Plant material classification method

Abstract

The present invention describes a method for classifying a batch of plant materials as contaminated or uncontaminated, comprising: (i) providing a polynucleotide sample from the batch of plant materials; (ii) contacting the polynucleotide sample with one or more amplification primers to amplify a target polynucleotide sequence associated with sterility; (iii) performing an in vitro polynucleotide amplification reaction on the sample to generate one or more amplification products; (iv) determining the size or sequence of the one or more amplification products; and (v) based on the size or sequence of the one or more amplification products determined in step (iv), comparing the size or sequence of the one or more amplification products with the size or sequence of one or more amplification products known from a known genetic source of sterility; wherein if the sterility genetic source determined in step (v) corresponds to the expected sterility genetic source of the batch of plant materials, the batch of plant materials is considered to be uncontaminated; or wherein if the sterility genetic source determined in step (v) does not correspond to the expected sterility genetic source of the batch of plant materials, the batch of plant materials is considered to be contaminated.

Description

Technical Field

[0001] The present disclosure generally relates to classifying a batch of plant materials as contaminated or uncontaminated. The classification is based on the analysis of one or more polynucleotide sequences associated with sterility. By performing the methods described herein, it can be determined whether a batch or batches of plant materials are contaminated or uncontaminated to ensure the quality or integrity of the plant materials. In particular, the present disclosure makes it easy to determine whether a batch of plant materials has been adulterated. Background Art

[0002] The tobacco seeds of commercial preparation are sold to farmers for their planting of tobacco plants. In order to ensure the quality of produced tobacco, it is usually expected that the producer of seed can test tobacco plants or the tobacco product derived from it, to check that it originates from the tobacco seeds that provide farmers. The seed producer also expects to check that the tobacco plants sold or the tobacco product are not polluted or mixed from the tobacco of other seed sources, and is obtained fully by the seed of supply. This helps to ensure the quality of tobacco plants or the tobacco product derived from it. For example, the tobacco batch or batches that comprise the tobacco of any tobacco seed of the tobacco that derives from the tobacco seeds of commercial preparation sold to farmers may be of poor quality, thereby may have to discard.

[0003] There is a need in the art for tests that can be used to check the quality or adulteration of plant material (such as tobacco material) or products derived therefrom. In particular, there is a need in the art for simplified methods that can be used at any stage of plant product production that are suitable for high throughput analysis. Summary of the invention

[0004] Commercially prepared tobacco seeds are usually sold in non-fertile form.Cytoplasmic male sterility (CMS) is the main mode of producing non-fertile tobacco plants for commercial use, and is the common genetic source of sterility.CMS is produced by transferring the nuclear genome of common tobacco (Nicotiana tabacum) to the cytoplasm of the species of the same genus via backcrossing.Commercially, the most abundant sterility source is derived from the cytoplasm of sweet tobacco (Nicotiana suaveolens) or the cytoplasm of powder blue tobacco (Nicotiana glauca).The present disclosure provides by analyzing at least one (or only one) polynucleotide sequence with polymorphism between the plant species or variety to be subjected to analysis, so that the method that fertile plant material can be easily distinguished from sterile plant material, the plant species or variety at least such as common tobacco, sweet tobacco and powder blue tobacco.If the fertility of the analysis result indication plant material does not meet expectations, then show that the plant material has been contaminated or doped, and for example is unqualified. In some embodiments, the polynucleotide sequence of the present invention can be used for the plant material of the present invention.This distinction can be realized, and reason is that some polynucleotide sequences associated with sterility in some plant species have different polymorphisms (for example, disappearance or addition) therein, so that the size of the polynucleotide sequence of each amplification or the difference of sequence allow the species that these polynucleotide sequences are derived from to be identified.In certain embodiments, common tobacco cytoplasm (fertile material) can be distinguished from sweet tobacco cytoplasm (sterile material) or powder blue tobacco cytoplasm (sterile material).According to the result of this analysis, if the sterility genetic source of sterility corresponds to the sterility genetic source of the expection of this batch of plant material being tested, then think that this batch of plant material is uncontaminated or unadulterated (for example, qualified), because there is no sign that this plant material has been polluted by the plant material containing different sterility genetic sources.If the sterility genetic source of sterility does not correspond to the sterility genetic source of the expection of this batch of plant material, then think that this batch of plant material is contaminated or doped (for example, unqualified), because there is sign that this plant material has been polluted or doped by the plant material containing different sterility genetic sources. In some cases, the genetic source of sterility may not correspond to the expected genetic source of sterility of this batch of plant material, because the genetic source of sterility is undetectable. If it is found that this batch of plant material is uncontaminated (e.g., qualified), it can be expected that the plant material is free from contamination or adulteration, and the plant material derived therefrom will have expected quality or purity. If it is found that this batch of plant material is contaminated or adulterated (e.g., unqualified), it can be expected that the plant material has been contaminated by other plant materials, and the plant material derived therefrom will not have expected quality or purity. In this case, owing to the quality or purity of the plant material cannot be guaranteed, it may be necessary to discard or destroy it.

[0005] The present invention can be used to determine the fertility status in sterile hybrids, such as sterile tobacco hybrids. Thus, the present invention can be applied to classify sterile hybrids, such as sterile hybrid crops in farmers' fields.

[0006] In one aspect, a method for classifying a batch of plant materials as contaminated or uncontaminated is described, comprising: (i) providing a polynucleotide sample from the batch of plant materials; (ii) contacting the polynucleotide sample with one or more amplification primers to amplify a target polynucleotide sequence associated with sterility; (iii) performing an in vitro polynucleotide amplification reaction on the sample to generate one or more amplification products; (iv) determining the size or sequence of the one or more amplification products; and (v) based on the size or sequence of the one or more amplification products determined in step (iv), comparing the size or sequence of the one or more amplification products with the size or sequence of one or more amplification products known from a known genetic source of sterility; wherein if the genetic source of sterility determined in step (v) corresponds to the expected genetic source of sterility for the batch of plant materials, the batch of plant materials is considered to be uncontaminated; or wherein if the genetic source of sterility determined in step (v) does not correspond to the expected genetic source of sterility for the batch of plant materials, the batch of plant materials is considered to be contaminated.

[0007] Suitably, the target polynucleotide sequence associated with sterility is a polynucleotide sequence associated with cytoplasmic male sterility.

[0008] Suitably, the presence of a polynucleotide sequence associated with sterility from Nicotiana tabacum, Nicotiana nicotiana, Nicotiana bigelovii, Nicotiana plumbaginifolia, Nicotiana megalosiphon or Nicotiana undulata indicates that the plant material is sterile; suitably, wherein the polynucleotide sequence associated with sterility from Nicotiana tabacum or Nicotiana nicotiana indicates that the plant material is sterile.

[0009] Suitably, the target polynucleotide sequence associated with sterility is from a chloroplast or a mitochondria.

[0010] Suitably, the target polynucleotide sequence associated with sterility is an intergenic spacer, suitably wherein the intergenic spacer is a chloroplast or mitochondrial intergenic spacer.

[0011] Suitably, the chloroplast intergenic spacer is selected from the group consisting of: trnH-psbA chloroplast intergenic spacer, trnL-trnF chloroplast intergenic spacer, ndhC-trnV chloroplast intergenic spacer, petA-psbJ chloroplast intergenic spacer, petN-psbM chloroplast intergenic spacer, psbE-petL chloroplast intergenic spacer, psbM-trnD chloroplast intergenic spacer, rbc1-acc D chloroplast intergenic spacer, rpoD-trnC chloroplast intergenic spacer, rps16-trnQ chloroplast intergenic spacer, trnS-trnG chloroplast intergenic spacer, trnT-psbD chloroplast intergenic spacer, trnW-psaJ chloroplast intergenic spacer or ycf1 chloroplast intergenic spacer, or a combination of two or more thereof, suitably, wherein the trnH-psbA chloroplast intergenic spacer comprises or consists of the sequence shown in SEQ ID NO:1, or the trnL-trnF chloroplast intergenic spacer comprises or consists of the sequence shown in SEQ ID NO:5.

[0012] Suitably, the plant material to be classified is Nicotiana tabacum plant material.

[0013] Suitably, the plant material to be classified is Nicotiana tabacum plant material and wherein the desired genetic source of sterility is cytoplasmic male sterility from Nicotiana tabacum, Nicotiana truncatum, Nicotiana indica, Nicotiana curcuma, Nicotiana magloire or Nicotiana wavyleaf, suitably from Nicotiana tabacum or Nicotiana truncatum.

[0014] Suitably, the batch of plant material to be sorted is common tobacco plant material, and wherein the expected genetic origin of sterility is cytoplasmic male sterility from sweet tobacco, and wherein if the genetic origin of sterility determined in step (v) corresponds to cytoplasmic male sterility from sweet tobacco, the batch of plant material is considered to be uncontaminated; or wherein if the genetic origin of sterility determined in step (v) does not correspond to cytoplasmic male sterility from sweet tobacco, the batch of plant material is considered to be contaminated.

[0015] Suitably, the batch of plant material for inspection is common tobacco plant material, and wherein the expected genetic origin of sterility is cytoplasmic male sterility from Nicotiana tabacum, and wherein if the genetic origin of sterility determined in step (v) corresponds to cytoplasmic male sterility from Nicotiana tabacum, the batch of plant material is considered to be uncontaminated; or wherein if the genetic origin of sterility determined in step (v) does not correspond to cytoplasmic male sterility from Nicotiana tabacum, the batch of plant material is considered to be contaminated.

[0016] Suitably, the plant material is selected from the group consisting of seedlings, seeds, plants, plant parts, harvested plant material, mature plant material or a combination of two or more thereof.

[0017] Suitably, the size of the amplification product is determined using gel electrophoresis, suitably agarose gel electrophoresis or two-dimensional gel electrophoresis or capillary electrophoresis; and / or

[0018] The sequence of the amplified product was determined using polynucleotide sequencing.

[0019] Also disclosed is a method for classifying a batch of plant material as contaminated or non-contaminated comprising using one or more amplification primers specific for a polynucleotide sequence associated with sterility.

[0020] Also disclosed is the use of two or more amplification primers specific for a polynucleotide sequence associated with sterility for classifying a batch of plant material as contaminated or non-contaminated.

[0021] Suitably, the plant material is sterile hybrid plant material, such as sterile hybrid tobacco material.

[0022] Some advantages

[0023] Advantageously, the present invention provides for conformity or quality checks at any stage of the tobacco production process, including polynucleotides extracted from seeds or seedlings prior to field transplantation; polynucleotides extracted from plants grown in the field; and / or polynucleotides extracted from harvested material in a curing room or at a purchasing station.

[0024] The target polynucleotide sequence associated with sterility (such as the intergenic spacer) has a different sequence in each of, for example, common tobacco, sweet tobacco, and powder blue tobacco, and this difference in sequence can be used to create a simple test to distinguish common tobacco cytoplasm (fertile material) from common tobacco cytoplasm (sterile material), sweet tobacco cytoplasm (sterile material), or powder blue tobacco cytoplasm (sterile material). Based on the results of this analysis, it can be easily determined whether a batch or batches of plant material are contaminated or adulterated, or are uncontaminated.

[0025] The method described herein does not require the use of a restriction endonuclease digestion step to distinguish one or more amplification products. This can make the method faster and simpler.

[0026] Additionally, the methods described herein are readily adaptable for high throughput analysis using, for example, capillary electrophoresis.

[0027] Advantageously, short polynucleotide fragments can be amplified so that plant materials containing degraded polynucleotides can be analyzed, because polynucleotides are usually broken into short fragments in processed plant materials (such as mature plant materials). Suitably, these short polynucleotide fragments are 500 base pairs or less. DETAILED DESCRIPTION

[0028] The section headings used in this disclosure are for organizational purposes and are not intended to be limiting.

[0029] definition

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art. In the event of a conflict, the present document (including definitions) shall prevail. Preferred methods and materials are described below, but methods and materials similar or equivalent to those described herein can be used to implement or test the present invention. The materials, methods, and examples disclosed herein are merely illustrative and are not intended to be limiting.

[0031] As used herein, the terms "comprises," "including," "having / has," "may," "contain," and variations thereof are intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures.

[0032] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0033] The term "and / or" means (a) or (b) or both (a) and (b).

[0034] The present disclosure contemplates other embodiments "comprising," "consisting of," and "consisting essentially of" the embodiments or elements presented herein, whether or not explicitly stated.

[0035] "Amplification primers" are oligonucleotides used to amplify a target polynucleotide sequence, such as an intergenic spacer associated with sterility, for example, a chloroplast intergenic spacer associated with sterility. Thus, in certain embodiments, the one or more amplification primers target a chloroplast polynucleotide (e.g., DNA) in an intergenic spacer between certain genes. Generally, this is achieved by extension of the oligonucleotide after hybridization with the target polynucleotide sequence. At least a portion of the amplification primer will hybridize with a complementary target polynucleotide sequence. This portion is referred to as a target binding sequence, which determines the target specificity of the primer.

[0036] "Complementarity" refers to Watson-Crick (e.g., AT / U and CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs. "Complementarity" refers to a property shared between two polynucleotides such that when they are arranged antiparallel to each other, the nucleotide bases at each position will be complementary.

[0037] The term "anticipated sterility genetic origin" refers to the sterility genetic origin that the plant material of a certain batch or batches has before carrying out the method or analysis described herein. This would usually be known in advance, because the tobacco material (such as seed or seedling) prepared is usually sold in a non-fertile form, and the genetic origin of this sterility would be known. For example, in the burley tobacco geographic area, the CMS standard is often the sweet tobacco CMS source. In the flue-cured tobacco geographic area, it is often the powder blue tobacco CMS source. In the oriental tobacco geographic area, it is often fertile common tobacco, therefore sterile sources are not used. Therefore, in some cases, tobacco seeds or seedlings are sold in fertile form, in which case, when sold in this fertile form, there will be no sterility genetic origin. The size or sequence of the amplified production obtained or obtainable from these known sterility genetic sources will also be known, and it is utilized as described herein.

[0038] The term "homology" or "similarity" refers to the degree of sequence similarity between two polynucleotides compared by sequence alignment. The degree of homology between two discrete polynucleotides being compared is a function of the number of identical or matching nucleotides at comparable positions.

[0039] In the context of two or more polynucleotides, "same" or "identity" means that these sequences have a specific percentage of identical residues in a specific region. The percentage can be calculated by optimally aligning the two sequences, comparing the specified region of the two sequences, determining the number of positions where the identical residues exist in the two sequences to produce the number of matching positions, dividing the number of matching positions by the total number of positions in the specified region, and multiplying the result by 100 to produce the sequence identity percentage. In the case where the two sequences have different lengths or the alignment produces one or more staggered ends and the specified comparison region includes only a single sequence, the residues of the single sequence are included in the denominator of the calculation rather than the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) are considered to be quite. Identity can be manually identified or determined by using a computer sequence algorithm such as ClustalW, ClustalX, BLAST, FASTA or Smith-Waterman. The popular multiple alignment program ClustalW (Polynucleotides Research (1994) 22, 4673-4680; Polynucleotides Research (1997), 24, 4876-4882) is a suitable means for generating multiple alignments of polynucleotides. Suitable parameters for ClustalW may be as follows: for polynucleotide alignments: gap open penalty = 15.0, gap extension penalty = 6.66, and matrix = identity. For DNA and protein alignments: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will appreciate that it may be necessary to change these and other parameters to achieve optimal sequence alignment. The percent identity is then suitably calculated from such an alignment as (N / T), where N is the number of positions where the sequences share consistent residues and T is the total number of positions compared, including gaps but not including overhangs.

[0040] The term "isolated" or "purified" refers to a material that is substantially or essentially free of components that normally accompany it in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. As used herein, the term "purified" means that the polynucleotide produces essentially one band in an electrophoretic gel. In particular, this means that the purity of the polynucleotide is at least 85%, more preferably at least 95%, and most preferably at least 99%. The isolated polynucleotide can be purified from its naturally occurring host cell. Conventional polynucleotide purification methods known to the skilled person can be used to obtain isolated polynucleotides. The term also encompasses recombinant polynucleotides and chemically synthesized polynucleotides.

[0041] "Oligonucleotide" or "polynucleotide" refers to at least two nucleotides covalently linked together. The description of a single strand also defines the sequence of the complementary strand. Therefore, a polynucleotide also encompasses the complementary strand of the depicted single strand. Many variants of a polynucleotide can be used for the same purpose as a given polynucleotide. Therefore, a polynucleotide also encompasses substantially identical polynucleotides and their complements. A single strand provides a probe that can hybridize with a given sequence under stringent hybridization conditions. Therefore, a polynucleotide also encompasses probes that hybridize under stringent hybridization conditions. A polynucleotide can be single-stranded or double-stranded, or can contain parts of double-stranded and single-stranded sequences. A polynucleotide can be DNA (both genomic DNA and cDNA), RNA or a hybrid, wherein a polynucleotide can include a combination of deoxyribonucleotides and ribonucleotides, and a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine and isoguanine. A polynucleotide can be obtained by chemical synthesis methods or by recombinant methods.

[0042] The specificity with which single-stranded DNA hybridizes to complementary fragments is determined by the "stringency" of the reaction conditions (Sambrook et al., Molecular Cloning and Laboratory Manual, 2nd ed., Cold Spring Harbor (1989)). Hybridization stringency increases as the propensity to form DNA duplexes decreases. In polynucleotide hybridization reactions, stringency can be selected to favor specific hybridization (high stringency), which can be used, for example, to identify full-length clones from a library. Low specific hybridization (low stringency) can be used to identify related but imprecise (homologous, but not identical) DNA molecules or segments. DNA duplexes are stable according to the following factors: (1) the number of complementary base pairs; (2) the type of base pairs; (3) the salt concentration (ionic strength) of the reaction mixture; (4) the reaction temperature; and (5) the presence of certain organic solvents, such as formamide, which reduce DNA duplex stability. In general, the longer the probe, the higher the temperature required for proper annealing. A common approach is to vary the temperature; higher relative temperatures result in more stringent reaction conditions. Hybridization under "stringent conditions" describes a hybridization protocol in which polynucleotides that are at least 60% homologous to each other remain hybridized. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) of the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and polynucleotide concentration) at which 50% of the probes complementary to a given sequence hybridize to the given sequence at equilibrium. Since a given sequence is usually present in excess, at the Tm, 50% of the probes are in equilibrium.

[0043] "Stringent hybridization conditions" are conditions under which a probe, amplification primer, or oligonucleotide is able to hybridize only to its specific sequence (such as a specific target polynucleotide sequence). Stringent conditions are sequence-dependent and will vary. Stringent conditions typically include: (1) low ionic strength and high temperature washes, e.g., 15 mM sodium chloride, 1.5 mM sodium citrate, 0.1% sodium dodecyl sulfate at 50°C; (2) denaturants during hybridization, e.g., 50% (v / v) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer (750 mM sodium chloride, 75 mM sodium citrate, pH 6.5) at 42°C; or (3) 50% formamide. Washes also typically include 5xSSC (0.75M NaCl, 75mM sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5xDenhardt's solution, sonicated salmon sperm DNA (50 μg / mL), 0.1% SDS, and 10% dextran sulfate at 42° C., and 0.2xSSC (sodium chloride / sodium citrate) at 42° C. and 50% formamide at 55° C., followed by a high stringency wash consisting of 0.1xSSC containing EDTA at 55° C. Suitably, the conditions are such that sequences at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% homologous to each other typically remain hybridized to each other.

[0044] "Medium stringency conditions" use a washing solution and less stringent hybridization conditions so that the polynucleotide will hybridize with the entirety, fragment, derivative or analog of the polynucleotide. An example includes hybridization in 6xSSC, 5xDenport solution, 0.5% SDS and 100 μg / mL denatured salmon sperm DNA at 55°C, followed by one or more washes in 1xSSC, 0.1% SDS at 37°C. Temperature, ionic strength, etc. can be adjusted to accommodate experimental factors, such as probe length. Other medium stringency conditions have been described (see Ausubel et al., Current Protocols in Molecular Biology, Vol. 1-3, John Wiley & Sons, Inc., Hoboken, NJ (1993); Kriegler, Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York, NY (1990); Perbal, A Practical Guide to Molecular Cloning, 2nd Edition, John Wiley & Sons, New York, NY (1988)).

[0045] "Low stringency conditions" use a wash solution and hybridization conditions that are less stringent than moderate stringency, so that a polynucleotide will hybridize to the entirety, fragment, derivative or analog of a polynucleotide. Non-limiting examples of low stringency hybridization conditions include hybridization at 40°C in 35% formamide, 5xSSC, 50mM Tris HCl (pH 7.5), 5mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg / mL denatured salmon sperm DNA, 10% (weight / volume) dextran sulfate, followed by one or more washes at 50°C in 2xSSC, 25mM Tris HCl (pH 7.4), 5mM EDTA and 0.1% SDS. Other conditions of low stringency, such as conditions for cross-species hybridization, have been fully described (see Ausubel et al., 1993; Kriegler, 1990).

[0046] The term "plant" refers to any plant and its offspring in any stage of its life cycle or growth. In one embodiment, plant is a tobacco plant, which refers to a plant belonging to the genus Nicotiana. The term includes the complete plant, plant organ, plant tissue, plant propagator, plant seed, plant cell and its offspring mentioned. Plant cell includes, but is not limited to, the cell from seed, suspension culture, plumule, meristem region, callus, leaf, root, shoot, gametophyte, sporophyte, pollen and pollen grain. Suitable kinds, cultivars, hybrids and varieties of tobacco plants are described herein. It will be appreciated by those skilled in the art that the multiple materials available from or can be derived from plants can be used according to the disclosure, including seedling, seed, plant, plant part, plant cell, plant tissue, the plant material of results or the plant material of slaking, or two or more combinations thereof. In certain embodiments, the plant material derives from sterile hybrids, such as sterile tobacco hybrids. Sterile hybrids can be the form of sterile hybrid crops in (farmers) fields, such as sterile hybrid tobacco crops in (farmers) fields. In certain embodiments, plant material is not derived from inbred line (such as inbred line of plant crops). Therefore, the disclosure may not be used for classifying hybrid seeds. Therefore, it is not necessary to screen the fertility restorer version and sterile version of inbred line. "Polynucleotide", "polynucleotide sequence" or "polynucleotide fragment" are used interchangeably herein, and refer to single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural or changed nucleotide bases. Nucleotide (usually present in its 5' monophosphate form) is referred to by its following single-letter name: "A" is for adenylic acid or deoxyadenylic acid (respectively for RNA or DNA), "C" is for cytidylic acid or deoxycytidylic acid, "G" is for guanylic acid or deoxyguanylic acid, "U" is for uridylic acid, "T" is for deoxythymidylic acid, "R" is for purine (A or G), "Y" is for pyrimidine (C or T), "K" is for G or T, "H" is for A or C or T, "I" is for inosine and "N" is for any nucleotide. The polynucleotide may be, but is not limited to, genomic DNA, complementary DNA (cDNA), mRNA or antisense RNA or a fragment thereof. In addition, the polynucleotide may be single-stranded or double-stranded, a mixture of single-stranded and double-stranded regions, a hybrid molecule comprising DNA and RNA, or a hybrid molecule having a mixture of single-stranded and double-stranded regions or a fragment thereof. In addition, the polynucleotide may be composed of a triple-stranded region comprising DNA, RNA or both, or a fragment thereof. The polynucleotide may contain one or more modified bases, such as phosphorothioates, and may be a peptide polynucleotide (PNA). In general, the polynucleotide may be assembled from isolated or cloned cDNA fragments, genomic DNA, oligonucleotides or individual nucleotides or a combination of the foregoing.Although the polynucleotides described herein are shown as DNA sequences, the polynucleotides include their corresponding RNA sequences and their complementary (eg, fully complementary) DNA or RNA sequences, including their reverse complements. Exemplary polynucleotides are listed in the attached sequence listing.

[0047] "Target polynucleotide sequence" refers to a polynucleotide sequence to be amplified and / or detected, which in the context of the present disclosure can be a polynucleotide sequence, such as an intergenic spacer associated with sterility (e.g., a chloroplast or mitochondrial intergenic spacer associated with sterility). A target polynucleotide sequence refers to a polynucleotide sequence to be amplified and any complementary second strand. The target polynucleotide sequence can be single-stranded or double-stranded, such that one or both strands can bind to an amplification primer. The amplification primers described herein are designed to anneal to a region of an intergenic spacer associated with sterility (e.g., a chloroplast intergenic spacer associated with sterility).

[0048] The term "tobacco" is used to refer to tobacco crops (e.g., various tobacco plants grown in the field rather than hydroponically grown tobacco), tobacco plants and parts thereof in a general sense, including but not limited to roots, stems, leaves, flowers and seeds prepared and / or obtained as described herein. It should be understood that tobacco refers to tobacco plants and products thereof.

[0049] The term "tobacco product" refers to consumer tobacco products, including but not limited to smoking materials (e.g., cigarettes, cigars, and pipe tobacco), snuff, chewing tobacco, chewing gum, and lozenges, and components, materials, and ingredients for making consumer tobacco products. Suitably, these tobacco products are made from the leaves and stems of tobacco harvested from tobacco, and are cut, dried, cured, and / or fermented according to conventional techniques in tobacco preparation.

[0050] "Variant" with respect to a polynucleotide refers to: (i) a portion or fragment of a polynucleotide; (ii) a polynucleotide or the complement of a portion thereof; (iii) a polynucleotide substantially identical to a polynucleotide of interest or its complement; or (iv) a polynucleotide that hybridizes to a polynucleotide of interest, its complement, or a polynucleotide substantially identical thereto under stringent conditions. Variants of the polynucleotides described herein are contemplated.

[0051] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention will have the meanings commonly understood by those of ordinary skill in the art. For example, any nomenclature used in connection with molecular biology, microbiology, plant biology, genetics, polynucleotide chemistry, and hybridization and their techniques are those well known and commonly used in the art. The meaning and scope of the terms should be clear; however, in the event of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definition. In addition, unless the context otherwise requires, singular terms should include plural terms and plural terms should include singular terms.

[0052] Male sterility

[0053] Several sources of introducing male sterility into plants are available and have been produced, for example, by transferring the plant genome into the cytoplasm of a heterologous species of the same genus via backcrossing. Cytoplasmic male sterility (CMS) is an advantageous mechanism for plant variety protection and for hybrid production. In some plants (such as tobacco), a fertility restoration system is not required because the product of interest is the leaves, rather than seeds as in other crops.

[0054] CMS is a maternally inherited trait that inhibits the production of functional pollen grains. It has been known for more than 100 years and has been reported in more than 150 plant species. The CMS phenotype is caused by incompatibility between the nuclear and cytoplasmic genomes and represents a valuable tool in hybrid seed production.

[0055] Sources of CMS in Nicotiana cytoplasm include cytoplasm from sweet, blue, Indian, curly, magrolon, and waveleaf. CMS cytoplasm can alter growth rate or the chemistry of cured leaves, but does not necessarily affect yield or leaf quality.

[0056] CMS can be introduced in plant in various ways.For example, if breeding or selection have been completed and fixed conversion strain is available, a kind of selection is to backcross these strains with the sterile version of the same strain so.After the first generation backcross (BC1), the proterties / genes of conversion will be heterozygous for all seeds.The second backcross (BC2) of this strain and the first generation male sterile progeny will produce 1 / 2 of the sterile superior strain with expected conversion proterties with regard to 1 gene, and will produce 1 / 4 of the sterile superior strain with expected conversion proterties with regard to 2 genes, and so on.BC2 strain can be maintained by adding pollen from fertile conversion superior parents at every turn.The time selection of these 2 generations (or 3 generations, to produce enough seeds) is generally 1 year to 1.5 years.In this case, it is not necessary to use molecular markers or marker assisted selection.

[0057] On the other hand, if the transformation of superior lines is being carried out, the BC1 or BC2 plants of the marker-assisted selection project can be crossed with the CMS superior varieties. This allows the development of sterile and fertile versions of the same variety in parallel, and since the sterile counterpart is always maintained by backcrossing with the fertile transformation line, it will become closer and closer genetically to the transformation line as the generations progress. In this case, the CMS and the transformed superior lines can be ready at almost the same time. It is expected that the availability of the CMS transformation lines may be delayed by 6 months.

[0058] Certain geographic regions tend to have their own preferred CMS genetic sources. For example, in the Burley tobacco geographic region, the CMS standard tends to be a sweet tobacco CMS source. In the flue-cured tobacco geographic region, it tends to be a powder blue tobacco CMS source. In the Oriental tobacco geographic region, it tends to be fertile common tobacco, so sterile sources are not used.

[0059] According to the present disclosure, one or more (suitably, two or more) amplification primers are used to amplify one or more polynucleotide sequences associated with sterility from two or more plant species or varieties (such as Nicotiana species). The same one or more polynucleotide sequences associated with sterility are usually amplified from two or more plant species or varieties. In one embodiment, the one or more polynucleotide sequences associated with sterility from plant species or varieties are intergenic spacer sequences associated with sterility. In one embodiment, the one or more polynucleotide sequences associated with sterility are one or more polynucleotide sequences associated with CMS. In one embodiment, the one or more polynucleotide sequences associated with sterility are intergenic spacer sequences associated with CMS. Other sequences associated with sterility are described herein. Based on the result of this analysis, it can be easy to determine whether a certain batch or batches of plant materials are contaminated or adulterated, or whether a certain batch or batches of plant materials are uncontaminated or unadulterated.

[0060] Polynucleotide sequences associated with infertility

[0061] According to the disclosure, one or more polynucleotide sequences associated with sterility (such as being associated with CMS) used in the disclosure will need to be present in various species or the variety of plant. The size or sequence of one or more polynucleotide sequences of amplification will need to be detectably different in each of various species or variety, so that the difference of size or sequence can be detected. In other words, the one or more polynucleotide sequences will need to be polymorphic between plant species or variety. For example, any one or more polynucleotide sequences from chloroplast or mitochondria can be used, and the polynucleotide sequences are polymorphic between plant species (such as common tobacco, sweet tobacco and powder blue tobacco). Such one or more polymorphic sequences can be easily identified by, for example, the organelle sequencing of plant species. In certain embodiments, chloroplast or mitochondrial intergenic sequences are used, because the polymorphism in the intergenic sequence is usually larger than the polymorphism in the gene.

[0062] In another embodiment, the one or more polynucleotide sequences associated with sterility are from Nicotiana tabacum, Nicotiana lindens, Nicotiana indica, Nicotiana curli, Nicotiana meglongii, or Nicotiana wavyleaf. In one embodiment, the polynucleotide sequence associated with sterility is an intergenic spacer associated with sterility.

[0063] In one embodiment, the intergenic spacer associated with sterility is a chloroplast or mitochondrial intergenic spacer associated with sterility.

[0064] In another embodiment, the intergenic spacer associated with sterility is a chloroplast intergenic spacer associated with Nicotiana tabacum, Nicotiana pastel, Nicotiana indica, Nicotiana curvatum, Nicotiana meglongata, or Nicotiana wavyleaf.

[0065] In another embodiment, the intergenic spacer associated with sterility is a mitochondrial intergenic spacer associated with sweet tobacco, powder blue tobacco, Indian tobacco, wrinkled tobacco, maiglon extinguished tobacco or wave leaf tobacco. In another embodiment, the chloroplast intergenic spacer associated with sterility is a trnH-psbA intergenic spacer sequence (GenBank accession number FJ493313.1). This chloroplast intergenic spacer is associated with CMS. The trnH-psbA chloroplast intergenic spacer from common tobacco is shown by SEQ ID NO:1. The example of the amplification part of the trnH-psbA chloroplast intergenic spacer from common tobacco is shown by SEQ ID NO:2. Exemplary forward amplification primer sequence and reverse amplification primer sequence are shown by SEQ ID No:3 and SEQ ID No:4 respectively. Those skilled in the art will readily appreciate that the amplification part of the trnH-psbA chloroplast intergenic spacer shown with SEQID NO:2 is only an example, and the variation in the sequence of this amplification part can be tolerated. The important consideration is that the fragment to be amplified can have different sizes or sequences in other plant species. In the context of the amplified portion of the trnH-psbA chloroplast intergenic spacer shown in SEQ ID NO:2, the amplified portion from Nicotiana tabacum is expected to be about 483bp. The amplified portion from the trnH-psbA chloroplast intergenic spacer of sweet tobacco is expected to be about 477bp. The amplified portion from the trnH-psbA chloroplast intergenic spacer of powder blue tobacco is expected to be about 467bp. Therefore, the size of the amplified portion from each species is different, which allows the size or sequence of the amplified fragment to be used as a marker, to identify which plant species the chloroplast intergenic spacer comes from.

[0066] In another embodiment, the chloroplast intergenic spacer associated with sterility is a trnL-trnF chloroplast intergenic spacer. This chloroplast intergenic spacer is associated with CMS. The trnL-trnF chloroplast intergenic spacer from common tobacco is shown by SEQ ID NO:5. The corresponding sequence from powder blue tobacco is disclosed with Genbank accession number AJ577414. The corresponding sequence from sweet tobacco is disclosed with Genbank accession number AJ577410. The example of the amplification part from the trnL-trnF chloroplast intergenic spacer of common tobacco is shown by SEQ ID NO:6. Exemplary forward amplification primer sequence and reverse amplification primer sequence are shown by SEQ ID No:7 and SEQ ID No:8 respectively. Due to the same reasons as above, the sequence of the amplification part and the sequence of the amplification primer are only exemplary. The amplification part from the trnL-trnF chloroplast intergenic spacer of common tobacco is expected to be about 483bp. The amplified portion of the trnL-trnF chloroplast intergenic spacer from N. sweetgrass is expected to be about 477 bp. The amplified portion of the trnH-psbA chloroplast intergenic spacer from N. pastel is expected to be about 467 bp.

[0067] In another embodiment, the chloroplast intergenic spacer associated with sterility is the atpH-atpI chloroplast intergenic spacer (nucleotides 14192-15350 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0068] In another embodiment, the chloroplast intergenic spacer associated with sterility is the ndhC-trnV chloroplast intergenic spacer (nucleotides 52761-53848 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0069] In another embodiment, the chloroplast intergenic spacer associated with sterility is the petA-psbJ chloroplast intergenic spacer (nucleotides 65390-66456 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0070] In another embodiment, the chloroplast intergenic spacer associated with sterility is the petN-psbM chloroplast intergenic spacer (nucleotides 29720-30853 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0071] In another embodiment, the chloroplast intergenic spacer associated with sterility is the psbE-petL chloroplast intergenic spacer (nucleotides 67222-68386 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0072] In another embodiment, the chloroplast intergenic spacer associated with sterility is the psbM-trnD chloroplast intergenic spacer (nucleotides 30957-32028 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0073] In another embodiment, the chloroplast intergenic spacer associated with sterility is the rbcl-accD chloroplast intergenic spacer (nucleotides 59121-59886 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0074] In another embodiment, the chloroplast intergenic spacer associated with sterility is the rpoD-trnC chloroplast intergenic spacer (nucleotides 27604-28889 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0075] In another embodiment, the chloroplast intergenic spacer associated with sterility is the rps16-trnQ chloroplast intergenic spacer (nucleotides 6302-7508 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0076] In another embodiment, the chloroplast intergenic spacer associated with sterility is the trnS-trnG chloroplast intergenic spacer (nucleotides 8811-9591 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0077] In another embodiment, the chloroplast intergenic spacer associated with sterility is the trnT-psbD chloroplast intergenic spacer (nucleotides 33345-34563 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0078] In another embodiment, the chloroplast intergenic spacer associated with sterility is the trnW-psaJ chloroplast intergenic spacer (nucleotides 68981-69658 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0079] In another embodiment, the chloroplast intergenic spacer associated with sterility is the ycf1 chloroplast intergenic spacer (nucleotides 125979-131687 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1). This chloroplast intergenic spacer is associated with CMS.

[0080] In certain embodiments, the chloroplast intergenic spacer associated with sterility is not the TrnH-TrnK chloroplast intergenic spacer (nucleotides 168-1900 of Nicotiana tabacum cv. TN90 plastid (GenBank Accession No.: KU199713.1)).

[0081] Amplification

[0082] According to the disclosure, provide the polynucleotide sample from certain batch or the vegetable material in batches for analysis.The vegetable material can be for example the vegetable material of seedling, seed, plant, plant part, results or the vegetable material of ripening, or two or more combination in them.Suitably, the vegetable material is sterile hybrid vegetable material.More suitably, the vegetable material is sterile hybrid tobacco material.

[0083] The polynucleotide sample is contacted with one or more amplification primers capable of amplifying a target polynucleotide sequence associated with infertility. The sample is then subjected to an in vitro polynucleotide amplification reaction to generate an amplification product.

[0084] The amplification methods used in the present disclosure are well known in the art, and include, for example, replicase-mediated amplification, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), thermophilic strand displacement amplification (tSDA), self-maintained sequence replication (3SR), transcription-mediated or transcription-related amplification (TMA), polynucleotide sequence-based amplification (NASBA), ligase chain reaction (LCR) and rolling circle amplification (RCA). Such amplification methods are well known in the art and are easy to use according to the present disclosure. Amplification techniques can be isothermal and performed at a constant temperature, or they can be thermal techniques that require cycling between high and low temperatures. In certain embodiments, it is preferred to use PCR.

[0085] For the in vitro polynucleotide amplification reaction to be performed, it is necessary to use one or more, preferably two or more amplification primers. The design of amplification primers can be optimized for each amplification method. Since no special sequence or structure is required to drive the amplification reaction, the amplification primers used for PCR can be composed only of the template binding sequence. However, other amplification reactions may require more specialized nucleotide sequences in addition to the target binding sequence so that the reaction continues. For example, the amplification primer used in the SDA assay also includes a restriction endonuclease recognition site located at the 5' end of the target binding sequence. The amplification primer can also include a 3'-OH group, which can be extended by DNA polymerase when the template binding sequence of the amplification primer is annealed to the target polynucleotide sequence. In contrast, the amplification primers used for 3SR and NASBA include an RNA polymerase promoter near the 5' end. The promoter is attached to the target binding sequence and is used to drive the amplification reaction by directing the transcription of multiple RNA copies of the template. Such sequences other than the target binding sequence necessary for a specific amplification reaction are well known in the art.

[0086] When designing amplification primers for the present disclosure, general problems known in the art will be considered. For example, when using a target polynucleotide sequence design primer comprising a large amount of GC tumor necrosis factor glycoproteins and AT tumor necrosis factor glycoproteins, it should be noted that potential dimer interactions are minimized to avoid primer self-hybridization. Primers that can form four or more continuous bonds with themselves or form eight or more interchain bonds with other primers should usually be avoided. Primers that can form 3' dimers should especially be avoided, because hybridization at the 3' end of the primer, even temporary hybridization, will also cause primer extension due to polymerase action and primer destruction. Some computer software programs can be used in primer design to avoid these problems. Primer combinations have also been screened to obtain optimal conditions.

[0087] As is known in the art, annealing or hybridization of complementary and partially complementary polynucleotide sequences can also be achieved by adjusting the reaction conditions to increase or decrease stringency (eg, adjusting the temperature or salt content of the buffer).

[0088] Polynucleotide amplification primers comprising about 10 or more continuous polynucleotides complementary to a target polynucleotide sequence to be amplified are described. These primers can comprise about 15, 20, 25, 30, 40, 45 or 50 more continuous polynucleotides or consist of them, and the continuous polynucleotides are hybridized (for example, specific hybridization) with one or more target polynucleotide sequences as described herein. In some embodiments, these primers can comprise about 10 to 50 continuous nucleotides, about 10 to 40 continuous nucleotides, about 10 to 30 continuous nucleotides or about 15 to 30 continuous nucleotides, or consist of them. The one or more amplification primers can be designed and used to amplify or detect part or all of the target polynucleotide sequence. For specific example, two kinds of amplification primers can be used in the PCR scheme to amplify the target polynucleotide sequence. PCR can also be carried out using a primer derived from a polynucleotide sequence and a second primer hybridized with a polynucleotide sequence upstream or downstream sequence, and the polynucleotide sequence is such as a promoter sequence, the 3' end of the mRNA precursor or the sequence derived from the carrier. Thus, in some embodiments, a pair of amplification primers is used, each of which anneals to one of the two strands of a double-stranded target polynucleotide sequence. In this case, amplification is exponential because both the sense strand and the antisense strand serve as templates for opposing primers in subsequent rounds of amplification. When a single amplification primer is used, amplification is linear because only one strand serves as a template for primer extension.

[0089] Amplification primers as described herein can be 100% complementary to their target polynucleotide sequences. However, based on the above-mentioned primer design conditions, primers and probes can be combined with target polynucleotide sequences even if their complementarity to these regions is less than 100%. The required degree of complementarity depends on a variety of factors, including the stringency of the binding conditions. Depending on the stringent conditions adopted, these amplification primers can be modified to include different bases in their sequences, and still fully complementary to bind to the target region. As used herein, fully complementary includes 70% or higher complementarity. In a preferred embodiment, the complementarity of these amplification primers to their target polynucleotide sequences is at least 80% on the length of the binding portion of the amplification primer. More preferably, the complementarity of these amplification primers to their target polynucleotide sequences is 90% or higher.

[0090] Suitably, as described herein, amplification primers according to the present disclosure are designed to specifically amplify polynucleotide sequences associated with infertility. Suitably, these amplification primers are designed such that they have at least 90%, 95% or 100% complementarity with respect to the polynucleotide sequences associated with infertility.

[0091] When designing the amplification primers used in the present disclosure, it is important that they are designed to make the target polynucleotide sequence that can be associated with sterility from more than one different plant species or variety amplification.Therefore, the sequence of described one or more amplification primers will be complementary with at least 90%, 95% or 100% of the polynucleotide sequence that is associated with sterility from more than one different plant species or variety.When designing the amplification primers used in the present disclosure, it is equally important that they are designed to make the sequence that is amplified have different sizes or sequences when amplifying from each different plant species or variety.Therefore, in one embodiment, amplification primers are configured to increase the polymorphic sequence in the Nicotiana.Therefore, then the size or sequence of amplified product can be used as marker, so that decipher which plant species or variety the amplified product comes from.The size of amplified product is designed to 500 base pairs or less usually, suitably, 400 base pairs or less, suitably, 300 base pairs or less, or suitably, 200 base pairs or less.

[0092] According to one embodiment of the present disclosure, the use of chloroplast or mitochondrial intergenic spacer regions can be advantageous because the chloroplast or mitochondrial genomes in higher plants are highly conserved, which has some practical significance for genetic research. Therefore, universal PCR primer pairs can be designed based on the conserved coding sequences of chloroplast or mitochondrial DNA to amplify DNA from different plant species.

[0093] Suitably, no restriction endonuclease digestion step is required to distinguish one or more amplification products. This can make the method faster and simpler.

[0094] The amplified product generated can be detected by any method known in the art. The amplified product can be detected by using conventional techniques and labeled probe hybridization, for example, a technique of hybridizing with the polynucleotide of amplification at the sequence between the amplification primers. Desirably, the amplified product is detected by its size or its sequence, as discussed more fully below.

[0095] Suitably, before determining the size and / or sequence of the amplified product, the amplified product is not subjected to any treatment and is directly analyzed. Thus, for example, before determining the size and / or sequence of the amplified product, the amplified product is not digested (e.g., with a restriction endonuclease). Advantageously, this makes the method faster and simpler.

[0096] Method for determining the sequence of amplification products

[0097] The amplified sequences may differ in sequence by at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, or at least 10 nucleotides. Suitably, the amplified sequences may differ in sequence by at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, or at least 10 nucleotides. Suitably, the amplified sequences may differ in sequence by at least 10 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, or at least 50 nucleotides.

[0098] The art has various methods that can be used to measure the sequence of an amplified product. The art has various methods that can be used to determine the presence of one or more polymorphisms in the amplified product, including determining the presence or absence of one or more single nucleotide polymorphisms. Such methods include direct sequencing of an amplified product, determination of amplified product polymorphism, polynucleotide hybridization determination, and computer-based methods. Commercially available methods, test kits or services for carrying out these methods are widely available and are well known to the technical staff.

[0099] For direct sequencing methods, the amplified product is sequenced (such as manual sequencing or automatic sequencing) using any suitable method, wherein the nucleotide sequence of the amplified product is determined. In order to determine the sequence of the amplified product, the polynucleotide sample is first subjected to sequencing reaction (such as Sanger dideoxy sequencing). The method relies on the incorporation of nucleotides into annealed primers from a mixture containing deoxynucleotides and dideoxynucleotides by DNA polymerase under the guidance of the template. Since the enzyme cannot catalyze the further extension of the chain, the incorporation of dideoxynucleotides causes chain termination. The separation of the reaction product results in a "ladder" of extension products, wherein each extension product terminates in a specific dideoxynucleotide complementary to the nucleotide relative to it in the template. The extension product can be detected in several ways, including, for example, a primer, deoxynucleotide triphosphate or dideoxynucleotide triphosphate containing a fluorescent label in the reaction. The sequencing reaction product can then be analyzed by a variety of means (most commonly by capillary gel electrophoresis and / or polyacrylamide gel electrophoresis, etc.).

[0100] The one or more polymorphisms can also be determined using a polynucleotide amplification assay in which oligonucleotide primers are designed to specifically amplify a fragment containing the one or more polymorphisms.

[0101] One or more polymorphisms can also be detected using fragment length polymorphism assays, wherein an enzyme (such as a restriction endonuclease) is used to generate a unique DNA banding pattern based on cutting DNA at a series of positions. DNA fragments from samples containing one or more polymorphisms will have a banding pattern different from the wild-type sequence.

[0102] One or more polymorphisms may also be detected by fragment size analysis.

[0103] One or more polymorphisms can also be detected using restriction fragment length polymorphism assay (RPLP). First, PCR is used to separate the region of interest. The PCR product is then cut with a restriction endonuclease known to produce unique length fragments to provide a given polymorphism. The PCR product digested with the restriction endonuclease is separated by agarose gel electrophoresis and visualized by ethidium bromide staining or other methods known in the art and then compared with a control (such as a wild type).

[0104] One or more polymorphisms can also be detected using a cleavage enzyme fragment length polymorphism assay, as described, for example, in US 5,888,750.

[0105] One or more polymorphisms can also be detected using hybridization assays, wherein the presence or absence of the polymorphism is determined based on the ability of the DNA from the sample to hybridize with a complementary DNA molecule (such as an oligonucleotide probe). Multiple hybridization assays are available. The polynucleotides of the hybridization can be detected using one or more labels attached to the sample polynucleotides. These labels can be incorporated by any of the various means well known to those skilled in the art.

[0106] One or more polymorphisms can also be detected using DNA chip hybridization assays, in which a series of oligonucleotide probes are attached to a solid support. These oligonucleotide probes are designed to be unique for a given single nucleotide polymorphism. DNA samples of interest are contacted with DNA chips and hybridization is detected (see, for example, US 6,045,996). Amplified products can be marked and incubated with arrays, then inserted into scanners, where the pattern of hybridization can be detected and collected. Because the sequence and position of each probe on the array are known, the identity of the target polynucleotides applied to the probe array can be determined.

[0107] As described in US 6,068,818, a DNA microchip containing electron capture probes can be used to detect one or more polymorphisms.

[0108] One or more polymorphisms may also be detected using microbead arrays for detecting polymorphisms as described in WO 00 / 39587.

[0109] Methods for determining the size of amplification products

[0110] The size difference of the one or more polynucleotides amplified can be at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, or at least 10 nucleotides. Suitably, the size difference of the one or more polynucleotides amplified can be at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, or at least 10 nucleotides. Suitably, the size difference of the one or more polynucleotides amplified can be at least 10 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, or at least 50 nucleotides.

[0111] Amplified polynucleotides can be analyzed based on size using methods well known in the art, such as gel electrophoresis, anion exchange chromatography, size exclusion chromatography, pulsed-field electrophoresis, sieving gel electrophoresis, capillary electrophoresis, or Southern analysis.

[0112] Gel electrophoresis is a technique that is often used to separate polynucleotide molecules based on size. The gel is usually composed of agarose, a seaweed polysaccharide, or, for separation of smaller nuclear fragments, polyacrylamide gels can be used. For analysis, a polynucleotide sample is placed into a well formed in the gel, and an electric field is applied. The negative charge of the polynucleotide will cause the polynucleotide to migrate through the gel toward the positive electrode. The composition of the gel changes the migration rate of the molecules, thus achieving separation. Variations of gel electrophoresis contemplated herein include pulsed-field gel electrophoresis and sieving agarose gel electrophoresis.

[0113] Another potentially useful analytical procedure is analysis of the amplified nuclear fragments by Southern analysis.

[0114] In a preferred embodiment, the polynucleotides amplified are analyzed by capillary gel electrophoresis. The physical properties of the capillary are important for analyzing the components of interest in the sample, and typically the inner diameter is less than 100 μm and the length is 20 cm to 100 cm, although the capillary is not necessarily limited to these sizes. Various polymer networks can be used, including those composed of cellulose materials, polyethylene oxide, polyethylene glycol, hydroxypropyl methylcellulose, hydroxyethyl cellulose or methylcellulose. The polymer network is usually suspended in a biological buffer. The sample can be introduced into the inlet of the capillary by various techniques (such as electric injection or fluid dynamic injection).

[0115] Sorting a batch of plant material

[0116] Based on the results of the analysis performed according to the present disclosure, a batch of plant material can be classified as contaminated or adulterated, or uncontaminated or unadulterated. Suitably, the plant material is classified as contaminated or adulterated by plant material from different sources, or uncontaminated or adulterated by plant material from different sources. The plant material from different sources can be plant material that is expected to be fertile, or plant material that lacks an expected source of sterility, or plant material with significantly different genetic sources of sterility.

[0117] In some embodiments, the fertility state of plant material in batches or in batches can be known.Generally speaking, the tobacco material (such as seed or seedling) prepared is sold in non-fertile form usually, and the genetic origin of this sterility of the tobacco seed prepared can be known.The seed or seedling of tobacco can also be sold in fertile form.For example, in the burley tobacco geographical area, the CMS standard is often the sweet tobacco CMS source.In the flue-cured tobacco geographical area, it is often the powder blue tobacco CMS source.In the oriental tobacco geographical area, it is often the fertile common tobacco, therefore does not use the sterile source.

[0118] Therefore, for example, the sterility source in the tobacco seeds supplied commercially can be the CMS from the cytoplasm of sweet tobacco. According to the method disclosed herein, once the size or sequence of one or more target polynucleotide sequences of the amplification of one or more polynucleotides associated with the sterility from this batch of plant materials has been determined, it can be compared with the size or sequence of the known amplification product from the known sterility genetic source. Then, according to the result of this step, if the sterility genetic source corresponds to the sterility genetic source of the expectation of this batch of plant materials, it is considered that this batch of plant materials is uncontaminated or unadulterated. If the sterility genetic source does not correspond to the sterility genetic source of this batch of plant materials, it is considered that this batch of plant materials is contaminated or doped. If it is found that this batch of plant materials is uncontaminated or unadulterated, it can be expected that this plant material is free from pollution, and the plant material derived from it will have expected quality or purity. If it is found that this batch of plant materials is contaminated or doped, it can be expected that this plant material has been polluted by the plant material from other sources, and the plant material derived from it will not have expected quality or purity. In such cases, the plant material may need to be discarded or destroyed as its quality or purity cannot be guaranteed.

[0119] Raise other example, a batch of vegetable materials for testing can have the CMS sterility source from the sweet tobacco cytoplasm.Extract polynucleotide samples from this vegetable material, and increase one or more target polynucleotide sequences of the cytoplasm intergenic spacer associated with CMS.Determine the size or sequence of one or more amplified productions, and based on the size or sequence of described one or more amplified productions, by comparing the size or sequence of amplified productions with the size or sequence of amplified productions from the same cytoplasm intergenic spacer associated with CMS, identify the sterility genetic source.Therefore, in the context of this example, the size or sequence of one or more amplified productions will be compared with the size or sequence of the known amplified productions from the known CMS sterility genetic source used in tobacco.If from the amplification step, determine that the size or sequence of one or more amplified productions only correspond to the CMS sterility source from the sweet tobacco cytoplasm, then can determine that vegetable material is uncontaminated or unadulterated.If from the amplification step, determine that the size or sequence of one or more amplified productions do not correspond to the CMS sterility source from the sweet tobacco cytoplasm, then can determine that vegetable material is contaminated or doped. Thus, for example, the size or sequence of one or more amplified products may correspond to a CMS sterility source from Nicotiana tabacum, Nicotiana indica, Nicotiana curvatum, Nicotiana magloire, or Nicotiana wavyii cytoplasm, or the size or sequence of the amplified products may correspond to Nicotiana tabacum cytoplasm, thereby indicating the presence of fertile tobacco material. In this example, the quality or purity of the plant material may need to be discarded or destroyed because the plant material cannot be guaranteed.

[0120] Take other example, a batch of plant materials for testing can have the CMS sterility from the cytoplasm of powder blue tobacco.Extract polynucleotide samples from this plant material, and increase one or more target polynucleotide sequences of the cytoplasm intergenic spacer associated with CMS.Determine the size or sequence of one or more amplified products, and based on the size or sequence of described one or more amplified products, by comparing the size or sequence of described one or more amplified products with the size or sequence of the amplified product from the same cytoplasm intergenic spacer associated with CMS, identify the sterility genetic source.Therefore, in the context of this example, the size or sequence of one or more amplified products will be compared with the size or sequence of the known amplified product from the known CMS sterility genetic source used in tobacco.If from amplification step, determine that the size or sequence of one or more amplified products only correspond to the CMS sterility source from the cytoplasm of powder blue tobacco, then can determine that plant material is uncontaminated or unadulterated.If from amplification step, determine that the size or sequence of one or more amplified products do not correspond to the CMS sterility source from the cytoplasm of powder blue tobacco, then can determine that plant material is contaminated or doped. Thus, for example, the size or sequence of one or more amplified products may correspond to a CMS sterility source from a cytoplasm of Nicotiana tabacum, Nicotiana indica, Nicotiana curvatum, Nicotiana magloire, or Nicotiana wavyii, or the size or sequence of one or more amplified products may correspond to a cytoplasm of Nicotiana tabacum, thereby indicating the presence of fertile tobacco material. In this example, the plant material may need to be discarded or destroyed because its quality or purity cannot be guaranteed.

[0121] Take other example, a batch of plant materials for testing can be fertile common tobacco.Extract polynucleotide samples from this plant material, and increase one or more target polynucleotide sequences of the cytoplasm intergenic spacer associated with CMS.Determine the size or sequence of one or more amplified products, and based on the size or sequence of described one or more amplified products, by comparing the size or sequence of described one or more amplified products with the size or sequence of the amplified product from the same cytoplasm intergenic spacer associated with CMS, identify the sterility genetic source.In this example, it will be expected that in uncontaminated or unadulterated plant material, an amplified product will not be obtained, because this plant material does not have the CMS genetic source.If from the amplification step, determine that there is no amplified product, then it can be determined that plant material is uncontaminated or unadulterated.If from the amplification step, determine that one or more amplified products are available from the CMS sterility source, then it can be determined that plant material is contaminated or doped.In this example, owing to the quality or purity of this plant material that cannot guarantee, it may be necessary to discard or destroy.

[0122] Also disclosed is a method for classifying a batch of plant material as contaminated or non-contaminated comprising using one or more amplification primers specific for a polynucleotide sequence associated with sterility.

[0123] Also disclosed is the use of two or more amplification primers specific for a polynucleotide sequence associated with sterility for classifying a batch of plant material as contaminated or non-contaminated.

[0124] Multiple amplification products may be obtained, indicating the presence of multiple different genetic sources of infertility in the sample. Typically, this would indicate contamination or adulteration.

[0125] Determining eligibility

[0126] Based on the result of the analysis performed according to the disclosure, the qualification of a certain batch or batches of plant material can be determined.When determining the qualification of a certain batch or batches of plant material, it can be determined whether the batch or batches of plant material meet the standard.For example, some geographical areas have standardized CMS genetic sources.For example, in the burley tobacco geographical area, the CMS standard is often the sweet tobacco CMS source.In the flue-cured tobacco geographical area, the CMS standard is often the powder blue tobacco CMS source.In the oriental tobacco geographical area, the CMS standard is often fertile common tobacco, so the sterile source is not used. Therefore, on the other hand, a method for checking the qualification of a batch of plant materials is provided, comprising: (i) providing a polynucleotide sample from the batch of plant materials; (ii) contacting the polynucleotide sample with an amplification primer to amplify one or more target polynucleotide sequences associated with sterility; (iii) performing an in vitro polynucleotide amplification reaction on the sample to generate one or more amplification products; (iv) determining the size or sequence of the one or more amplification products; and (v) based on the size or sequence of the amplification products determined in step (iv), comparing the size or sequence of the one or more amplification products with the size or sequence of known amplification products from a known genetic source of sterility; wherein if the genetic source of sterility determined in step (v) corresponds to the expected genetic source of sterility for the batch of plant materials, the batch of plant materials is considered to be qualified; or wherein if the genetic source of sterility determined in step (v) does not correspond to the expected genetic source of sterility for the batch of plant materials, the batch of plant materials is considered to be unqualified.

[0127] According to the method, once the size or sequence of one or more target polynucleotide sequences of the amplification associated with the sterility from the batch of plant materials has been determined, it can be compared with the size or sequence of the known amplification products from the known sterility genetic source. Then, according to the result of this step, if the sterility genetic source corresponds to the expected sterility genetic source of the batch of plant materials, the batch of plant materials is considered to be qualified (e.g., unadulterated). If the sterility genetic source does not correspond to the expected sterility genetic source of the batch of plant materials, the batch of plant materials is considered to be unqualified (e.g., doped). If it is found that the batch of plant materials is qualified, it can be expected that the plant materials are free from contamination or doping, and the plant materials derived therefrom will have the expected quality or purity. If it is found that the batch of plant materials is unqualified or doped, it can be expected that the plant materials have been contaminated by plant materials from other sources, and the plant materials derived therefrom will not have the expected quality or purity. In this case, it may be necessary to discard or destroy it because the quality or purity of the plant materials cannot be guaranteed.

[0128] For example, a batch of vegetable materials for testing can have the CMS genetic origin from the expection of sweet tobacco cytoplasm.Extract polynucleotide samples from this vegetable material, and increase one or more target polynucleotide sequences of the cytoplasm intergenic spacer associated with CMS.Determine the size or sequence of one or more amplified products, and based on the size or sequence of amplified products, by comparing the size or sequence of the amplified products from the same cytoplasm intergenic spacer associated with CMS, identify the sterility genetic origin.Therefore, in the context of this example, the size or sequence of one or more amplified products will be compared with the size or sequence of the known amplified products from the known CMS sterility genetic origin used in tobacco.If from amplification step, determine that the size or sequence of one or more amplified products only correspond to the CMS sterility source from the sweet tobacco cytoplasm, then can determine that vegetable material is qualified or unadulterated.If from amplification step, determine that the size or sequence of one or more amplified products do not correspond to the CMS sterility source from the sweet tobacco cytoplasm, then can determine that vegetable material is unqualified or doped. Thus, for example, the size or sequence of one or more amplified products may correspond to a CMS sterility source from Nicotiana tabacum, Nicotiana indica, Nicotiana curvatum, Nicotiana magloire, or Nicotiana wavyii cytoplasm, or the size or sequence of one or more amplified products may correspond to Nicotiana tabacum cytoplasm, thereby indicating the presence of fertile tobacco material. In this example, the plant material may need to be discarded or destroyed because the quality or purity cannot be guaranteed.

[0129] Raise other example, a batch of vegetable materials for testing can have the CMS genetic origin of expection from the pink blue tobacco cytoplasm.Extract polynucleotide sample from this vegetable material, and increase one or more target polynucleotide sequences of the cytoplasm intergenic spacer associated with CMS.Determine the size or sequence of one or more amplified products, and based on the size or sequence of described one or more amplified products, by comparing the size or sequence of described one or more amplified products with the size or sequence of the amplified product from the same cytoplasm intergenic spacer associated with CMS, identify the sterility genetic origin.Therefore, in the context of this example, the size or sequence of one or more amplified products will be compared with the size or sequence of the known amplified product from the known CMS sterility genetic origin used in tobacco.If from amplification step, determine that the size or sequence of one or more amplified products only correspond to the CMS sterility source from the pink blue tobacco cytoplasm, then can determine that vegetable material is qualified or unadulterated.If from amplification step, determine that the size or sequence of one or more amplified products do not correspond to the CMS sterility source from the pink blue tobacco cytoplasm, then can determine that vegetable material is unqualified or doped. Thus, for example, the size or sequence of the amplified product may correspond to a CMS sterility source from the cytoplasm of Nicotiana tabacum, Nicotiana indica, Nicotiana curvatum, Nicotiana magloire, or Nicotiana wavyii, or the size or sequence of the amplified product may correspond to the cytoplasm of Nicotiana tabacum, thereby indicating the presence of fertile tobacco material. In this example, the quality or purity of the plant material may need to be discarded or destroyed because the material cannot be guaranteed.

[0130] Take other example, a batch of plant materials for testing can be fertile common tobacco.Extract polynucleotide samples from this plant material, and increase one or more target polynucleotide sequences of the cytoplasm intergenic spacer associated with CMS.Determine the size or sequence of one or more amplified products, and based on the size or sequence of the one or more amplified products, by comparing the size or sequence of the amplified product with the size or sequence of the amplified product from the same cytoplasm intergenic spacer associated with CMS, identify the sterility genetic source.In this example, it will be expected that in qualified plant materials, amplified products will not be obtained, because this plant material does not have the CMS genetic source.If from the amplification step, determine that there is no amplified product, then it can be determined that plant material is qualified.If from the amplification step, determine that one or more amplified products are available from the CMS sterility source, then it can be determined that plant material is unqualified.In this example, owing to the quality or purity of this plant material that cannot guarantee, it may be necessary to discard or destroy it.

[0131] Multiple amplification products may be obtained, indicating the presence of multiple different genetic sources of infertility in the sample. Typically, this would indicate contamination or adulteration.

[0132] Also disclosed are methods for checking the fitness of a batch of plant material comprising using one or more amplification primers specific for a polynucleotide sequence associated with sterility.

[0133] Also disclosed is the use of two or more amplification primers specific for a polynucleotide sequence associated with sterility for checking the compliance of a batch of plant material.

[0134] plant

[0135] Plants suitable for use in the present disclosure and plant materials derived therefrom include monocots and dicots. Suitable species may include members of the Nicotiana genus, including N. rustica and N. tabacum (e.g., LA B21, LN KY171, TI 1406, Basma, Galpao, Perique, Beinhart 1000-1, and Petico). Other species include N. acaulis, N. acuminata, N. africana, N. alata, N. ameghinoi, N. amplexicaulis, N. arentsii, N. attenuata, N. azambujae, N. benavidesii, N. benthamiana, N. bigelovii, N. bonariensis, N. cavicolola, N. clevelandii, N. cordifolia, N. corymbosa, N. debneyi, N. excelsior, N. forget iana), N. fragrans, N. glauca, N. glutinosa, N. goodspeedii, N. gossei, N. hybrid, N. ingulba, N. kawakamii, N. knightiana, N. langsdorffii, N. linearis, N. longiflora, N. maritima, N. megalosiphon, N. miersii, N. noctiflora, N. nudicaulis, N. obtusifolia, N. occidentalis, N. occidentalis subsp. hesperis), ear-shaped tobacco (N.otophora), round tobacco (N. paniculata), few-flowered tobacco (N.pauciflora), petunioides, plumbaginifolia, quadrivalvis, raimondii, repanda, rosulata, rosulata ingulba subsp.ingulba), round-leaf tobacco (N.rotundifolia), settelli (N.setchellii), pseudo-tobacco (N.simulans), front-leaf tobacco (N.solanifolia), Spegazzinii (N.spegazzinii), Stocktonii (N.stocktonii), sweet tobacco (N.suaveolens), beautiful flower tobacco (N.sylvestris), pseudo-spicate tobacco (N.thyrsiflora), hairy tobacco (N.tomentosa), hairy tobacco (N.tomentosiformis), trigonophylla (N.trigonophylla), shade tobacco (N.umbratica), wave-leaf tobacco (N.undulata), trembling tobacco (N.velutina), sequence leaf tobacco (N.wigandioides) and flower tobacco (Nx sanderae).

[0136] In one embodiment, it is contemplated that common tobacco varieties will be used.

[0137] Common tobacco varieties include burley tobacco, black tobacco, flue-cured tobacco and oriental tobacco. Non-limiting examples of varieties or cultivars are: BD 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CD 263, DF911, DT 538LC Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL 939, GL 973, HB 04P, HB04P LC, HB3307PLC, Hybrid 403LC, Hybrid 404LC, Hybrid 501LC, K 149, K 326, K 346, K 358, K394, K399, K 730, KDH 959, KT 200, KT204LC, KY10, KY14, KY 160, KY 17, KY 171, KY 907, KY907LC, KY14xL8 LC, Little Crittenden, McNair 373, McNair 944, msKY 14×L8, narrow leaf Madole, narrow leaf Madole LC, NBH 98, N-126, N-777LC, N-7371LC, NC 100, NC 102, NC 2000, NC291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH129, NC 2002, Neal Smith Madole,OXFORD 207,PD 7302LC, PD 7309LC, PD 7312LC, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R7-11, R 7-12, RG 17, RG81, RG H51, RGH 4, RGH 51, RS 1410, Speight 168, Speight 172, Speight 179, Speight210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, TI 1406, TI 1269, TN 86, TN86LC, TN 90, TN97, TN97LC, TN D94, TND950, TR (Tom Rosson) Madole, VA 309, VA359, AA 37-1, B 13P, Xanthi (Mitchell-Mor), Bel-W3, 79-615, Samsun Holmes NN, KTRDC No. 2 Hybrid 49, White Burley 21, KY8959, KY 9, MD 609, PG 01, PG 04, PO1, PO2, PO3, RG 11, RG 8, VA 509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 347, Criollo Misionero, Delcrest, Djebel 81, DVH 405, Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona, Kutsage E1, LA BU 21, NC 2326, NC 297, PVH2110, Red Russian, Samsun, Saplak, Simmaba, Talgar 28, Wislica, Yayaldag, Prilep HC-72, Prilep P23, Prilep PB 156 / 1, Prilep P12-2 / 1, Yaka JK-48, Yaka JB 125 / 3, TI-1068, KDH-960, TI-1070, TW136, Basma, TKF 4028, L8, TKF 2002, GR141, Basma xanthi, GR149, GR153, Petit Havana. The above low-conversion subvariants are also contemplated even if not specifically stated herein.

[0138] This article also covers the use of tobacco cultivars and elite tobacco cultivars.

[0139] Consumables

[0140] Plant materials tested as described herein, particularly leaves and midribs of such plants, can be incorporated into or used to prepare various consumables, including but not limited to aerosol forming materials, aerosol forming devices, smoking articles, smokeable products, smokeless products, medicine or cosmetic products, intravenous preparations, tablets, powders and tobacco products. The example of aerosol forming materials includes tobacco composition, tobacco, tobacco extract, shredded tobacco, cut filler, cured tobacco, expanded tobacco, homogenized tobacco, reconstituted tobacco and pipe tobacco. Smoking articles and smokeable products are the types of aerosol forming devices. The example of smoking articles or smokeable products includes cigarettes, cigarillos and cigars. The example of smokeless products includes chewing tobacco and snuff. In some aerosol forming devices rather than burning, tobacco composition or another aerosol forming material is heated by one or more electric heating elements to produce aerosol. In another type of heated aerosol-forming device, aerosol is generated by transferring heat from a combustible fuel element or a heat source to a physically separated aerosol-forming material, which can be located in, around, or downstream of the heat source. Smokeless tobacco products and a variety of tobacco-containing aerosol-forming materials can include any form of tobacco, including dry particles, fragments, small particles, powders, or slurries deposited on, mixed in, surrounded by, or otherwise combined with other ingredients, which take any form, such as flakes, films, cards (tabs), foams, or beads. As used herein, the term "smoke" is used to describe a class of aerosols produced by smoking articles such as cigarettes or by burning aerosol-forming materials.

[0141] The plant material being tested may be cured plant material. Processes for curing green tobacco leaves are known to those skilled in the art and include, but are not limited to, air-curing, fire-curing, flue-curing and sun-curing as described herein.

[0142] The invention is also described in the following examples, which are provided to describe the invention in more detail. These examples set forth preferred modes presently contemplated for carrying out the invention and are intended to illustrate, but not to limit, the invention.

[0143] Example

[0144] Example 1: Method for amplifying the Nicotiana tabacum trnH-psbA chloroplast intergenic spacer region PCR primers were designed to amplify the Nicotiana tabacum trnH-psbA chloroplast intergenic spacer region (GenBank Accession No. FJ493313.1).

[0145] SEQ ID NO: 1—Nicotiana tabacum trnH-psbA chloroplast intergenic spacer (GenBank Accession No. FJ493313.1). The positions of the amplification primers are underlined.

[0146] ACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCCTCGCCTACTTACATTCCGTTTTTACATTATTTAAATT AGAAAACAAAAGATTCAAGTTCG AATATAGCTCTTCTTTCTTATTTCAAAGATAAGAGATATTCAAAGATAAGAGATAAGAAGAAGTCAAAATTTGATTTTTTTTTTGGAAAAAAAAAATCAAAAAGATATAGTAACATTAGCAAGAAGAGAAACAAGTTCTATTTCTACAATTTTAAACAAATACAAAATCAAAATAGAATACTCAATCATGAATAAAT GCAAGAAAATAACCTCTCCTTC TTTTTCTATAATGTAAACAAAAAAGTCTATGTAAGTAAAATACTAGTAAATAAATAAAAAGAAAAAAAGAAAGGAGCAATAGCACCCTCTTGATAGAACAAGAAAATGATTATTGCTCCTTTCTTTTCAAAACCTCCTATAGACTAGGCCAGGATCTTATCCATTTGTAGATGGAGCTTCGATAGCAGCTAGGTCTAGAGGGAAGTTGTGAGCATTACGTTCATGCATAAC

[0147] SEQ ID NO: 2—Amplified fragment of the Nicotiana tabacum trnH-psbA chloroplast intergenic spacer region (GenBank Accession No. FJ493313.1). The positions of the amplification primers are underlined.

[0148] AGAAAACAAAAGATTCAAGTTCG AATATAGCTCTTCTTTCTTATTTCAAAGATAAGAGATATTCAAAGATAAGAGATAAGAAGAAGTCAAAATTTGATTTTTTTTTTGGAAAAAAAAAATCAAAAAGATATAGTAACATTAGCAAGAAGAGAAACAAGTTCTATTTCTACAATTTTAAACAAATACAAAATCAAAATAGAATACTCAATCATGAATAAAT GCAAGAAAATAACCTCTCCTTC

[0149] SEQ ID NO:3—Forward amplification primer for amplifying the Nicotiana tabacum trnH-psbA chloroplast intergenic spacer region (GenBank accession number FJ493313.1)

[0150] AGAAAACAAAAGATTCAAGTTCG (optional 5' modification: AT550 dye)

[0151] SEQ ID NO:4—Reverse amplification primer for amplifying the Nicotiana tabacum trnH-psbA chloroplast intergenic spacer region (GenBank accession number FJ493313.1)

[0152] GCAAGAAAATAACCTCTCCTTC

[0153] PCR The PCR was performed in a 9700 thermal cycler (Applied Biosystems). The reaction mixture contained: TAM (True Allele PCR Master Mix, Applied Biosystems (ThermoFisher)): 6 μL; forward primer and reverse primer [10 μM] 0.3 μL; H2O 2.7 μL and DNA (5 ng to 10 ng) 1 μL.

[0154] The forward primer was labeled with a fluorescent dye to perform capillary electrophoresis.

[0155] These primers target chloroplast DNA in the intergenic spacer between the trnH gene and the psbA gene.

[0156] The following PCR reaction cycle was used: 95°C for 10 minutes; 95°C for 1 minute, 55°C for 1 minute and 72°C for 2 minutes for a total of 35 cycles; then 72°C for 7 minutes. After the PCR reaction, a denaturation step was performed at 95°C for 2 minutes with the following materials: 1 μL PCR product and 12 μL denaturation mixture (1950 μL HiDi formamide + 50 μL GeneScan 400HD ROX size standard). The GeneScan 400HD ROX size standard is a product of Applied Biosystems.

[0157] After denaturation, the fragments were run electrophoretically on an ABI 3130xl Genetic Analyzer (Applied Biosystems) using a 36 cm capillary array filled with POP7 polymer (Applied Biosystems).

[0158] The results were analyzed using GeneMapper v5.0 software (Applied Biosystems). The results were reviewed manually twice independently. The Nicotiana tabacum trnH-psbA chloroplast intergenic spacer allows the differentiation of Nicotiana tabacum from the sources of sterility of sweet and blue tobacco.

[0159] The fragment from Nicotiana tabacum was expected to be approximately 259 bp.

[0160] The fragment from Nicotiana tabacum was expected to be approximately 206 bp.

[0161] The fragment from Nicotiana tabacum was expected to be approximately 238 bp.

[0162] Example 2: Analysis of tobacco batches using the Nicotiana tabacum trnH-psbA chloroplast intergenic spacer

[0163] Tobacco lots of Nicotiana tabacum were obtained from tobacco farmers who were provided with seeds of sterile tobacco hybrids. Polynucleotides were extracted from the tobacco lots and analyzed using the methods described in Example 1.

[0164] Testing of various tobacco lots revealed that at least one of these tobacco lots had a Nicotiana tabacum trnH-psbA chloroplast intergenic spacer size of 206 bp, indicating that the tobacco lot contained sweet tobacco cytoplasm and was derived exclusively from seeds of a sterile tobacco hybrid.

[0165] Testing of various tobacco lots revealed that at least one of these tobacco lots had a Nicotiana tabacum trnH-psbA chloroplast intergenic spacer size of 238 bp, indicating that the tobacco lot contained Nicotiana tabacum cytoplasm and was derived exclusively from seeds of a sterile tobacco hybrid.

[0166] Testing of various tobacco batches revealed that at least one of these tobacco batches had a 259 bp Nicotiana tabacum trnH-psbA chloroplast intergenic spacer size, indicating that the tobacco batch contained Nicotiana tabacum cytoplasm and was derived from seeds in fertile tobacco seeds. This result indicates that sterile tobacco seeds were mixed with fertile tobacco material when offered for sale.

[0167] Example 3: Method for amplifying the tobacco trnL-trnF chloroplast intergenic region

[0168] PCR primers were designed to amplify the Nicotiana tabacum trnL-trnF chloroplast intergenic spacer region (GenBank accession number AH003085.2).

[0169] SEQ ID NO:5 - Intergenic spacer of the chloroplast genes trnL-trnF of common tobacco (GenBank accession number AH003085.2). The positions of the amplification primers are underlined.

[0170] TCAATGGTTCCAGTATAAATGAAAGAAAAAGAAAAAGGAATGACATCACAACGAGATCCTAATCTCAAAAAGAAAGGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAAT GCGTT GGTAGAGGAATCTTT ACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAAATCAAATGATTAATGATGACCCGAATCTGTATTTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCGATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAACCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTCACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTCTTTTAGAA ATGG ATTTGAGCGTAAATGGCTTTCTCTTATCACAAGTCTTGTGATATATATGATACACATAGAAATGAACGTCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCTATCAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGAGAAAATTTTTAATCTACTTTTGTCCTTGTAATTGACATAGACCCCAGTTCTCTAATAAAATGAGGATACTACATTGGGAAT AGCCGGGATAGCTCAGTTGGTAGCAGAGGACTGAAAATCCTCGTGTCACCAGTTCAAATCTGGTTCCTGGCACATGATTAATTTGTATGGGTCTCTCTTCCCTCGAATTAATTTCTAATTAATTGATATGAATCAACATACATATTCTTTTAGAGTCTAGATTAGAATAATAGCTTTATCCAGTTTGGCGAGATATACCCCATCTATGTTCTAGATGGGTAGAGTTTCTTAGATAAAGT

[0171] SEQ ID NO:6—Amplified fragment of the Nicotiana tabacum trnL-trnF chloroplast intergenic spacer region (GenBank Accession No. AH003085.2). The positions of the amplification primers are underlined.

[0172] GCGTTGGTAGAGGAATCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAAATCAAATGATTAATGATGACCCGAATCTGTATTTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCGATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAACCATTCACTCCATAGTCTGATAGATCTTTTGAAGAAC TGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTCACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTCTTTTAGAA ATGGATTTGAGCGTAAATGG

[0173] SEQ ID NO:7—Forward amplification primer for amplifying the Nicotiana tabacum trnL-trnF chloroplast intergenic spacer region (GenBank accession number AH003085.2)

[0174] GCGTTGGTAGAGGAATCTTT (5' modification: AT550 dye)

[0175] SEQ ID NO:8—Reverse amplification primer for amplifying the Nicotiana tabacum trnL-trnF chloroplast intergenic spacer region (GenBank accession number AH003085.2)

[0176] ATGGATTTGAGCGTAAATGG

[0177] PCR The PCR was performed in a 9700 thermal cycler (Applied Biosystems). The reaction mixture contained: TAM (True Allele PCR Master Mix, Applied Biosystems (ThermoFisher)): 6 μL; forward primer and reverse primer [10 μM] 0.3 μL; H2O 2.7 μL and DNA (5 ng to 10 ng) 1 μL.

[0178] The forward primer was labeled with a fluorescent dye to perform capillary electrophoresis.

[0179] These primers target chloroplast DNA in the intergenic spacer between the trnL and trnF genes.

[0180] The following PCR reaction cycle was used: 95°C for 10 minutes; 95°C for 1 minute, 55°C for 1 minute and 72°C for 2 minutes for a total of 35 cycles; then 72°C for 7 minutes. After the PCR reaction, a denaturation step was performed at 95°C for 2 minutes with the following materials: 1 μL PCR product and 12 μL denaturation mixture (1950 μL HiDi formamide + 50 μL GeneScan 400HD ROX size standard). The GeneScan 400HD ROX size standard is a product of Applied Biosystems.

[0181] After denaturation, the fragments were run electrophoretically on an ABI 3130xl Genetic Analyzer (Applied Biosystems) using a 36 cm capillary array filled with POP7 polymer (Applied Biosystems).

[0182] The results were analyzed using GeneMapper v5.0 software (Applied Biosystems). The results were reviewed manually twice independently. The Nicotiana tabacum trnL-trnF chloroplast intergenic spacer allows the differentiation of Nicotiana tabacum from the sources of sterility of sweet and blue tobacco.

[0183] The fragment from Nicotiana tabacum was expected to be approximately 483 bp.

[0184] The fragment from Nicotiana tabacum was expected to be approximately 477 bp.

[0185] The fragment from Nicotiana tabacum was expected to be approximately 467 bp.

[0186] Example 4: Analysis of tobacco batches using the Nicotiana tabacum trnL-trnF chloroplast intergenic spacer

[0187] Tobacco lots of Nicotiana tabacum were obtained from tobacco farmers who were provided with seeds of sterile tobacco hybrids. Polynucleotides were extracted from the tobacco lots and analyzed using the methods described in Example 3.

[0188] Testing of various tobacco lots revealed that at least one of the tobacco lots had a Nicotiana tabacum trnL-trnF chloroplast intergenic spacer size of 477 bp, indicating that the tobacco lot contained sweet tobacco cytoplasm and was derived exclusively from seeds of a sterile tobacco hybrid.

[0189] Testing of various tobacco lots revealed that at least one of these tobacco lots had a N. tabacum trnL-trnF chloroplast intergenic spacer size of 467 bp, indicating that the tobacco lot contained N. cerana cytoplasm and was derived exclusively from seeds of a sterile tobacco hybrid.

[0190] Tests of various tobacco batches revealed that at least one of these tobacco batches had a 483bp Nicotiana tabacum trnL-trnF chloroplast intergenic spacer size, thereby indicating that the tobacco batch contained Nicotiana tabacum cytoplasm and was derived from seeds in fertile tobacco seeds. This result indicates that sterile tobacco seeds were mixed with fertile tobacco material when offered for sale.

[0191] Example 5—Further Analysis of Tobacco Batches

[0192] The tobacco of common tobacco is obtained from the tobacco farmer who is provided with the seed of sterile tobacco hybrid in batches. Extract polynucleotide from tobacco in batches, and use the method described in embodiment 1 to analyze.Fragment expectation from common tobacco is about 259bp.Fragment expectation from sweet tobacco is about 206bp.Fragment expectation from powder blue tobacco is about 238bp.

[0193] The response to the first batch of tests is a single peak of 206bp in the sweet tobacco expected bin (the grey bar on the left side of the chromatogram). The merged samples showing this genotype mainly contain leaves from sterile plants. Also included in this group is a sample showing a little common tobacco signal (30% lower than the sweet tobacco peak height) at 259bp, which may be relevant to low-level pollution or low-level doping in the sample.

[0194] The response to the second batch of testing is the single peak at 259bp in the common tobacco expected bin (the grey bar on the right side of the chromatogram). The merged sample showing this genotype mainly contains the leaf from fertile plants. Also included in this group is the sample showing little sweet tobacco signal (30% lower than the common tobacco peak height) at 206bp, which may be relevant to low-level pollution or low-level admixture in the sample.

[0195] The response to the third batch tested was a peak at 206 bp in sweet tobacco and 259 bp in common tobacco, both peaks having similar peak heights. The pooled sample representing this genotype contained almost equal proportions of sterile and fertile material.

[0196] The response to the test of the 4th batch test article is the peak at 206bp in the sweet tobacco and the peak at 259bp in the common tobacco. Yet the peak height in the common tobacco bin represents about 30% or more of the sweet tobacco peak height. The merged sample that shows this genotype contains sterile material and fertile material of various ratios. In this merged sample, sterile material is more abundant, but the ratio of fertile plant cannot be ignored.

[0197] The threshold value of the Nicotiana tabacum peak height used to classify the samples in this group was chosen arbitrarily. However, the level of DNA amplification was high enough to exclude any contamination from neighboring samples and contamination from adulteration of fertile material with sterile crop material.

[0198] Any publication cited or described in this article provides relevant information disclosed before the filing date of this application. Statements herein should not be interpreted as admitting that the inventor loses the qualification prior to such disclosure. All publications mentioned in the above specification are incorporated herein by reference. Without departing from the scope and spirit of the present invention, various modifications and changes of the present invention will be obvious to those skilled in the art. Although the present invention has been described in conjunction with specific preferred embodiments, it should be understood that the present invention as required should not be unduly limited to such specific embodiments. In fact, different improvements to the described modes for realizing the present invention that are obvious to those skilled in the art of cell biology, molecular biology and plant biology or related fields are intended to be within the scope of the following claims.

[0199] Sequence (shown in 5'-3' direction)

[0200] SEQ ID NO:1 Nucleotide sequence of the chloroplast intergenic spacer region of Nicotiana tabacum trnH-psbA (GenBank accession number FJ493313.1)

[0201] ACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCCTCGCCTACTTACATTCCGTTTTTACATTATTTAAATTAGAAAACAAAAGATTCAAGTTCGAATATAGCTCTTCTTTCTTATTTCAATGATATTATTATTTCAAAGATAAGAGATATTCAAAGATAAGAGATAAGAAGAAGTCAAAATTTGATTTTTTTTTTGGAAAAAAAAAATCAAAAAGATATAGTAACATTAGCAAGAAGAGAAACAAGTTCTATTTCTACAATTTTAAACAAATACAAAATCAAAATAGAATACTCAATCATGAATAAATGCAAGAAAATAACCTCTCCTTCTTTTTCTATAATGTAAACAAAAAAGTCTATGTAAGTAAAATACTAGTAAATAAATAAAAAGAAAAAAAGAAAGGAGCAATAGCACCCTCTTGATAGAACAAGAAAATGATTATTGCTCCTTTCTTTTCAAAACCTCCTATAGACTAGGCCAGGATCTTATCCATTTGTAGATGGAGCTTCGATAGCAGCTAGGTCTAGAGGGAAGTTGTGAGCATTACGTTCATGCATAAC

[0202] SEQ ID NO:2: Amplified nucleotide sequence of the intergenic spacer of the chloroplast gene trnH-psbA from Nicotiana tabacum (GenBank accession number FJ493313.1)

[0203] AGAAAACAAAAGATTCAAGTTCGAATATAGCTCTTCTTTCTTATTTCAATGATATTATTATTTCAAAGATAAGAGATATTCAAAGATAAGAGATAAGAAGAAGTCAAAATTTGATTTTTTTTTTGGAAAAAAAAAATCAAAAAGATATAGTAACATTAGCAAGAAGAGAAACAAGTTCTATTTCTACAATTTTAAACAAATACAAAATCAAAATAGAATACTCAATCATGAATAAATGCAAGAAAATAACCTCTCCTTC

[0204] SEQ ID NO:3: Forward amplification primer for amplifying the trnH-psbA chloroplast intergenic spacer region of Nicotiana tabacum (GenBank accession number FJ493313.1)

[0205] AGAAAACAAAAGATTCAAGTTCG

[0206] SEQ ID NO:4: Reverse amplification primer for amplifying the trnH-psbA chloroplast intergenic spacer region of Nicotiana tabacum (GenBank accession number FJ493313.1)

[0207] GCAAGAAAATAACCTCTCCTTC

[0208] SEQ ID NO:5: Nucleotide sequence of the trnL-trnF chloroplast intergenic spacer region of Nicotiana tabacum (GenBank accession number AH003085.2)

[0209]

[0210] SEQ ID NO:6: Amplified nucleotide sequence of the Nicotiana tabacum trnL-trnF chloroplast intergenic spacer region (GenBank accession number AH003085.2)

[0211] GCGTTGGTAGAGGAATCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAAATCAAATGATTAATGATGACCCGAATCTGTATTTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCGATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAACCATTCACTCCATAGTCTGATAGATCTTTTGAAGAAC TGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTCACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTCTTTTAGAAATGGATTTGAGCGTAAATGG

[0212] SEQ ID NO:7: Forward amplification primer for amplifying the trnL-trnF chloroplast intergenic spacer region of Nicotiana tabacum (GenBank accession number AH003085.2)

[0213] GCGTTGGTAGAGGAATCTTT

[0214] SEQ ID NO:8: Reverse amplification primer for amplifying the trnL-trnF intergenic spacer region of Nicotiana tabacum chloroplasts (GenBank accession number AH003085.2)

[0215] CCATTTACGCTCAAATCCAT Sequence Listing <110> Philip Morris Products SA <120> Classification methods of plant materials <130> P10546EP <140> 18305638.1 <141> 2018-05-25 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 597 <212> DNA <213> Common tobacco (Nicotiana tabacum) <400> 1 acgggaattg aacccgcgca tggtggattc acaatccact gccttgatcc acttggctac 60 atccgccccc tcgcctactt acattccgtt tttacattat ttaaattaga aaacaaaaga 120 ttcaagttcg aatatagctc ttctttctta tttcaatgat attattattt caaagataag 180 agatattcaa agataagaga taagaagaag tcaaaatttg attttttttt tggaaaaaaa 240 aaatcaaaaa gatatagtaa cattagcaag aagagaaaca agttctattt ctacaatttt 300 aaacaaatac aaaatcaaaa tagaatactc aatcatgaat aaatgcaaga aaataacctc 360 tccttctttt tctataatgt aaacaaaaaa gtctatgtaa gtaaaatact agtaaataaa 420 taaaaagaaa aaaagaaagg agcaatagca ccctcttgat agaacaagaa aatgattatt 480 gctcctttct tttcaaaacc tcctatagac taggccagga tcttatccat ttgtagatgg 540 agcttcgata gcagctaggt ctagagggaa gttgtgagca ttacgttcat gcataac 597 <210> 2 <211> 259 <212> DNA <213> Common tobacco <400> 2 agaaaacaaa agattcaagt tcgaatatag ctcttctttc ttatttcaat gatattatta 60 tttcaaagat aagagatatt caaagataag agataagaag aagtcaaaat ttgatttttt 120 ttttggaaaa aaaaaatcaa aaagatatag taacattagc aagaagagaa acaagttcta 180 tttctacaat tttaaacaaa tacaaaatca aaatagaata ctcaatcatg aataaatgca 240 agaaaataac ctctccttc 259 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Forward primers for amplifying the trnH-psbA chloroplast intergenic spacer region of tobacco <400> 3 agaaaacaaa agattcaagt tcg 23 <210> 4 <211> twenty two <212> DNA <213> Artificial sequence e <220> <223> Reverse primers for amplifying the trnH-psbA chloroplast intergenic spacer region of Nicotiana tabacum (GenBank accession number FJ493313.1) <400> 4 gcaagaaaat aacctctcct tc 22 <210> 5 <211> 1260 <212> DNA <213> Common tobacco <400> 5 tcaatggttc cagtataaat gaaagaaaaa gaaaaaggaa tgacatcaca acgagatcct 60 aatctcaaaa agaaaggggg atatggcgaa atcggtagac gctacggact taattggatt 120 gagccttggt atggaaactt actaagtgat cactttcaaa ttcagagaaa ccctggaatt 180 aacaaaaatg ggcaatcctg agccaaatcc tgttttccga aaacaaacaa aggttcagaa 240 aaaaaggata ggtgcagaga ctcaatggaa gctattctaa caaatggagt taaatgcgtt 300 ggtagaggaa tctttacatc gaaacttcag aaagaaaaag aatgaagtga aggataaacg 360 tatatacata cgtattgaat actatatcaa aatcaaatga ttaatgatga cccgaatctg 420 tattttttct ataaaaaata gaagaattgg tgtgaatcga ttctacattg aagaaagaat 480 cgaatattca ttgatcaaac cattcactcc atagtctgat agatcttttg aagaactgat 540 taatcggacg agaataaaga tagagtcccg ttctacatgt caataccggc aacaatgaaa 600 tttatcgtaa gaggaaaatc cgtcgacttt aaaaatcgtg agggttcaag tcccttatc 660 cccaaaaaga ctatttcact cccaactat ttatccgacc cccattcctt agcggttcca 720 aattccttat ctttctcatt cactctattc ttttagaat ggattgagc gtaaatggct 780 ttctcttatc acagtcttg tgatatatat gatacacata gaaatgaacg tctttgagca 840 aggaatccct agttgaatga tccctatca attackcattac tcatactgaa acttacaag 900 tcatctttt gaagatcgaa gaattcccc ggctttgaga aaatttttaa tctactttg 960 tccttgtaat tgacatagac cccagttctc taaaaatg aggatactac attgggaata 1020 gccgggatag ctcagttggt agagcagagg actgaaaatc ctcgtgtcac cagttcaaat 1080 ctggttcctg gcacatgatt aatttgtatg ggtctctt ccctcgaatt aatttctaat 1140 tattgatat gatcacat acatattcttt tagagtcta tattgaat atagctttat 1200 ccagttttggc gagatatacc ccatctatgt tctagatgggg tagataagt 1260 <210> 6 <211> 483 <212> DNA <213> snowflake <400> 6 gcgttggtag aggaatcttt acatcgaaac ttcagaaaga aaaagaatga agtgaaggat 60 aaacgtatat acatacgtat tgaatactat atcaaaatca aatgattaat gatgacccga 120 atctgtattt tttctataaa aaatagaaga attggtgtga atcgattcta cattgaagaa 180 agaatcgaat attcattgat caaaccattc actccatagt ctgatagatc ttttgaagaa 240 ctgattaatc ggacgagaat aaagatagag tcccgttcta catgtcaata ccggcaacaa 300 tgaaatttat cgtaagagga aaatccgtcg actttaaaaa tcgtgagggt tcaagtccct 360 ctatccccaa aaagactatt tcactcccca actatttatc cgaccccctt tccttagcgg 420 ttccaaattc cttatctttc tcattcactc tattctttta gaaatggatt tgagcgtaaa 480 tgg 483 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primers for amplifying the trnL-trnF chloroplast intergenic spacer region of common tobacco <400> 7 gcgttggtag aggaatcttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primers for amplifying the trnL-trnF intergenic spacer region of tobacco chloroplasts <400> 8 ccatttacgc tcaaatccat 20

Claims

1. A method for classifying a batch of common tobacco (Nicotiana tabacum) plant material as contaminated or uncontaminated, comprising: (i) providing a polynucleotide sample from the batch of Nicotiana tabacum plant materials; (ii) contacting the polynucleotide sample with one or more amplification primers to amplify a target polynucleotide sequence associated with sterility, wherein the target polynucleotide sequence associated with sterility is selected from the trnH-psbA or trnL-trnF chloroplast intergenic spacer region; (iii) performing an in vitro polynucleotide amplification reaction on the sample to generate one or more amplification products; (iv) determining the size or sequence of the one or more amplification products; and (v) comparing the size or sequence of the one or more amplification products to the size or sequence of one or more amplification products known from a known genetic source of sterility, wherein the known genetic source of sterility is from Nicotiana suaveolens, Nicotiana glauca, Nicotiana bigelovii, Nicotiana plumbaginifolia, Nicotiana amegalosiphon or Nicotiana undulata; wherein if the genetic source of sterility determined in step (v) corresponds to the expected genetic source of sterility of the batch of tobacco plant material, the batch of tobacco plant material is considered to be uncontaminated; or Wherein if the genetic source of sterility determined in step (v) does not correspond to the expected genetic source of sterility of the batch of Nicotiana tabacum plant material, then the batch of Nicotiana tabacum plant material is considered to be contaminated.

2. The method of claim 1, wherein the target polynucleotide sequence associated with sterility is a polynucleotide sequence associated with cytoplasmic male sterility.

3. The method of claim 1, wherein the presence of a polynucleotide sequence associated with sterility from Nicotiana tabacum, Nicotiana pastel, Nicotiana indica, Nicotiana curvatum, Nicotiana meglongata, or Nicotiana wavyleaf indicates that the Nicotiana tabacum plant material is sterile.

4. The method of claim 3, wherein the polynucleotide sequence associated with sterility from Nicotiana tabacum or Nicotiana truncatum indicates that the Nicotiana tabacum plant material is sterile.

5. The method according to claim 1, wherein the trnH-psbA chloroplast intergenic spacer comprises or consists of the sequence shown in SEQ ID NO: 1, or the trnL-trnF chloroplast intergenic spacer comprises or consists of the sequence shown in SEQ ID NO:

5.

6. The method of claim 1, wherein the tobacco plant material is selected from the group consisting of seedlings, seeds, harvested plant material, cured plant material, or a combination of two or more thereof.

7. The method of claim 1, wherein the size of the amplification product is determined using gel electrophoresis; and / or wherein the sequence of the amplification product is determined using polynucleotide sequencing.

8. The method according to claim 7, wherein the gel electrophoresis is agarose gel electrophoresis or two-dimensional gel electrophoresis or capillary electrophoresis.

9. The method of claim 1, wherein the Nicotiana tabacum plant material is a sterile hybrid Nicotiana tabacum plant material.

10. The method according to any one of claims 1 to 9, wherein the expected genetic source of sterility is cytoplasmic male sterility from sweet tobacco, and wherein if the genetic source of sterility determined in step (v) corresponds to cytoplasmic male sterility from sweet tobacco, the batch of common tobacco plant material is considered to be uncontaminated; or wherein if the genetic source of sterility determined in step (v) does not correspond to cytoplasmic male sterility from sweet tobacco, the batch of common tobacco plant material is considered to be contaminated.

11. The method according to any one of claims 1 to 9, wherein the expected genetic source of sterility is cytoplasmic male sterility from Nicotiana tabacum, and wherein if the genetic source of sterility determined in step (v) corresponds to the cytoplasmic male sterility from Nicotiana tabacum, the batch of common tobacco plant material is considered to be uncontaminated; or wherein if the genetic source of sterility determined in step (v) does not correspond to the cytoplasmic male sterility from Nicotiana tabacum, the batch of common tobacco plant material is considered to be contaminated.

12. Use of two or more amplification primers specific for a polynucleotide sequence associated with sterility for classifying a batch of common tobacco plant material as contaminated or uncontaminated, wherein the target polynucleotide sequence associated with sterility is the trnH-psbA or trnL-trnF chloroplast intergenic spacer region from Nicotiana suaveolens, Nicotiana glauca, Nicotiana bigelovii, Nicotiana plumbaginifolia, Nicotiana megalosiphon or Nicotiana undulata.

13. The use according to claim 12, wherein the Nicotiana tabacum plant material is a sterile hybrid Nicotiana tabacum plant material.

14. A kit for classifying a batch of common tobacco plant material as contaminated or uncontaminated, comprising amplification primers specific for a polynucleotide sequence of the trnH-psbA or trnL-trnF chloroplast intergenic spacer region from Nicotiana tabacum, Nicotiana truncatum, Nicotiana indica, Nicotiana curvatum, Nicotiana meglongata or Nicotiana wavyleaf and instructions for performing the method according to any one of claims 1 to 11.

15. The kit according to claim 14, wherein the primer comprises or consists of SEQ ID NO: 3, 4, 7 or 8.