGCTCAAGAAGCCCAACAATTGGACGCTGTCATTGCTACCAACCAATTGAAAACCGCTTCTTTGTTCACCGCTGCTTTGGAAGTTGCCGCTTTATTAGCTGGTGCCGAACGTACCAGAACTAGACACTTGCAAGGTTTCGCTAACCAATTGGGTTTAGCTTTCCAATTGCTGGATGATATCGCTGATGGTTTAACTCCAGAACAAACCGGTAAGAACTGCCAACAAGACAGAACCAAGGCTACAGTTGTCTCCCTCTTGGGTCAACAAGCTGCTGAACAACAATTGGCCACCCACAGAGAAGCTGCTTTGACTCACTTGGATGCTGCCGGTTTGGGTGACGGTGAATTGGCTGCTATGATGAGACAGTTGTTTGGTTAA

[0109] The GOMC-CrtE-Su gene sequence is as follows (SEQ ID NO: 58):

[0110] ATGATTGACGCTTACTTCAACGAAATTTTGAAGGATATCAACGCTACCATCGCTAACTACATCAAGGGTAACGTTAAGGAATTATACGAAGCTTCTTACTACTTATTCCAAGCTGGTGGTAAGAGATTAAGACCATTGATGTTGGTTGCTTCTTCTGATTTGGTTGGTGGTGAAAGAATCAGAGCTATTCTAGCCGGTTCTGCTGTCGAAGTTTTGCACACTTTCACATTGATTCACGATGACATCATGGACCAAGATACTTTGAGAAGAGGTATGCCAACCGTCCATGTCAAGTATGGTGTTCCAATGGCTATCTTGGCTGGTGACTTGTTGCACGCTAAGGCTTTTCAAATCTTGAACGATGCTTTGTCTGGTATGGAATCTAATTTGATCACCAAGGCTTTCAGAATTTTCACCGATGCCATTTTGGTTATCTCAGAAGGTCAAGCCTTGGACATGCAATTCGAAGACAGAAAGAGTATTTCTGAAGGTG AATACCTTGACATGATCAACAGAAAGACCGCCAAGTTGTTTTCCGCATCCACCGCTTTGGGTGCTTTGATTGGTAAGGCTTCCGATGATGTCGTTAAAAGTTGGAAGATTTCGGTTTATTACTCGGTATCTCTTTCCAAATTGTTGACGACATTCTGGGTTTGACTGCCAACGAAGAAGAGTTAGGTAAGCCATTGTACTCCGACATTAGAGAAGGTAAAAGACTATCTTGGTCATCAAGGCCTT AGACATGGCCAATGAAGAAGAAAAGCGTATTATCCTACAAAACTTGGGTAACAGAAACGCCTCCAAGGAAGAATTGAAGCAAACTGCTGACATCATCAAGAAGTACTCTTTGAACTACGCTTACGAATTGGCTGATAAATATTACAAGCAAGCTTTGGACAAGTTGGACTCCATTGAATGGAAGAACGAATTGGCTGGCAAAGCTTTGAAGTACATTGCTGAATTCACTGTCAAGAGACGTAAATGA

[0111] Example 1: Mining CrtE homologous enzymes with potential high β-carotene production based on the GOMC database

[0112] The present invention uses the TurNuP model to predict the Kcat value of the enzyme reaction, uses the ESP model to predict the Km value of the substrate-corresponding enzyme, and reflects the catalytic efficiency of the CrtE enzyme based on the Kcat / Km value. The higher the Kcat / Km value, the better the catalytic activity of the CrtE enzyme. The present invention screened 119 CrtE homologous enzymes from the GOMC database based on the amino acid sequences of the CrtE-Af, CrtE-Sa, and CrtE-Pa genes, and selected three CrtE homologous enzymes (GOMC-CrtE-Ar, GOMC-CrtE-Su, and GOMC-CrtE-Ps) with similar structures and the highest Kcat / Km values ​​for experimental verification.

[0113] The Kcat / Km values ​​of the six genes of the present invention are shown in Table 4, wherein the Kcat / Km values ​​of the genes mined from the GOMC database are all higher than those of the CrtE-Af, CrtE-Sa, and CrtE-Pa genes reported in the literature, indicating that the genes selected by the present invention may have better catalytic activity.

[0114] Table 4 Kcat / Km values ​​of predicted genes

[0115]

[0116] The present invention uses the Foldtree tool (https: / / github.com / DessimozLab / fold_tree) to cluster protein structures and visualizes them using the iTOL tool, such as Figure 2 As shown. Among them, CrtE-Pa and COMC-CrtE-Ps, CrtE-Af and GOMC-CrtE-Ar, CrtE-Sa and GOMC-CrtE-Su have similar structures.

[0117] Example 2: Construction of an initial chassis strain expressing β-carotene

[0118] 2.1 Construction of gene expression cassette

[0119] Construction of CarRP-Bt gene expression vector: BY4741 yeast strain genome was used as a template to amplify Int3L, P PGK1 、T PGK1 , Int3R target fragments, and assembled them into a large fragment Int3L-P using Overlap PCR technology. PGK1 -T PGK1 -Int3R, where P PGK1 Promoter and T PGK1The restriction sites KpnI and SacI were inserted between the terminators, and the large fragment Int3L-P PGK1 -T PGK1 -Int3R was assembled into the PRS426 linear vector digested with KpnI and SacI to construct plasmid TG-2. The CarRP-Bt target fragment synthesized after codon optimization was assembled into the TG-2 linear vector digested with KpnI and SacI to construct the CarRP-Bt gene expression cassette TG-2-CarRP-Bt.

[0120] Construction of CarB-Bt gene expression vector: BY4741 yeast strain genome was used as a template to amplify Int10L, P CYC1 , T CYC1 , Int10R target fragments, and assembled them into a large fragment Int10L-P using Overlap PCR technology. CYC1 -T CYC1 -Int10R, where P CYC1 Promoter and T CYC1 The restriction sites BamHI and EcoRI were inserted between the terminators, and the large fragment Int10L-P was cloned using the Gibson technique. CYC1 -T CYC1 -Int10R was assembled into the pRS426 linear vector digested with KpnI and SacI to construct plasmid TG-3. The CarB-Bt target fragment synthesized after codon optimization was assembled into the TG-3 linear vector digested with BamHI and EcoRI to construct the CarB-Bt gene expression cassette TG-3-CarB-Bt.

[0121] 2.2 Construction of CRISPR-Cas9 expression cassette

[0122] The CRISPR-Cas9 gene expression cassette designed in this study mainly inserts a 20bp recognition site, a gRNA scaffold skeleton, and screens for resistance URA protein based on pCas. The gene insertion recognition site gRNA is designed using the CHOPCHOP online design tool (https: / / chopchop.cbu.uib.no / ).

[0123] Construction of CRISPR-Cas9 expression cassette of CarRP-Bt gene: CarRP-Bt gene was designed to be inserted between RPO21 and SCM3 genes on chromosome IV of 2369R strain, i.e., site Int3, with recognition sequence of AACATTAATTGCTCTCACAG (SEQ ID NO: 59). The sequence Int3gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and Int3gRNA-Ura fragment with BsaI restriction enzyme to construct the pCAS-Int3 expression cassette.

[0124] Construction of CRISPR-Cas9 expression cassette of CarB-Bt gene: CarB-Bt gene was designed to be inserted between IPI3 and PBR1 genes on chromosome XIV of 2369R strain, i.e., site Int10, with recognition sequence CATGAGCAGCCACTGTATCG (SEQ ID NO: 60). The sequence Int10gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and Int10gRNA-Ura fragment with BsaI restriction endonuclease to construct the pCAS-Int10 expression cassette.

[0125] 2.3 CarRP-Bt and CarB-Bt genome insertion

[0126] Using plasmids TG-2-CarRP-Bt and TG-3-CarB-Bt as templates, PCR was performed to obtain Int3L-P PGK1 -CarRP-Bt-T PGK1 -Int3R and Int10L-P CYC1 -CarB-Bt-T CYC1 -Donor DNA fragment of Int10R.

[0127] Using 2369R cells as the base, the donor DNA fragment Int3L-P was transformed into PGK1 -CarRP-Bt-T PGK1 -Int3R and pCAS-Int3 plasmids were introduced to obtain strain 2-RP with the CarRP-Bt gene introduced.

[0128] Using 2-RP as the base cell, the donor DNA fragment Int10L-P was transformed into CYC1 -CarB-Bt-T CYC1-Int10R and pCAS-Int10 plasmids were introduced to obtain the strain 2-RPB introduced with CarRP-Bt and CarB-Bt genes. This strain is the initial chassis cell for heterologous synthesis of β-carotene.

[0129] Example 3: Overexpression of CrtE homologous enzymes from different sources

[0130] 3.1 Construction of CrtE gene expression cassette

[0131] The BY4741 yeast genome was used as a template to amplify X-4L and P TDH3 、T PGK1 , X-4R target fragments, and assembled them into large fragments X-4L-P using Overlap PCR technology. TDH -T PGK1 -X-4R, where P TDH3 Promoter and T PGK1 The restriction sites KpnI and SacI were inserted between the terminators, and the large fragment X-4L-P was then cloned using the Gibson technique. TDH -T PGK1 -X-4R was assembled into the pRS426 linear vector digested with KpnI and SacI to construct plasmid TG-1. The target fragments of CrtE-Af, CrtE-Pa, CrtE-Sa, GOMC-CrtE-Ar, GOMC-CrtE-Ps, and GOMC-CrtE-Su synthesized after codon optimization were assembled into the TG-1 linear vector digested with KpnI and SacI to construct the CrtE gene expression cassettes TG-1-CrtE-Af, TG-1-CrtE-Pa, TG-1-CrtE-Sa, TG-1-GOMC-CrtE-Ar, TG-1-GOMC-CrtE-Ps, and TG-1-GOMC-CrtE-Su.

[0132] 3.2 Construction of CRISPR-Cas9 expression cassette

[0133] The CrtE gene of the present invention is constructed by sharing a CRISPR-Cas9 expression cassette, wherein the CrtE gene is designed to be inserted between the LSB6 and GSH1 genes of the Xth chromosome of the 2369R strain, i.e., site X-4, and the recognition sequence is CGCCATTCAAGAGCAGCAAC (SEQ ID NO: 61). The sequence X-4gRNA-Ura is synthesized by PCR, and then the pCas9 vector and the X-4gRNA-Ura fragment are assembled by Golden-gate cloning with the BsaI restriction endonuclease to construct a pCAS-X-4 expression cassette.

[0134] 3.3 CrtE series gene insertion into the genome

[0135] Using plasmids TG-1-CrtE-Af, TG-1-CrtE-Pa, TG-1-CrtE-Sa, TG-1-GOMC-CrtE-Ar, TG-1-GOMC-CrtE-Ps, and TG-1-GOMC-CrtE-Su as templates, PCR was performed to obtain X-4L-P TDH3 -CrtE-Af-T PGK1 -X-4R, X-4L-P TDH3 -CrtE-Pa-T PGK1 -X-4R, X-4L-P TDH3 -CrtE-Sa-T PGK1 -X-4R, X-4L-P TDH3 -GOMC-CrtE-Ar-T PGK1 -X-4R, X-4L-P TDH3 -GOMC-CrtE-Ps-T PGK1 -X-4R, X-4L-P TDH3 -GOMC-CrtE-Su-T PGK1 -Donor DNA fragment of X-4R.

[0136] Using 2-RPB as the chassis cell, the donor DNA fragments of the CrtE series genes and the pCAS-X-4 plasmid were respectively transferred by LiAc-mediated chemical transformation method, and the strain chassis cell 2-E into which the CrtE-Af, CrtE-Pa, CrtE-Sa, GOMC-CrtE-Ar, GOMC-CrtE-Ps, and GOMC-CrtE-Su genes were transferred was obtained. Af RPB, 2-E Pa RPB, 2-E Sa RPB, 2-E Ar RPB, 2-E Ps RPB, 2-E Su RPB.

[0137] Example 4: Detection of carotenoid content in engineered strains

[0138] The present invention uses LC-MS / MS to analyze the expression of the β-carotene initial chassis strain 2RPB and the strain 2-E with different CrtE genes inserted into the genome. Af RPB, 2-E Pa RPB, 2-E Sa RPB, 2-E Ar RPB, 2-E Ps RPB, 2-E Su RPB is used to test the content of lycopene and β-carotene, such as Figure 3shown.

[0139] Depend on Figure 3 It can be seen that the strain 2RPB with CarRP-Bt and CarB-Bt genes inserted into the genome can express and produce β-carotene, but the yield is low, only 21.6 ug / L / OD, and no lycopene is detected; secondly, the insertion of CrtE-Pa, CrtE-Af and their structurally similar GOMC-CrtE-Ps and GOMC-CrtE-Ar genes on the basis of 2RPB chassis all showed that the lycopene production was significantly higher than that of β-carotene, indicating that these four CrtE genes will produce lycopene substrate inhibition, and the higher the lycopene content, the lower the β-carotene content; however, the insertion of CrtE-Sa and GOMC-CrtE-Su genes into the genome can relieve the lycopene substrate inhibition, causing the β-carotene content to increase sharply, while the strain 2-E Su The β-carotene content of RPB was significantly higher than that of 2-E Sa The RPB strain reached 574.01 ug / L / OD, which was 26.57 times that of the initial strain 2RPB. This indicates that the GOMC-CrtE-Su gene discovered from the GOMC database in the present invention has great advantages in heterologous expression of β-carotene.

Claims

1. A method for producing β-carotene, characterized in that: The method comprises: overexpressing CrtE gene, CarRP gene and CarB gene in a chassis strain; Wherein, the CrtE gene is a CrtE gene from Sulfolobaceae and / or Sulfolobus acidocaldarius, and the CrtE gene sequence is as shown in SEQ ID NO: 55 or 58, or has a sequence identity of more than 95% with SEQ ID NO: 55 or 58; Furthermore, the CarRP gene and CarB gene are the CarRP gene and CarB gene from Blakeslea trispora; wherein the CarRP gene sequence is as shown in SEQ ID NO: 62, or has a sequence identity of more than 95% with SEQ ID NO: 62; the CarB gene sequence is as shown in SEQ ID NO: 63, or has a sequence identity of more than 95% with SEQ ID NO:

63.

2. The method according to claim 1, characterized in that The overexpression is achieved by introducing heterologous CrtE gene, CarRP-Bt and CarB-Bt genes into the chassis strain through gene editing method.

3. The method according to claim 1 or 2, characterized in that The chassis strain is a yeast strain.

4. The method according to claim 2, characterized in that The gene editing method is to use the CRISPR-Cas9 system to perform gene editing.

5. A chassis strain for producing β-carotene, characterized in that: The CrtE gene, the CarRP gene and the CarB gene are overexpressed in the chassis strain, and the β-carotene yield in the chassis strain is at least 5 times higher than the lycopene yield; Wherein, the CrtE gene is a CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius, and the CrtE gene sequence is as shown in SEQ ID NO: 55 or 58, or has a sequence identity of more than 95% with SEQ ID NO: 55 or 58; Furthermore, the CarRP gene and CarB gene are the CarRP gene and CarB gene from Blakeslea trispora; wherein the CarRP gene sequence is as shown in SEQ ID NO: 62, or has a sequence identity of more than 95% with SEQ ID NO: 62; the CarB gene sequence is as shown in SEQ ID NO: 63, or has a sequence identity of more than 95% with SEQ ID NO:

63.

6. The chassis strain according to claim 5, characterized in that The chassis strain is a yeast strain.

7. The chassis strain according to claim 6, characterized in that The chassis strain is yeast strain 2369R, and wherein the CarRP gene is introduced between the RPO21 and SCM3 genes of chromosome IV, the CarB gene is introduced between the IPI3 and PBR1 genes of chromosome XIV, and / or the CrtE gene is introduced between the LSB6 and GSH1 genes of chromosome X.

8. Use of the CrtE gene in producing β-carotene, characterized in that: The CrtE gene is a CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius; the CrtE gene sequence is shown in SEQ ID NO: 55 or 58, or has a sequence identity of more than 95% with SEQ ID NO: 55 or 58.

Images