Molecular marker of tilletia dwarf and application of molecular marker

Abstract

The invention discloses a molecular marker of wheat dwarf tilletia and application of the molecular marker. The molecular marker of the wheat dwarf tilletia caryophyllus, disclosed by the invention, comprises at least one gene segment of OG0008430, OG0008601, OG0008603 and OG0008610. The molecular marker of the wheat dwarf tilletia caryophyllus, disclosed by the invention, is used for detecting the tilletia caryophyllus. According to the molecular marker disclosed by the invention, the tilletia dwarfing and the approximate species thereof are distinguished and identified from the genome level, the molecular difference between the tilletia dwarfing and the approximate species can be more comprehensively, accurately and effectively reflected, a new scheme and a new way are provided for detection and identification of the tilletia dwarfing; the method has important value and significance for quarantine and prevention and treatment of wheat stunt smut bacteria.

Description

Technical Field

[0001] The present application relates to the technical field of wheat dwarf bunt pathogen detection, and in particular to molecular markers of wheat dwarf bunt pathogen and applications thereof. Background Art

[0002] Tilletia controversa is a plant pathogen that causes wheat dwarfing and increased tillering, and is listed as a quarantine disease in more than 40 countries. It is spread through seeds, soil, air and other channels, can survive in the soil for many years, and is difficult to eradicate.

[0003] The biological and molecular biological characteristics of wheat dwarf bunt fungus are very similar to those of the same genus, such as wheat net bunt, wheat light bunt, etc. Therefore, it is difficult to distinguish them using traditional plant pathogen detection methods.

[0004] Although there have been some studies and reports on PCR detection of wheat dwarf bunt fungus in recent years, it is difficult to effectively distinguish and detect it because the ITS sequences of wheat dwarf bunt fungus and various bunt fungi of the same genus are very similar.

[0005] Therefore, developing new molecular markers for wheat dwarf bunt fungus to better meet the needs of detection and identification of wheat dwarf bunt fungus is of great value and significance for the quarantine and prevention of wheat dwarf bunt fungus. Summary of the invention

[0006] The purpose of the present application is to provide a new molecular marker for wheat dwarf bunt pathogen and its application.

[0007] This application adopts the following technical solutions:

[0008] The first aspect of the present application discloses a molecular marker for wheat dwarf bunt fungus, including at least one gene fragment among the OG0008430 gene fragment, the OG0008601 gene fragment, the OG0008603 gene fragment, and the OG0008610 gene fragment.

[0009] It should be noted that the present application creatively obtained new molecular markers for wheat dwarf bunt pathogen from the genome level screening, providing a new scheme and approach for the detection and identification of wheat dwarf bunt pathogen, which has important value and significance for the quarantine and prevention of wheat dwarf bunt pathogen.

[0010] In one implementation of the present application, the OG0008430 gene fragment is the sequence shown in Seq ID No.25, the OG0008601 gene fragment is the sequence shown in Seq ID No.26, the OG0008603 gene fragment is the sequence shown in Seq ID No.27, and the OG0008610 gene fragment is the sequence shown in Seq ID No.28.

[0011] The second aspect of the present application discloses a recombinant plasmid containing the molecular marker of the present application.

[0012] It should be noted that the key to this application is the development of new molecular markers for wheat dwarf bunt fungus at the genome level: OG0008430, OG0008601, OG0008603, and OG0008610; it can be understood that these four gene fragments can be cloned into a recombinant plasmid according to conventional methods, and then the recombinant plasmid can be used as a positive control.

[0013] It should also be noted that the specific primers and probes designed based on the molecular markers of the present application can completely amplify the four genes, or only amplify a certain fragment of the molecular marker gene; in this case, only the amplified target fragment can be cloned in the recombinant plasmid without cloning the complete molecular marker gene into the recombinant plasmid.

[0014] The third aspect of the present application discloses a transfected cell containing the recombinant plasmid of the present application.

[0015] It should be noted that the recombinant plasmid of the present application can be transfected into host cells, and then single clones that can stably replicate in host cells can be obtained through single clone screening and identification, and the recombinant plasmid of the present application can be obtained through host cell culture and plasmid extraction.

[0016] The fourth aspect of the present application discloses the use of the molecular marker of the present application, the recombinant plasmid of the present application or the transfected cell of the present application in the detection or identification of wheat dwarf bunt fungus.

[0017] It should be noted that the key to this application is that research has found that at least one gene fragment among OG0008430, OG0008601, OG0008603, and OG0008610 can be used as a molecular marker for the detection or identification of wheat dwarf bunt fungus; therefore, recombinant plasmids or cloned cells containing these gene fragments can also be used for the detection or identification of wheat dwarf bunt fungus.

[0018] The fifth aspect of the present application discloses a kit for detecting or identifying wheat dwarf bunt pathogen, which contains reagents for detecting the molecular markers of the present application.

[0019] In one implementation of the present application, the reagents for detecting the molecular markers of the present application include OG0008430-specific detection primers and probes, OG0008601-specific detection primers and probes, OG0008603-specific detection primers and probes, and OG0008610-specific detection primers and probes.

[0020] In one implementation of the present application, the OG0008430 specific detection primers and probes include at least one set of the OG0008430 first primer-probe combination and the OG0008430 second primer-probe combination; the upstream and downstream primers of the OG0008430 first primer-probe combination are the sequences shown in Seq ID No.1 and Seq ID No.2, respectively, and the probe is the sequence shown in Seq ID No.3; the upstream and downstream primers of the OG0008430 second primer-probe combination are the sequences shown in Seq ID No.4 and Seq ID No.5, respectively, and the probe is the sequence shown in Seq ID No.6.

[0021] In one implementation of the present application, the OG0008601-specific detection primers and probes include at least one set of the OG0008601 first primer-probe combination and the OG0008601 second primer-probe combination; the upstream and downstream primers of the OG0008601 first primer-probe combination are the sequences shown in Seq ID No.7 and Seq ID No.8, respectively, and the probe is the sequence shown in Seq ID No.9; the upstream and downstream primers of the OG0008601 second primer-probe combination are the sequences shown in Seq ID No.10 and Seq ID No.11, respectively, and the probe is the sequence shown in Seq ID No.12.

[0022] In one implementation of the present application, the OG0008603-specific detection primers and probes include at least one set of an OG0008603 first primer-probe combination and an OG0008603 second primer-probe combination; the upstream and downstream primers of the OG0008603 first primer-probe combination are the sequences shown in Seq ID No.13 and Seq ID No.14, respectively, and the probe is the sequence shown in Seq ID No.15; the upstream and downstream primers of the OG0008603 second primer-probe combination are the sequences shown in Seq ID No.16 and Seq ID No.17, respectively, and the probe is the sequence shown in Seq ID No.18.

[0023] In one implementation of the present application, the OG0008610 specific detection primers and probes include at least one set of the OG0008610 first primer-probe combination and the OG0008610 second primer-probe combination; the upstream and downstream primers of the OG0008610 first primer-probe combination are the sequences shown in Seq ID No.19 and Seq ID No.20, respectively, and the probe is the sequence shown in Seq ID No.21; the upstream and downstream primers of the OG0008610 second primer-probe combination are the sequences shown in Seq ID No.22 and Seq ID No.23, respectively, and the probe is the sequence shown in Seq ID No.24.

[0024] In one implementation of the present application, the kit of the present application also contains the recombinant plasmid of the present application, which is used as a positive control.

[0025] In one implementation of the present application, the kit of the present application further contains a real-time fluorescent PCR reaction mixture.

[0026] It can be understood that the key to the kit of the present application lies in the specific primers and probes for detecting the molecular markers of the present application. As for the real-time fluorescent PCR reaction mixture, it can be combined into the kit of the present application according to needs, or it can be directly purchased separately, and no specific limitation is made here.

[0027] The sixth aspect of the present application discloses a method for detecting or identifying wheat dwarf bunt fungus, comprising using the kit of the present application to detect the molecular markers of the present application, and distinguishing and identifying the Tilletia species to be detected based on the detection results.

[0028] It should be noted that the detection or identification method of the present application, by detecting the molecular markers of the present application, especially the combined detection of four genes OG0008430, OG0008601, OG0008603, and OG0008610, can effectively distinguish and identify Tilletia species. In one implementation of the present application, 37 Tilletia species are specifically distinguished and identified.

[0029] The beneficial effects of this application are:

[0030] The molecular markers of the present application can distinguish and identify wheat dwarf bunt fungus and its similar species at the genomic level, and can more comprehensively, accurately and effectively reflect the molecular differences between wheat dwarf bunt fungus and similar species, providing a new solution and approach for the detection and identification of wheat dwarf bunt fungus, which is of great value and significance to the quarantine and prevention and control of wheat dwarf bunt fungus. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1It is the homologous gene obtained by preliminary screening in the examples of this application;

[0032] Figure 2 It is the homologous gene screened in the examples of this application and used for primer probe design. DETAILED DESCRIPTION

[0033] The present application is further described in detail below through specific examples. The following examples are only used to further illustrate the present application and should not be construed as limiting the present application.

[0034] Example

[0035] 1. Materials and Methods

[0036] 1. Test materials

[0037] There are 31 Tilletia genome data for comparative genome analysis, of which 3 were provided by Shenzhen Customs Animal and Plant Inspection and Quarantine Technology Center, and 28 were from GenBank assembled and annotated genomes; among them, there are 7 genome data for T.controversa, as shown in Table 1.

[0038] Table 1 Tilletia species used for genome analysis

[0039]

[0040]

[0041] 2. Gene fragment screening and analysis

[0042] OrthoFinder (version 2.5.4) was used to cluster homologous protein sequences according to sequence similarity. The sequence clustering results unique to T. contorversa were preliminarily screened out based on the clustering results. The corresponding nucleic acid sequences were found based on the screened protein sequence results. The multiple sequence alignment tool MUSCLE (v3.8.31) was used to perform multiple sequence alignment on the nucleic acid sequences. Nucleic acid sequences or sequence fragments with 100% consistency were screened out based on the alignment results.

[0043] 3. Sequence fragment verification

[0044] The screened sequence fragments were aligned to the known database, and the CDS region fragments of the nucleic acid sequence were screened according to the recorded information in the genome. They were aligned to the NR database through NCBI online alignment blastx, and the CDS fragment sequences and their protein sequences were aligned to the gene sequences obtained from the transcriptome data analysis.

[0045] 4. Gene Primer Probe Design

[0046] The screened nucleic acid sequence was supplemented with 100 bp of bases in the upstream and downstream of the genome, and the online tool Primer-BLAST (which integrates the functions of Primer3 and Blast tools) provided by NCBI was used to try to design primers for the fragments.

[0047] 5. Genetic verification

[0048] 5.1 PCR amplification

[0049] PCR amplification was performed on the samples to verify the discrimination of the target gene. In this experiment, PCR amplification and Sanger sequencing were performed on 37 Tilletia species, as shown in Table 2.

[0050] Table 2 Tilletia species used for primer and probe verification

[0051]

[0052]

[0053] 5.2 Sanger sequencing

[0054] The amplified products were sequenced to verify whether they were the target genes. The software MEGA7 was used for alignment and sorting.

[0055] 5.3 Genome sequencing

[0056] The genomes of TCK-XJ (Tilletia controversa), TFO-XJ (Tilletia laevis), and CBS122087 (Tilletia secalis) were sequenced and compared with the TCK genome for similarity.

[0057] 5.4 Fluorescence probe test

[0058] Design corresponding fluorescent probes for PCR amplification primers and develop multiple fluorescence experimental schemes. According to the Ct value, combined with the previous common PCR amplification results, determine whether the sample is effectively amplified.

[0059] Ordinary PCR reaction system (25 μL): sample DNA 1 μL, 10×PCR buffer 2.5 μL, 2.5 mmol / LMgCl2 2.5 μL, 2.5 mmol / L dNTPs 2.5 μL, 10 μmol / L primers 0.5 μL each, 5 U / μL Taq DNA polymerase 0.2 μL, and ddH2O to make up to 25 μL.

[0060] Ordinary PCR reaction conditions: 94°C for 5 min, then 32 cycles: 94°C for 30 s, 52°C for 30 s, 72°C for 30 s, 72°C for 8 min after the cycle, and standby at 4°C.

[0061] 2. Results and Analysis

[0062] 1. Comparative genomic analysis of Tilletia to screen for homologous genes

[0063] There are 7 genomes of the target strain Tilletia controversa queried in the database, and their data number information is as follows (GCA_905071765.1 is the Ref genome of the target strain): GCA_001645045, GCA_009428265, GCA_905071705, GCA_905071725, GCA_905071765, GCA_905071775, GCA_905071785. A total of 12,587 gene clusters were obtained by clustering using OrthoFinder software, of which 15 gene clusters had gene copies in the target strain and no copies in other species of the same genus. The statistical information of sequence copy number is shown in Figure 1 .

[0064] According to the results of nucleic acid sequence comparison, gene clusters with large sequence differences were removed, and only gene fragments with completely identical sequences in at least 5 of the 7 genomes were retained. A total of 9 fragment results were screened, see Figure 2 , mainly based on the Ref genome fragment sequence, including intron sequences.

[0065] The CDS fragments in the nucleic acid sequence were selected and compared online to the NR database. The results showed that in addition to the protein sequence of this species, some other species also had comparison results. In order to prevent false positives, the sequences with relatively good comparison rates with other species were also removed. The final sequence fragments retained were used as potential specific fragments. A total of 4 were retained, namely OG0008430, OG0008601, OG0008603, and OG0008610. OG0008430 is the sequence shown in Seq ID No.25, OG0008601 is the sequence shown in Seq ID No.26, OG0008603 is the sequence shown in Seq ID No.27, and OG0008610 is the sequence shown in Seq ID No.28.

[0066] Seq ID No.25:

[0067] ATGACTGGTGGAACCTTCACGTACTACCTCAAGGACAGCGTCGCCGTCGCTGTTGTCTTGACGGGAGTTCCGCCCCGCGCTCATGACCCTCTGATGACGCTCCAGCCAGACGTCTTCGACCACTGGAGAGTCAAGGTGCGCGACGCCGTCACGGGTCACAACAACGTCAACCAGCGGTTCTACGTCGTCATCGATTCGTCCGTCGTCATGGCACAGGTACAGGGTCAGGACCAGCTTGCCGTGCGCGTCGTTGTCCTCGCCCAGAGCGTCAGGTCGTCGGTGGCTACGTATGACTTCCGCAAGGCTGCGCAGGAGCTCGGGCTCAACTTTGCCGTGGTCGACCAGCGAATCGACGTCGACAATCCCGAGGTCGCTGGGTTGTTCAGGGACCGCATGCCTCGCTAA

[0068] Seq ID No.26:

[0069]

[0070] Seq ID No.27:

[0071] ATGAATGACCACCAGATGGCAACAAAGTGAGTTGCTCACGATTGGACCCTGTACAATGTCGTGATCCTCATTGAGCTCTTGCTTCCTCATGTTTCTTGCTTTGCCTCCCCCTACCACCACACCACCTCTTCAAACTCAAGGCAAGGTTGGGACAAAGCTATCGGCAAACCAAGGCCGATGATGGCTGCCATCACCGCCGACACTGTCAAAGACGGCCAAGAATGGTGCACCTTGATCGACGAAGCCTTGTATGCATTCAAGGGCCTGGTCGAGATCCAAGGCGGGACCATCCGAAACCAAGATGCAATGGTCGATCTCTTCCAGGCATACACCGTCTTCAAATCTCAGTTCGTGCTCAACTACGACCAAGCGGACCTTCAAAAGAAGTTCAACATGGCCATCGACGCCATCGAGAACAAGCTTACCAGCCCTGAGCCCGCTTATGCCCAGTATAAGGTCCACTCCAAGATGATGGTCGCCATCAAGAACAAGTTCCCGAACAACTACGAAGGCAAGCAAAAGATTTGGAAGCAGCTGTGCTCGCAGATCCTCGTCGACAAGGCCGCCTACGTCAAATCTGGTCTGAAACGAGATGCCACCAACATGAAGCAGGTCGCCGACGTCAAGCGGGATCTCCCTTAG

[0072] Seq ID No.28:

[0073] ATGACCCGACACAGCTGCCGTCCCGTTCGGAAGCTCCGCCGATACAGCAAGGCGGTGCTGAACCAGCAACTCTTCGAGATCTGGGTTGAGCCCCCCCTCAAGGATCGGCCTCAAAAACTGACTTTG CCCAAATTCAAGAGTATTTTCAAAGAGCTCCTTAAGCACTACGGTTGCTATGAGAAAGCCGAGGCCCACAAGATCATGAAGGCGGTAAGTGCGTTGTCAACTCCCTCTGTTTGTTATCTACATCTCATC TCATGCCTCGTCGGCCCATCCCTTTATATAGTTCGCTCGGTCTCATTACTACCGAAACACCGAGCCGGCTGACAGCCCTTTCCACCCTGGAGCAACGCTACATCATGCTCCTCCTCGTCCTCAAGTC TCTGACTGGAGCCTGCACCACCGACGAGGAGCTTTCCGCTGCGGCGGCCAAAACCGGACTTTTCAACGTACAAGTGCGTAATTACATCGCCGCCGCGAAGAAATATGATGTCCAGCTCTTTGTTCGTTAG

[0074] 2. Primer and probe design of candidate genes

[0075] For the several gene fragments finally screened and the retained upstream and downstream bases, the default conditions were used to design primers to obtain primer information. The primer sequence information is shown in Table 4.

[0076] Table 4 Primers and probes designed for candidate gene fragments

[0077]

[0078]

[0079] In Table 4, the primers and probes with "8430" in the "number" are specific primers and probes designed for the "OG0008430" gene fragment, "1F" is the upstream primer, "1R" is the corresponding downstream primer, "1PF" or "1PR" is the corresponding probe, and the rest are similar.

[0080] 3. Design primers and probes to distinguish and identify efficiency

[0081] PCR amplification and Sanger sequencing were performed on 37 Tilletia species. The results showed that the combination of 4 genes can distinguish and identify Tilletia species. The distinction is shown in Table 5. At the same time, multiple real-time fluorescence PCR was established. The reaction system and amplification procedure are shown in Table 6. In the multiple qPCR, the Bioer 9600 fluorescence quantitative PCR instrument (model: FQD-96A) was used to detect different targets, and fluorescent groups with different spectral ranges were selected. Although many fluorescent groups with similar fluorescence spectra have different maximum emission wavelengths, they still overlap in nearby bands. Therefore, it is necessary to exclude the fluorescent group combinations that may interfere with each other in the emission spectra, select some samples to test the remaining multiple probe combinations, and finally obtain a combination method that can amplify multiple pairs of primer probes at the same time, and the amplification results are consistent with the ordinary PCR results. After many combination attempts, a triple + single real-time fluorescence PCR method was formed to effectively distinguish the target species from other species. There were two combinations, one was triple (OG0008601, OG0008603, OG0008610) + single (OG0008430), and the other was triple (OG0008430, OG0008603, OG0008610) + single (OG0008601). The combination methods and differentiation and identification results are shown in Tables 7, 8, 9 and 10, respectively. Table 7 is the result of triple real-time fluorescence PCR consisting of primer-8601-2F, primer-8601-2R and primer-8601-2PF, primer-8603-1F, primer-8603-1R and primer-8603-1PF, and primer-8610-1F, primer-8610-1R and primer-8610-1PR, and Table 8 is the result of single real-time fluorescence PCR consisting of primer-8430-2F, primer-8430-2R and primer-8430-2PR. Tables 7 and 8 are for combination 1, i.e. triple (OG0008601, OG0008603, OG0008610) + single (OG0008430). Table 9 shows the results of triple real-time fluorescence PCR consisting of primer-8430-1F, primer-8430-1R and primer-8430-1PF, primer-8603-1F, primer-8603-1R and primer-8603-1PF, and primer-8610-2F, primer-8610-2R and primer-8610-2PR, and Table 10 shows the results of single real-time fluorescence PCR consisting of primer-8601-1F, primer-8601-1R and primer-8601-1PF.Tables 9 and 10 are combination 2, namely triple (OG0008430, OG0008603, OG0008610) + single (OG0008601).

[0082] The experimental results showed that the triple qPCR combination of primer-8601-2PF, primer-8603-1PF, primer-8610-1PR and the triple qPCR combination of primer-8430-1PF, primer-8603-1PF, primer-8610-2PR can effectively amplify, and the amplification results are consistent with those of ordinary PCR amplification, which can meet the identification and differentiation of most Tilletia species. For the Tilletia species that cannot be effectively distinguished by the two multiplex qPCRs, single PCR was performed separately for the probes primer-8430-2PR and primer-8601-1PF. Two sets of triple qPCR + single qPCR combinations for 8 probes can effectively distinguish all Tilletia species.

[0083] Table 5 The efficiency of the selected primers and probes in distinguishing and identifying Tilletia

[0084]

[0085]

[0086] In Table 5, the sample numbers are consistent with those in Tables 1 and 2, “8430 first group” means “OG0008430 first primer probe combination”, “8430 second group” means “OG0008430 second primer probe combination”, and the rest are similar.

[0087] Table 6 qPCR reaction system

[0088] Reagent name 20μL reaction system volume (μL) 2×qPCRMix 10 F primer (10pmol / μL) 0.4 R primer (10pmol / μL) 0.4 DNA template 4 Fluorescent probes 0.2 <![CDATA[ddH2O]]> 5

[0089] Fluorescence PCR reaction conditions: 95℃30sec, then enter 40 cycles: 95℃10sec, 58℃20sec, 72℃30sec, after the cycle, 95℃15sec, 60℃1min, 72℃15sec. During the 40 cycles, fluorescence was collected at 58℃; after the cycle, melting curve analysis was performed, with a step temperature of 0.5℃ and a step constant temperature time of 20sec.

[0090] Table 7 Triple qPCR results for combination 1

[0091]

[0092]

[0093] Table 8. Results of single-plex qPCR for combination 1

[0094] Sample No. Ct value of fluorescent 8430-2 8430-2 Ordinary PCR CBS371.36 － － CBS121951 － － ATCC42080 33.53 √ CBS160.85 － － ATCC90926 33 √ CBS369.36 － － TCK-XJ 34.69 √ CK － －

[0095] Table 9 Triple qPCR results of combination 2

[0096]

[0097] Table 10 Single-plex qPCR results for combination 2

[0098]

[0099]

[0100] In Tables 7 to 10, the sample numbers are consistent with those in Tables 1 and 2, TCK-XJ is the positive control, and CK is the negative control. When the negative control has no Ct value, the sample with a Ct value is judged as effective amplification; when the negative control has a Ct value, the sample Ct value < negative 0.5 or more is judged as effective amplification.

[0101] 3. Discussion and Conclusion

[0102] Molecular detection of wheat dwarf bunt pathogens has always been difficult. Hai DTNguyen et al. (2019) analyzed the genomes of 10 Tilletia species, including 5 species of TCK, and designed specific primer probes for different species, but did not discuss the effectiveness of identification of wheat or single spores in the absence of galls. Somayyeh et al. (2021) compared 21 genomes of 6 species of the genus to identify specific and conserved DNA regions in all TCK isolates and developed a LAMP detection method, but it produced false positive signals for Tilletia trabutii with a specificity of 97.7%. Based on the previous experience of screening specific marker genes for TCK at the genome level, through homologous gene evolution analysis, it was concluded that four genes, OG0008430, OG0008601, OG0008603, and OG0008610, can effectively distinguish TCK and other similar species. Eight pairs of primer probes were designed and two sets of triple + single combination real-time fluorescence PCR detection methods were established, namely combination one and combination two detection methods. The detection method in this example is time-saving, highly sensitive, and can accurately and quickly distinguish Tilletia species, and can be directly applied to the raw grain quarantine of imported wheat.

[0103] The above contents are further detailed descriptions of the present application in combination with specific implementation methods, and it cannot be determined that the specific implementation of the present application is limited to these descriptions. For ordinary technicians in the technical field to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A molecular marker for wheat dwarf bunt pathogen, characterized in that: It includes at least one gene fragment among the OG0008430 gene fragment, the OG0008601 gene fragment, the OG0008603 gene fragment, and the OG0008610 gene fragment.

2. The molecular marker according to claim 1, characterized in that: The OG0008430 gene fragment is the sequence shown in Seq ID No.25, the OG0008601 gene fragment is the sequence shown in Seq ID No.26, the OG0008603 gene fragment is the sequence shown in Seq ID No.27, and the OG0008610 gene fragment is the sequence shown in Seq ID No.

28.

3. A recombinant plasmid containing the molecular marker according to claim 1 or 2.

4. A transfected cell containing the recombinant plasmid according to claim 3.

5. Use of the molecular marker according to claim 1 or 2, the recombinant plasmid according to claim 3 or the transfected cell according to claim 4 in the detection or identification of wheat dwarf bunt pathogen.

6. A kit for detecting or identifying wheat dwarf bunt fungus, characterized in that: Contains a reagent for detecting the molecular marker according to claim 1 or 2.

7. The kit according to claim 6, characterized in that: The reagents for detecting the molecular markers of claim 1 include OG0008430-specific detection primers and probes, OG0008601-specific detection primers and probes, OG0008603-specific detection primers and probes, and OG0008610-specific detection primers and probes.

8. The kit according to claim 7, characterized in that: The OG0008430 specific detection primers and probes include at least one of the OG0008430 first primer-probe combination and the OG0008430 second primer-probe combination; The upstream and downstream primers of the first primer-probe combination of OG0008430 are the sequences shown in Seq ID No.1 and Seq ID No.2, respectively, and the probe is the sequence shown in Seq ID No.3; The upstream and downstream primers of the second primer-probe combination of OG0008430 are the sequences shown in Seq ID No.4 and Seq ID No.5 respectively, and the probe is the sequence shown in Seq ID No.6; Preferably, the OG0008601-specific detection primers and probes include at least one of an OG0008601 first primer-probe combination and an OG0008601 second primer-probe combination; The upstream and downstream primers of the first primer-probe combination of OG0008601 are the sequences shown in Seq ID No.7 and Seq ID No.8 respectively, and the probe is the sequence shown in Seq ID No.9; The upstream and downstream primers of the second primer-probe combination of OG0008601 are the sequences shown in Seq ID No.10 and Seq ID No.11 respectively, and the probe is the sequence shown in Seq ID No.12; Preferably, the OG0008603-specific detection primers and probes include at least one of an OG0008603 first primer-probe combination and an OG0008603 second primer-probe combination; The upstream and downstream primers of the first primer-probe combination of OG0008603 are the sequences shown in Seq ID No.13 and Seq ID No.14 respectively, and the probe is the sequence shown in Seq ID No.15; The upstream and downstream primers of the second primer-probe combination of OG0008603 are the sequences shown in Seq ID No.16 and Seq ID No.17 respectively, and the probe is the sequence shown in Seq ID No.18; Preferably, the OG0008610 specific detection primers and probes include at least one of the OG0008610 first primer-probe combination and the OG0008610 second primer-probe combination; The upstream and downstream primers of the first primer-probe combination of OG0008610 are the sequences shown in Seq ID No.19 and Seq ID No.20 respectively, and the probe is the sequence shown in Seq ID No.21; The upstream and downstream primers of the second primer-probe combination of OG0008610 are sequences shown in Seq ID No.22 and Seq ID No.23 respectively, and the probe is the sequence shown in Seq ID No.

24.

9. The kit according to any one of claims 6 to 8, characterized in that: Also contains the recombinant plasmid according to claim 2; Preferably, it also contains a real-time fluorescence PCR reaction mixture.

10. A method for detecting or identifying wheat dwarf bunt pathogen, characterized in that: The method comprises using the kit according to any one of claims 6 to 9 to detect the molecular marker according to claim 1 or 2, and distinguishing and identifying the Tilletia species to be detected according to the detection result.

Images