Method for producing antiangiogenesis agent RT-X in colibacillus and application of antiangiogenesis agent RT-X

Abstract

The invention relates to the technical field of bio-engineering and pharmaceuticals, in particular to a process for producing targeting anti-tumor antiangiogenesis fusion protein RT-X in colibacillus as well as a separation and purification method for the fusion protein RT-X. The fusion protein RT-X is soluble, has biological activity, and comprises RGD and Maspin protein. Through the adoption of the expressed and purified antiangiogenesis agent RT-X with the biological activity, endotheliocyte can be inhibited from migration according to specificity and dose dependence, and an effect for inhibiting angiogenesis is realized in a chicken embryo chorioallantoic membrane animal experiment. The process and the separation and purification method are applicable to research in bio-engineering pharmacy and gene engineering, biochemistry, molecular biology and other fields.

Description

Technical field:

[0001] The invention relates to the technical fields of bioengineering and medicine, in particular to a process and a separation and purification method for producing a soluble and biologically active fusion protein RT-X with targeting anti-tumor blood vessel inhibition in Escherichia coli. Background technique:

[0002] In recent years, with the in-depth study of tumor anatomy and molecular biology, people have gradually realized that angiogenesis plays a key role in the growth and metastasis of solid tumors. Since Algureza proposed the concept of tumor-induced angiogenesis in 1947, until 1971, folkman clearly proposed the theory that tumor growth and metastasis depend on new angiogenesis. New blood vessels not only provide the necessary nutrients and oxygen for tumor growth, but also help eliminate metabolites , or the way of its distant metastasis (Folkman, J. What is the evidence that tumors are angiogenesis dependent J. Natl. Cancer Inst. 1990: 82: 4-6)...

Examples

Embodiment 1

[0083] Example 1 Cloning, expression, separation and purification of the vascular inhibitor RT-X gene

[0084] The Maspin gene refers to the cDNA sequence of Maspin (Genbank sequence number: AY893387.1), and the gene sequence is shown in SEQ ID NO:5;

[0085] ATGGATGCCCTGCAACTAGCAAATTCGGCTTTTGCCGTTGATCTGTTCAAACAACTATGTGAAAAGGAGCCACTGGGCAATGTCCTCTTCTCTCCAATCTGTCTCTCCACCTCTCTGTCACTTGCTCAAGTGGGTGCTAAAGGTGACACTGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCCTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTCCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCCACGTTCTGTATGGGAAACATTGACAGTATCAATTGTAAGATCATAGAGCTTCCTTTTCAAAATAAGCATCTCAGCATGTTCATCCTACTACCCAAGGATGTGGAGGATGAGTCCACAGGCTTGGAGA...

Embodiment 2

[0105] Example 2 Analysis of biological activity of fusion protein RT-X

[0106] 1. Endothelial Cell Migration Assay

[0107] Matrigel preparation: place the matrigel frozen at -80°C at 4°C overnight to become liquid; take 150 μL of Matrigel, coat the upper chamber of the Transwell (operated on ice), put it in a 37°C incubator, and incubate for 1 hour; digest HUVEC cells were washed 3 times in serum-free medium, counted, and made into 2×10 6 Cell suspension; wash Matrigel-coated Transwell once with serum-free medium; add 100 μL cell suspension to each well; add 600 μL conditioned medium containing 20% ​​FBS to the lower chamber of Transwell; incubate at 37°C for 48 hours; take out Wash 2 times with PBS, wipe off the upper surface cells with cotton balls, fix with neutral formaldehyde for 10 minutes; add crystal violet (0.1%) to stain for 10 minutes, wash 2 times with PBS at room temperature, observe and take pictures under a microscope. Count the number of positively stained...

Technical field:

[0001] The invention relates to the technical fields of bioengineering and medicine, in particular to a process and a separation and purification method for producing a soluble and biologically active fusion protein RT-X with targeting anti-tumor blood vessel inhibition in Escherichia coli. Background technique:

[0002] In recent years, with the in-depth study of tumor anatomy and molecular biology, people have gradually realized that angiogenesis plays a key role in the growth and metastasis of solid tumors. Since Algureza proposed the concept of tumor-induced angiogenesis in 1947, until 1971, folkman clearly proposed the theory that tumor growth and metastasis depend on new angiogenesis. New blood vessels not only provide the necessary nutrients and oxygen for tumor growth, but also help eliminate metabolites , or the way of its distant metastasis (Folkman, J. What is the evidence that tumors are angiogenesis dependent J. Natl. Cancer Inst. 1990: 82: 4-6)...

Examples

Embodiment 1

[0083] Example 1 Cloning, expression, separation and purification of the vascular inhibitor RT-X gene

[0084] The Maspin gene refers to the cDNA sequence of Maspin (Genbank sequence number: AY893387.1), and the gene sequence is shown in SEQ ID NO:5;

[0085] ATGGATGCCCTGCAACTAGCAAATTCGGCTTTTGCCGTTGATCTGTTCAAACAACTATGTGAAAAGGAGCCACTGGGCAATGTCCTCTTCTCTCCAATCTGTCTCTCCACCTCTCTGTCACTTGCTCAAGTGGGTGCTAAAGGTGACACTGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCCTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTCCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCCACGTTCTGTATGGGAAACATTGACAGTATCAATTGTAAGATCATAGAGCTTCCTTTTCAAAATAAGCATCTCAGCATGTTCATCCTACTACCCAAGGATGTGGAGGATGAGTCCACAGGCTTGGAGA...

Embodiment 2

[0105] Example 2 Analysis of biological activity of fusion protein RT-X

[0106] 1. Endothelial Cell Migration Assay

[0107] Matrigel preparation: place the matrigel frozen at -80°C at 4°C overnight to become liquid; take 150 μL of Matrigel, coat the upper chamber of the Transwell (operated on ice), put it in a 37°C incubator, and incubate for 1 hour; digest HUVEC cells were washed 3 times in serum-free medium, counted, and made into 2×10 6 Cell suspension; wash Matrigel-coated Transwell once with serum-free medium; add 100 μL cell suspension to each well; add 600 μL conditioned medium containing 20% ​​FBS to the lower chamber of Transwell; incubate at 37°C for 48 hours; take out Wash 2 times with PBS, wipe off the upper surface cells with cotton balls, fix with neutral formaldehyde for 10 minutes; add crystal violet (0.1%) to stain for 10 minutes, wash 2 times with PBS at room temperature, observe and take pictures under a microscope. Count the number of positively stained...

Images