Preparation method and phenotype identification method of Zmpste24 gene knockout non-human animal model

By targeting the Zmpste24 gene in non-human animals using CRISPR/Cas9 gene editing technology, a Zmpste24 gene knockout model was prepared, solving the problems of long construction cycle and inaccurate simulation in existing technologies. This provides an ideal tool for aging research and drug screening, and achieves efficient model preparation and multi-dimensional evaluation.

CN121950796APending Publication Date: 2026-05-01BEIJING LAB ANIMAL RES CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511978223.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing technologies for constructing Zmpste24 knockout mouse models suffer from long construction cycles, low efficiency, and difficulty in accurately simulating the pathological characteristics of human premature aging, thus limiting drug development and application.

Method used

Using CRISPR/Cas9 gene editing technology, the second exon region of the Zmpste24 gene in non-human animals was targeted, and gene editing was performed using gRNA to prepare a non-human animal model of Zmpste24 gene knockout. The impact of gene knockout on the aging process was evaluated through multidimensional phenotypic identification.

Benefits of technology

It has enabled the efficient preparation of Zmpste24 gene knockout non-human animal models, simplified the construction cycle, provided an ideal tool for aging mechanism research and anti-aging drug screening, established a systematic phenotypic evaluation process, and accurately simulated the pathological characteristics of human premature aging.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121950796A_ABST
    Figure CN121950796A_ABST
Patent Text Reader

Abstract

The invention relates to a gRNA of a targeted non-human animal Zmpste24 gene, a preparation method of a Zmpste24 gene knockout non-human animal model and a phenotype identification method. The gRNA comprises a nucleotide sequence which is complementary with a second exon region of the non-human animal Zmpste24 gene; the target sequence of the second exon region of the non-human animal Zmpste24 gene is as shown in SEQ ID NO: 4; the gRNA comprises gRNA1 as shown in SEQ ID NO: 1 and gRNA3 as shown in SEQ ID NO: 3, and the molar ratio of the gRNA1 to the gRNA3 is (1-5): (1-5). The Zmpste24 gene knockout non-human animal model prepared by the invention shows a remarkable senescence phenotype at the age of 12 weeks, and has the advantages of remarkable phenotype, good reproducibility, short experimental period and the like. The multi-dimensional phenotype identification method established by the invention can comprehensively evaluate the influence of gene knockout on the aging process.
Need to check novelty before this filing date? Find Prior Art

Description

A method for preparing a Zmpste24 gene knockout non-human animal model and a method for phenotypic identification. Technical Field

[0001] This invention relates to the fields of genetic engineering and aging research technology, and in particular to a method for preparing a Zmpste24 gene knockout non-human animal model and a method for phenotypic identification. Background Technology

[0002] The Zmpste24 gene encodes a protease responsible for the cleavage and processing of prelamin A. Loss of its function can lead to abnormal accumulation of prelamin A, causing laminin diseases such as premature aging.

[0003] Currently, traditional methods for constructing Zmpste24 knockout mouse models suffer from problems such as long construction cycles and low efficiency, and lack a systematic phenotypic identification process. Furthermore, existing models struggle to accurately simulate the pathological characteristics of human progeria, limiting their application in drug development.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The primary objective of this invention is to provide a method for preparing a non-human animal model with the Zmpste24 gene knockout, which provides an ideal tool for studying aging mechanisms and screening anti-aging drugs.

[0006] The second objective of this invention is to provide a phenotypic identification method for a Zmpste24 gene knockout non-human animal model, which can be used to assess the impact of gene knockout on the aging process from multiple dimensions.

[0007] In a first aspect, the present invention provides a gRNA targeting the Zmpste24 gene in non-human animals, said gRNA comprising a nucleotide sequence complementary to the second exon region of the Zmpste24 gene in non-human animals.

[0008] Preferably, the target sequence of the second exon region of the non-human animal Zmpste24 gene is shown in SEQ ID NO: 4; the nucleotide sequence of the gRNA is one or both of gRNA1 shown in SEQ ID NO: 1, gRNA2 shown in SEQ ID NO: 2, or gRNA3 shown in SEQ ID NO: 3.

[0009] Preferably, the nucleotide sequence of the gRNA includes gRNA1 shown in SEQ ID NO: 1 and gRNA3 shown in SEQ ID NO: 3.

[0010] Preferably, the non-human animal mentioned in this invention (in this part and in the context) is a mouse.

[0011] In a second aspect, the present invention provides a method for preparing a non-human animal model with the Zmpste24 gene knocked out, comprising the following steps: using gene editing technology to disrupt the second exon region of the non-human animal Zmpste24 gene, wherein the target sequence of the second exon region of the non-human animal Zmpste24 gene is shown in SEQ ID NO: 4, and the gRNA used to target the non-human animal Zmpste24 gene includes one or both of gRNA1 shown in SEQ ID NO: 1, gRNA2 shown in SEQ ID NO: 2, or gRNA3 shown in SEQ ID NO: 3.

[0012] Preferably, the gRNA for targeting the Zmpste24 gene in non-human animals includes gRNA1 shown in SEQ ID NO: 1 and gRNA3 shown in SEQ ID NO: 3, with a molar ratio of gRNA1 to gRNA3 of (1~5):(1~5).

[0013] Preferably, the gene editing technology is any one of zinc finger nuclease-based gene editing technology, TALEN gene editing technology, or CRISPR / Cas9 gene editing technology; more preferably, the gene editing technology is CRISPR / Cas9 gene editing technology.

[0014] Those skilled in the art will understand that, upon learning of the highly efficient gene-editing region (the second exon region of the ZMPSTE24 gene in non-human animals in this application), they can use any gene-editing method, such as zinc finger nuclease-based gene-editing technology, TALEN gene-editing technology, CRISPR / Cas (e.g., CRISPR / Cas9) gene-editing technology, and other gene-editing methods discovered in the future, to edit the learned highly efficient gene-editing region, optimize gene-editing conditions, and achieve the purpose of highly efficient editing. Therefore, this application covers technical solutions for gene knockout of the non-human animal Zmpste24 gene identified in this application using any available gene-editing method.

[0015] Preferably, the method for preparing a Zmpste24 gene knockout non-human animal model includes the following steps: preparing a gene editing solution containing Cas9 protein and gRNA1 and gRNA3 for targeting the Zmpste24 gene in non-human animals; delivering the gene editing solution into non-human animal fertilized eggs; culturing the delivered fertilized eggs and transplanting them into pseudopregnant non-human animals to obtain a Zmpste24 gene knockout non-human animal model.

[0016] Preferably, the molar ratio of Cas9 protein, gRNA1 and gRNA3 in the gene editing solution is (2~3):(1~5):(1~5).

[0017] Preferably, the method further includes the following steps: mating a non-human animal model that knocks out the Zmpste24 gene to obtain heterozygous or homozygous offspring; and performing phenotypic identification on the heterozygous or homozygous offspring.

[0018] Preferably, the delivered fertilized eggs are cultured to two-cell transplantation into pseudopregnant mice.

[0019] Preferably, the gene editing solution is delivered into non-human animal fertilized eggs via electroporation, and the specific operation of electroporation is known in the art.

[0020] Specifically, gene editing fluid can be prepared using various methods known in the art.

[0021] Preferably, the gRNA used to target the Zmpste24 gene in non-human animals is a gRNA obtained after screening and confirming its knockout efficiency.

[0022] Preferably, the knockout efficiency screening includes the following steps: constructing the designed gRNA into a vector backbone, delivering it to recipient cells, and then screening to obtain gRNAs with high knockout efficiency.

[0023] Preferably, the cells are delivered to the recipient cells via liposome transfection.

[0024] In a third aspect, the present invention provides a Zmpste24 gene knockout non-human animal model, obtained by the method described above for preparing the Zmpste24 gene knockout non-human animal model.

[0025] In a fourth aspect, the present invention provides a method for preparing a Zmpste24 gene knockout mouse model, wherein the mouse Zmpste24 gene is destroyed using CRISPR / Cas9 gene editing technology, the target sequence of the second exon region of the mouse Zmpste24 gene is shown in SEQ ID NO: 4, and the gRNA for targeting the mouse Zmpste24 gene includes one or two of gRNA1 shown in SEQ ID NO: 1, gRNA2 shown in SEQ ID NO: 2, or gRNA3 shown in SEQ ID NO: 3.

[0026] In one specific embodiment, the gRNA for targeting the mouse Zmpste24 gene includes gRNA1 shown in SEQ ID NO: 1 and gRNA3 shown in SEQ ID NO: 3.

[0027] In one specific embodiment, the molar ratio of Cas9 protein, gRNA1, and gRNA3 in the gene editing solution is (2~3):(1~5):(1~5), for example, it can be 2:1:1, 2:1:2, 2:1:3, 2:1:4, 2:1:5, 2:2:1, 1:1:1, 2:2:3, 2:2:4, 2:2:5, 2:3:1, 2:3:2, 2:3:3, 2:3:4, 2:3:5, 2:4:1, 2:4:2, 2:4:3, 2:4:4, 2:4:5, 2:5:1. 2:5:2, 2:5:3, 2:5:4, 2:5:5, 3:1:1, 3:1:2, 3:1:3, 3:1:4, 3:1:5, 3:2:1, 3:2:2, 3:2:3, 3:2:4, 3:2:5, 3:3:1, 3:3:2, 3:3:4, 3:3:5, 3:4:1, 3:4:2, 3:4:3, 3:4:4, 3:4:5, 3:5:1, 3:5:2, 3:5:3, 3:5:4, 3:5:5, etc.

[0028] In one specific embodiment, the mouse is a C57BL / 6J mouse.

[0029] Specifically, the method for preparing the Zmpste24 gene knockout mouse model includes the following steps: synthesizing gRNA1 and gRNA3 for targeting the second exon region of the mouse Zmpste24 gene, and mixing them to obtain a gRNA mixture; purchasing Cas9 protein; mixing the gRNA mixture and the Cas9 protein to obtain a gene editing solution for targeting the gRNA in the second exon region of the mouse Zmpste24 gene; electrotransfecting the gene editing solution into mouse zygotes; culturing the electrotransfected zygotes into two-cell transplantation into pseudopregnant mice to obtain the Zmpste24 gene knockout mouse F0 generation; crossing the F0 generation mice with wild-type mice to obtain F1 generation heterozygous mice; crossing the F1 generation heterozygous mouse fathers and F1 generation heterozygous mouse mothers to obtain F2 generation homozygous mice; and obtaining the Zmpste24 gene knockout homozygous mouse model through phenotypic identification.

[0030] Specifically, the gRNA can be synthesized using methods known in the art.

[0031] Preferably, the gRNA used to target the mouse Zmpste24 gene is the gRNA of the Zmpste24 gene obtained after screening and confirming the knockout efficiency using mouse cells.

[0032] Preferably, the screening of knockout efficiency using mouse cells includes the following steps: constructing the designed gRNA into the vector backbone PX459, transfecting it into mouse cells with liposomes; and screening with puromycin to obtain gRNAs with high knockout efficiency as gRNAs of the Zmpste24 gene after screening confirmation.

[0033] Preferably, the mouse cells are B16 cells (mouse melanoma cells).

[0034] In a fifth aspect, the present invention provides a Zmpste24 gene knockout mouse model, which is obtained by the method for preparing the Zmpste24 gene knockout mouse model described above.

[0035] In a sixth aspect, the present invention provides a vector comprising: a vector backbone and the gRNA targeting the non-human animal Zmpste24 gene.

[0036] Preferably, the carrier skeleton includes any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the carrier skeleton is PX459.

[0037] In a seventh aspect, the present invention provides a cell, tissue, or organ derived from a non-human animal model obtained by the method for preparing the Zmpste24 gene knockout non-human animal model.

[0038] In an eighth aspect, the present invention provides a non-human animal model obtained by the method for preparing the Zmpste24 gene knockout non-human animal model, and the application of the cells, tissues or organs described therein in the study of the pathogenesis of progeria and the screening of anti-aging drugs.

[0039] In a ninth aspect of the present invention, a phenotypic identification method for a Zmpste24 gene knockout non-human animal model is provided, comprising: (1) genotyping: confirming the knockout of the Zmpste24 gene by PCR or sequencing; (2) growth curve detection: periodically measuring body weight; (3) appearance detection: observing body size and morphology; (4) aging score: based on multiple aging indicators of non-human animals, including reactivity, passivity, smoothness, roughness, hair loss, skin ulcers, periorbital injury, corneal opacity, cataracts, kyphosis, and corneal ulcers. Scale for scoring; each item is scored from 0 to 3 points, the higher the score, the higher the degree of aging; (5) Body composition detection: the ratio of muscle to fat is detected by dual-energy X-ray absorptiometry (DEXA); (6) Non-invasive in vivo imaging detection: the lens transparency is observed by slit lamp back illumination method, and corneal edge pannus and epithelial roughness are detected; (7) Grasp test: the muscle function decline and neuromuscular coordination of aging non-human animals are quantitatively assessed; (8) Data analysis: the data from (2) to (7) are integrated to assess the impact of Zmpste24 gene knockout on the aging process.

[0040] Preferably, in step (1), the genotype identification uses a specific primer pair, the sequences of which are shown in SEQ ID NO:5 and SEQ ID NO:6.

[0041] Preferably, in step (2), the growth curve is measured once a week for at least 8 weeks.

[0042] Preferably, in step (7), the grip strength test includes at least one of forelimb grip strength, quadrupedal grip strength, and hindlimb grip strength.

[0043] Preferably, in step (8), the data analysis includes statistical comparisons (such as t-tests or ANOVA) with age-matched wild-type non-human animals and naturally aged wild-type non-human animals.

[0044] Preferably, it also includes histopathological analysis: taking samples of heart, liver or skeletal muscle for HE staining or immunohistochemical staining.

[0045] In a tenth aspect of the present invention, a method for phenotypic identification of Zmpste24 gene knockout mice is provided, comprising: (1) genotyping: confirming Zmpste24 gene knockout homozygous mice by PCR or sequencing; genotyping uses specific primer pairs, the sequences of which are shown in SEQ ID NO:5 and SEQ ID NO:6; (2) growth curve detection: periodically measuring the weight of Zmpste24 gene knockout homozygous mice aged 3-12 weeks and wild-type mice aged 3-12 weeks; the measurement frequency is once a week for at least 8 weeks; (3) appearance detection: observing Zmpste24 gene knockout 12-week-old homozygous mice (Zmpste24- / - 12w), 12-week-old wild-type mice (wt 12w), and 20-month-old wild-type mice (wt (20m) body size and shape; (4) Aging score: A scoring table was developed based on 11 aging indicators of mice, including reactivity, passivity, smoothness, roughness, hair loss, skin ulcers, periorbital damage, corneal opacity, cataracts, kyphosis and corneal ulcers, with each item scored from 0 to 3 points. The Zmpste24 gene knockout 12-week-old homozygous mice, 12-week-old wild-type mice and 20-month-old wild-type mice (wt20m, naturally aging mice) were scored; (5) Body composition detection: The muscle, water and fat of Zmpste24 gene knockout 12-week-old homozygous mice, 12-week-old wild-type mice and 20-month-old wild-type mice were detected by dual-energy X-ray absorptiometry (DEXA). (6) Non-invasive in vivo imaging detection: The lens transparency was observed by slit-lamp back-illumination method. The corneal limbal pannus and epithelial roughness of Zmpste24 gene knockout homozygous mice, 12-week-old wild-type mice and 20-month-old wild-type mice were detected. (7) Grasp test: The muscle function decline and neuromuscular coordination of Zmpste24 gene knockout homozygous mice, 12-week-old wild-type mice and 20-month-old wild-type mice were quantitatively assessed. (8) Data analysis: The above data were integrated to evaluate the effect of Zmpste24 gene knockout on the aging process. (9) Histopathological analysis: The heart, liver or skeletal muscle were taken for HE staining or immunohistochemical staining.

[0046] This invention offers at least the following beneficial effects: It ensures functional knockout by precisely targeting the second exon of non-human animals, establishes a standardized phenotypic evaluation process, and for the first time achieves a systematic comparison between gene-edited premature aging models and natural aging. It also establishes a homozygous non-human animal model of Zmpste24 gene knockout. The non-human animal model constructed using this method is simple, easy to implement, and has a short cycle, allowing for thorough research into the pathogenic mechanisms of the Zmpste24 gene in aging and other diseases, and providing a basis for further development of treatments for these diseases. Furthermore, this invention establishes a multi-dimensional phenotypic identification system for assessing the impact of gene knockout on the aging process. Attached Figure Description

[0047] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0048] Figure 1 shows the efficiency of Zmpste24 gene knockout gRNA.

[0049] Figure 2 shows the genotype identification of F2 generation Zmpste24- / - mice.

[0050] Figure 3 shows a comparison of the body size of Zmpste24- / - and wt mice.

[0051] Figure 4 shows the growth curves of Zmpste24 - / - mice and wt mice from 3 to 12 weeks of age.

[0052] Figure 5 shows a comparison of aging scores among 12-week-old homozygous mice (Zmpste24- / - 12w), 12-week-old wild-type mice (wt 12w), and 20-month-old wild-type mice (wt 20m).

[0053] Figure 6 shows a comparison of limb grip strength among 12-week-old homozygous mice (Zmpste24- / - 12w), 12-week-old wild-type mice (wt 12w), and 20-month-old wild-type mice (wt 20m).

[0054] Figure 7 shows a comparison of body composition of 12-week-old homozygous mice (Zmpste24- / - 12w), 12-week-old wild-type mice (wt 12w), and 20-month-old wild-type mice (wt 20m).

[0055] Figure 8 shows a comparison of non-invasive in vivo imaging of 12-week-old homozygous mice (Zmpste24- / - 12w), 12-week-old wild-type mice (wt 12w), and 20-month-old wild-type mice (wt 20m). Detailed Implementation

[0056] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0057] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0058] definition The term "CRISPR / Cas9" as used in this article refers to an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technique for specifically modifying the DNA of target genes. CRISPR / Cas9-based gene editing technology has shown great promise in a range of gene therapy applications, such as hematological diseases, cancer, and other genetic disorders. This technology has already been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0059] The terms “gRNA,” “guide RNA,” and “CRISPR guide sequence” used herein are used interchangeably and refer to nucleic acids containing sequences that determine the specificity of Cas-binding proteins in the CRISPR / Cas system. The gRNA hybridizes (partially or completely complementary) to a target nucleic acid sequence in the host cell genome. The length of the gRNA or a portion thereof that hybridizes to the target nucleic acid can be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.

[0060] As used herein, the term "sgRNA" generally refers to single-molecule guide RNA or single-stranded guide RNA in artificial CRISPR / Cas9 systems. It is the RNA that guides the Cas protein to specifically bind to the target DNA sequence and is an important component of CRISPR gene knockout / knock-in systems. The sgRNA of this application contains a guide sequence that targets the target sequence. In a preferred embodiment, the sgRNA of this application further contains a tracr sequence and a tracr chaperone sequence.

[0061] As used herein, the term "gene knockout" or "knockout" refers to editing a gene in a cell (e.g., modifying it by insertion, substitution, and / or deletion) to cause the gene to lose its original function (e.g., to be unable to express a functional protein). Various known molecular biology techniques (e.g., gene editing using zinc finger nucleases, TALEN gene editing, and CRISPR / Cas (e.g., CRISPR / Cas9) gene editing) can be used to edit genes in the cellular genome. Gene knockout is not limited to the complete deletion or removal of an entire gene, but only to the loss of its original function. For example, gene knockout can be achieved by inserting a foreign DNA fragment into the gene, preventing it from expressing a functional protein, or by inserting or deleting one or more bases into the gene, causing a frameshift mutation. For example, the gene knockout described in this application can utilize CRISPR / Cas9 gene editing technology.

[0062] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to: plasmids; bacteriophages; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages, such as λ phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to: retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including but not limited to: promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.

[0063] As used in this paper, the term "delivery" refers to the introduction of biological macromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. Examples include electroporation, liposome transfection, lipid-nanoparticle delivery, viral delivery, and exosome delivery. The term "electroporation" as used in this paper refers to a technique that uses a high-voltage electrical pulse to briefly alter cell membrane permeability, thereby efficiently introducing exogenous molecules (such as DNA, RNA, and proteins) into the cell.

[0064] The term "body composition analysis" as used in this article refers to a detection technique that quantitatively determines the content, distribution, and proportion of various components within an organism using specific technical methods. Its core is the systematic classification and quantitative assessment of the body's constituent substances, primarily including adipose tissue (white fat, brown fat), lean tissue (skeletal muscle, smooth muscle, cardiac muscle, etc.), and water (intracellular fluid, extracellular fluid).

[0065] Non-invasive in vivo imaging detection refers to a method that uses optical, acoustic, electromagnetic and other technical means to visualize and quantitatively analyze the physiological, pathological or molecular processes of live animals (such as mice) in real time and dynamically without damaging the tissues or organs of the organism.

[0066] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0067] Example Instruments used in this experiment: Electrophoresis apparatus (BiO-RAD, PowerPac™ Basic), ultra-micro spectrophotometer (Dinghaoyuan, NanoPro2010), ProFlex PCR System (Thermo Fisher Scientific, ProFlex 3×32 well PCR system), chemiluminescence gel imaging analysis system (Bio-Rayet, Universal HoodⅡ), precision constant temperature incubator (Yiheng, BPH-9162), snowflake ice maker (Xiamen Guoyi, GYXH-35), high-speed refrigerated centrifuge (Thermo Fisher Scientific, Sorvall Legend Micro 21R), stereomicroscope (Olympus, SZX7), electroporator (BEX, CUY21 EDIT) II), Inverted fluorescence microscope (Olympus, IX73), gripping force tester (Shanghai Xinruan, XR501), slit lamp (Rixin Guanxue Instrument Components, LYL-S), conscious animal body composition analyzer (Suzhou Nuomai, QMR06-090H), carbon dioxide constant temperature incubator (Reward, D180-P), constant temperature low speed centrifuge (Eppendorf, 5702R), inverted fluorescence microscope (Olympus, IX51), constant temperature water bath (Shanghai Senxin, DKS24), cell counter (Reward, C100), double-person biosafety cabinet (Shandong Boke, BSC-1360IIA2).

[0068] Reagents used in this experiment: BPII (Thermo Fisher Scientific, ER0291), T4 DNA Ligase kit (Solepro, T1410), MinElute PCR Purification Kit (QIAGEN, 2084), Phanta Max Super-Fidelity DNA Polymerase (Novazia, P505), MinElute PCR Purification Kit. Kit (Käger, Germany, 28004), hyaluronidase (Nanjing Aibei, M2215), M2 culture medium (Sigma, M7167), M16 culture medium (Sigma, R-010), tissue culture oil (Beijing Jinming SAGE, M10037ARF-4008P-5P), pregnant mare serum gonadotropin (PMSG) (Ningbo Sansheng Biotechnology), human chorionic gonadotropin (hCG) (Ningbo Sansheng Biotechnology), PBS solution (Solepro, P1010), small-volume medium-volume kit (TIANGEN, DP118), agarose rapid gel extraction kit (Generay, GK7045-200), PCR product purification kit (Generay, GK2052-100), 5 min TA / Blunt-Zero Cloning Kit (Novazia, C601), serum (Anwei, F0601), penicillin and streptomycin (Pusitan, PS0526), ​​transfection reagent (Beyotime, C0533), puromycin (Gibico, A11138), trypsin-EDTA (0.25%) (Thermo, 25200056), EnGen® Spy Cas9 NLS (NEB, M0646T).

[0069] 1 gRNA was designed at the second exon of the mouse Zmpste24 gene. Three gRNAs were designed for knockout, namely gRNA1, gRNA2 and gRNA3.

[0070] The target sequence of the second exon region of the mouse ZMPSTE24 gene is: AGAAGGATATACAAAACGACGACTCGCGTACCAGCAGAGTTAGAACAGATCATGGATTCGGACACGTTTGAGAAATCTCGATTGTATCAACTGGATAAAAGTACCTTCAGCTTCTGGTCAGGACTCTACTCAGAGGTGGAAGGCACT (SEQ ID NO: 4).

[0071] The sequence of gRNA1 is: GGACTCTACTCAGAGGTGGA (SEQ ID NO: 1).

[0072] The sequence of gRNA2 is: AGCAGGTTAGAACAGATCA (SEQ ID NO: 2).

[0073] The sequence of gRNA3 is: ATGATCTGTTCTAACTCTGC (SEQ ID NO: 3).

[0074] 2. Single nucleotide polymorphism (SNP) detection at target sites was performed using NCBI Primer-BLAST. A pair of primers containing all gRNAs was designed. Amplification using these primers required genome editing. The amplified products were then analyzed by 1% agarose gel electrophoresis. The results showed no single nucleotide mutations at the sgRNA locations. The sequence of the forward primer was: ACAACCCAGATGGCCATTCC (SEQ ID NO: 5), and the sequence of the reverse primer was: TAAAGGCTGGCACCTGAAGG (SEQ ID NO: 6).

[0075] 3. Plasmid Construction: The gRNA-F and gRNA-R synthesized by Qingke Company were mixed and annealed according to the procedure in Table 1; a suitable cloning site was selected, and the PX459 (SEQ ID NO: 7) vector was linearized by enzyme digestion method, and the enzyme digestion system is shown in Table 2; ligation was performed according to the enzyme ligation system in Table 3, the ligation product was transformed, plated, single clones were picked, and finally the successful construction of the vector PX459-gRNA was confirmed by bacterial PCR.

[0076] gRNA1-F: CACCGGACTCTACTCAGAGGTGGA (SEQ ID NO: 8); gRNA1-R: AAACTCCACCTCTGAGTAGAGTCC (SEQ ID NO: 9); gRNA1-F and gRNA1-R anneal to produce sticky ends and link with sticky ends on PX459 to form PX459-gRNA1.

[0077] gRNA2-F: CACCGAGCAGAGTTAGAACAGATCA (SEQ ID NO: 10); gRNA2-R: AAACTGATCTGTTCTAACTCTGCTC (SEQ ID NO: 11); gRNA2-F and gRNA2-R anneal to produce sticky ends and link with sticky ends on PX459 to form PX459-gRNA2.

[0078] gRNA3-F: CACCGATGATCTGTTCTAACTCTGC (SEQ ID NO: 12); gRNA3-R: AAACGCAGAGTTAGAACAGATCATC (SEQ ID NO: 13); gRNA3-F and gRNA3-R anneal to produce sticky ends and link with sticky ends on PX459 to form PX459-gRNA2.

[0079] Table 1 gRNA annealing procedure

[0080] Table 2. Enzyme digestion system of px459 vector

[0081] Table 3 Enzyme ligation system

[0082] 4. Vector Efficiency Identification: PX459-gRNA1+PX459-gRNA2 and PX459-gRNA1+PX459-gRNA3 vectors were mixed at a 1:1 ratio and transfected into mouse melanoma cells (B16). After 48 hours, puromycin was added for selection culture, and after another 48 hours, cells were extracted for PCR amplification. The PCR products were identified by 1% agarose gel electrophoresis. The results showed that PX459-gRNA1+PX459-gRNA3 knockout had a better knockout effect (Figure 1).

[0083] 5. Gene editing solution preparation: synthesize gRNA1 and gRNA3, and prepare gRNA mixture by mixing gRNA1 and gRNA3 in a molar ratio of 1:1; then mix EnGen® Spy Cas9 NLS and gRNA mixture in a molar ratio of 3:2 and add Opti-MEM culture medium by volume to prepare gene editing solution.

[0084] 6. Delivery of fertilized eggs using gene editing solution 6.1 Superovulation in female mice PMSG and hCG were diluted to 50 IU / ml and injected intraperitoneally into 4-week-old C57BL / 6J female mice at 10 IU / mouse. 48 hours after PMSG injection, hCG was injected intraperitoneally at 10 IU / mouse. Immediately after hCG injection, the mice were paired with male mice, with one male mouse paired with one female mouse.

[0085] 6.2 Preparation of Culture Drops: Hyaluronidase Digestion Drops: Prepare one 200 μL hyaluronidase drop in a 35 mm culture dish, and prepare five 50 μL M2 culture drops around it. Cover with mineral oil and preheat at 37°C overnight. M2 Culture Drops: Prepare one 100 μL M2 culture drop in a 35 mm culture dish, cover with mineral oil, and preheat at 37°C overnight.

[0086] 6.3 Electrotransfection: The morning after mating, examine the vaginal plug and remove the female mouse with the plug. Euthanize the female mouse by cervical dislocation, dissect its back to expose the uterus, oviduct, and ovary, and remove the oviduct. Remove fat and blood from the oviduct on paper. Tear the dilated part of the oviduct in a digestive oil drop and pull the oocytes containing cumulus cells into hyaluronidase. Wait 1-2 minutes and shake the culture dish clockwise 8-10 times. After digestion, collect the oocytes and wash them three times in M2 culture drop, then culture in M2 medium for at least 2 hours, ready for electrotransfection. Add 5 μL of gene editing solution to the gap between the platinum plates of the electrodes. Simultaneously, transfer the fertilized oocytes to Opti-MEM culture medium, wash them three times, and then transfer them to gene editing solution for electrotransfection. After electroporation, the fertilized eggs were washed three times with M2 culture medium and then transferred to M2 culture drops. They were cultured overnight at 37°C in a 5% CO2 incubator until they reached the two-cell stage. The next day, the cells were transplanted into the oviducts of surrogate mice. The tails of the mice were collected for identification after birth.

[0087] 7. Genotypic and Phenotypic Identification of Zmpste24 Gene Mice vs. Wild-Type Mice 7.1 Genotypic Identification of Zmpste24 Gene Mice vs. Wild-Type Mice Tissue samples were taken from the 0.5 cm tail tip of F2 generation homozygous mice (5 days old), and genomic DNA was extracted by lysis. Using the extracted DNA as a template, PCR amplification was performed targeting the flanking sequences of the Zmpste24 gene editing site using specific primer pairs (SEQ ID NO: 5 and SEQ ID NO: 6). The amplification products were separated by 1% agarose gel electrophoresis. The results are shown in Figure 2. Wild-type mice (WT or wt) showed only one band with a size of 484 bp, heterozygous mice showed two bands, one 484 bp and the other 427 bp, and homozygous mice showed only one band with a size of 427 bp. Zmpste24 gene homozygous knockout mice (Zmpste24- / -) were successfully obtained.

[0088] 7.2 Phenotypic Identification of Zmpste24 Gene Mice vs. Wild-Type Mice 7.2.1 Appearance Examination Appearance examination was performed on F2 generation mice at 12 weeks of age, and the results are shown in Figure 3. Compared to wild-type mice, Zmpste24- / - mice were smaller in size, exhibited poor passivity, and showed a weakened escape response when pinched; their skin and hair showed reduced luster, and ulcers appeared on the skin except around the eyes; their eyes showed a rough corneal surface with changes in opacity visible under direct ophthalmoscopy, with ulceration of the entire cornea and almost no transparent portion with visible iris; the changes in mucositis around the eyelids extended further; their spine showed visibly kyphotic deformity, with unnatural forward and backward bending when pressure was applied to the back, and the phenomenon of increased curvature disappearing when pressure was applied to the back disappeared.

[0089] 7.2.2 Growth Curves Zmpste24- / - and wt mice were weighed weekly for 3 weeks after birth. The results are shown in Figure 4. Compared with wild-type mice, Zmpste24- / - mice showed statistically significant differences in weight from 3 weeks of age, reaching a plateau at 8 weeks of age. From 3 to 12 weeks of age, the weight growth rate was significantly lower than that of wild-type mice. This weight loss is consistent with the growth retardation characteristics of human progeria patients.

[0090] 7.2.3 Aging Score: The impact of gene knockout on the aging process in mice was assessed using an 11-item phenotypic scoring system, including reactivity, passivity, smoothness, roughness, hair loss, skin ulceration, periocular damage, corneal opacity, cataract, kyphosis, and corneal ulceration. The scoring results showed that, compared to the wt 12w group, the Zmpste24- / - and wt 20m groups exhibited significantly higher cumulative defect scores. Specifically, the severity of core indicators such as kyphosis, corneal opacity, and spontaneous mobility was significantly aggravated, confirming that gene deletion triggered a synergistic decline in multiple physiological functions, ultimately leading to a premature onset of overall frailty, similar to the symptoms in naturally aging mice (Figure 5).

[0091] 7.2.4 Grasping Force: At 12 weeks of age, the gripping force of Zmpste24- / - and wt mice in different groups was measured. The results are shown in Figure 6. Compared with wild-type mice, the gripping force of Zmpste24- / - mice was significantly reduced. The reduction in gripping force was highly consistent with the myasthenia gravis phenotype of human progeria patients.

[0092] 7.2.5 Body composition: Body composition of Zmpste24- / - and wt mice was measured at 12 weeks of age. The results are shown in Figure 7. Compared with wild-type mice, Zmpste24- / - mice showed significant abnormalities in body composition, mainly manifested as a decrease in lean body content. The body composition of the Zmpste24- / - group at 12 weeks of age was equivalent to that of the wt group at 20 weeks of age. The decrease in lean body content suggests the early occurrence of sarcopenia.

[0093] 7.2.6 Non-invasive in vivo imaging: At 12 weeks of age, non-invasive in vivo imaging was performed on Zmpste24- / - and wt mice. The results are shown in Figure 8. The degree of eye damage in Zmpste24- / - and wt 20m mice was similar. Compared with the eyes of normal wt 12w mice, the corneal surface was rough and opaque under direct ophthalmoscopy. The entire cornea was ulcerated, and there was almost no transparent part with visible iris. The changes in mucositis in the periorbital area extended further.

[0094] In summary, the Zmpste24 gene knockout mice prepared in this invention exhibit slow weight gain and show significant aging phenotypes at 12 weeks of age, including severe spinal curvature, corneal opacity, and motor dysfunction, accompanied by metabolic abnormalities such as muscle loss and increased fat percentage. The Zmpste24 gene knockout mouse model of this invention can serve as an important tool for studying the mechanisms of aging and for screening anti-aging drugs. It has advantages such as significant phenotypes, good reproducibility, and short experimental cycle, providing a new experimental platform for aging-related research and drug development.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gRNA targeting the Zmpste24 gene in non-human animals, characterized in that, The gRNA contains a nucleotide sequence complementary to the second exon region of the non-human animal Zmpste24 gene; the target sequence of the second exon region of the non-human animal Zmpste24 gene is shown in SEQ ID NO: 4; the gRNA includes gRNA1 shown in SEQ ID NO: 1 and gRNA3 shown in SEQ ID NO: 3, with a molar ratio of (1~5):(1~5) for gRNA1 and gRNA3.

2. A method for preparing a Zmpste24 gene knockout non-human animal model, characterized in that, The procedure includes the following steps: using gene editing technology to disrupt the second exon region of the non-human animal Zmpste24 gene; wherein the target sequence of the second exon region of the non-human animal Zmpste24 gene is shown in SEQ ID NO: 4; the gRNA used to target the non-human animal Zmpste24 gene includes gRNA1 shown in SEQ ID NO: 1 and gRNA3 shown in SEQ ID NO: 3, and the molar ratio of gRNA1 to gRNA3 is (1~5):(1~5).

3. The method for preparing a Zmpste24 gene knockout non-human animal model according to claim 2, characterized in that, The process includes the following steps: preparing a gene editing solution containing Cas9 protein and gRNA1 and gRNA3 for targeting the Zmpste24 gene in non-human animals; delivering the gene editing solution into non-human animal fertilized eggs; culturing the delivered fertilized eggs and transplanting them into pseudopregnant non-human animals to obtain a Zmpste24 gene knockout non-human animal model.

4. The method for preparing a Zmpste24 gene knockout non-human animal model according to claim 3, characterized in that, The molar ratio of Cas9 protein, gRNA1 and gRNA3 in the gene editing solution is (2~3):(1~5):(1~5).

5. A method for phenotypic identification of a Zmpste24 gene knockout non-human animal model, characterized in that, include: (1) Genotyping: The knockout of the Zmpste24 gene was confirmed by PCR or sequencing. (2) Growth curve detection: Weight was measured regularly. (3) Appearance detection: Body size and shape were observed. (4) Aging score: A scoring table was developed based on multiple aging indicators of non-human animals, including reactivity, passivity, smoothness, roughness, hair loss, skin ulcers, periorbital damage, corneal opacity, cataracts, kyphosis and corneal ulcers. (5) Body composition detection: The ratio of muscle to fat was detected by dual-energy X-ray absorptiometry. (6) Non-invasive in vivo imaging detection: Lens transparency was observed by slit-lamp back-illumination method, and corneal marginal pannus and epithelial roughness were detected. (7) Grasp test: The muscle function decline and neuromuscular coordination of aging non-human animals were quantitatively assessed. (8) Data analysis: Data from (2) to (7) were integrated to assess the impact of Zmpste24 gene knockout on the aging process.

6. The phenotypic identification method for the Zmpste24 gene knockout non-human animal model according to claim 5, characterized in that, In step (1), the genotype identification uses specific primer pairs, the sequences of which are shown in SEQ ID NO:5 and SEQ ID NO:

6.

7. The phenotypic identification method for the Zmpste24 gene knockout non-human animal model according to claim 5, characterized in that, It also includes histopathological analysis: taking samples of the heart, liver, or skeletal muscle for HE staining or immunohistochemical staining.

8. A carrier, characterized in that, include: The vector backbone and the gRNA targeting the non-human animal Zmpste24 gene as described in claim 1.

9. A cell, tissue, or organ, characterized in that, The cells, tissues, or organs are derived from non-human animal models obtained by the method for preparing the Zmpste24 gene knockout non-human animal model as described in any one of claims 2-4.

10. The application of the non-human animal model obtained by the method for preparing the Zmpste24 gene knockout non-human animal model according to any one of claims 2-4, and the cell, tissue or organ according to claim 9, in the study of the pathogenesis of progeria and the screening of anti-aging drugs.