A DNA framework-wrapped G-quadruplex structure and its preparation method and application

Abstract

The present invention discloses a G-quadruplex structure wrapped by a DNA framework and its preparation method and application. The present invention is by mixing the 6 DNA sequences required for assembling the framework structure, the Cy3 sequence and the Cy5 sequence required for constituting the G-quadruplex probe in a buffer solution with a final concentration of 0.6 μM, and the sample is placed in a PCR instrument and annealed from 95°C to 4°C within 3.5 hours to obtain a G-quadruplex nanostructure (G4-F) wrapped by the DNA framework, and in the case of the target sequence (miR-122a) being missing, only green fluorescence from Cy3 appears. When the target sequence is present, the fluorescence resonance energy transfer process can be promoted, so that the Cy5 fluorescence is enhanced while the Cy3 fluorescence is weakened. The preparation method of the present invention is simple, low in cost, and the prepared G4-F can specifically detect the target of interest, is not disturbed by external environmental factors, has high stability, and the DNA framework structure can effectively protect the G-quadruplex probe from being degraded by intracellular substances in the cell, and can efficiently identify the target sequence and realize intracellular imaging detection.

Description

Technical Field

[0001] The invention belongs to the field of nanotechnology, and in particular relates to a G-quadruplex (G4-F) structure wrapped by a DNA framework, and a preparation method and application thereof. Background Art

[0002] With the development of modern society, there is an increasingly urgent need to develop fast and sensitive biosensors for rapid and accurate detection of clinical samples. Although there has been extensive research on biosensors, the development of accurate and sensitive biosensors still faces severe challenges. The development of DNA nanotechnology has brought new opportunities for early detection of cancer. Framework nucleic acids (FNA) have molecularly precise spatial organization characteristics and excellent programmability, and have great potential in the construction of biosensor devices. Moreover, it can be internalized into cells through energy-dependent endocytosis, so its biocompatibility and non-degradability give DNA nanostructures a huge advantage as a carrier to enter cells.

[0003] G-quadruplexes are rich in tandem repeats of guanine (G), and Hoogsteen hydrogen bonds connect four Gs to form a ring-shaped plane. Two or more tetrads form a quadruplex through π-π stacking. G-quadruplexes can exhibit catalytic ability in peroxidation reactions and enhance the fluorescence of certain porphyrin derivatives (such as protoporphyrin IX). Therefore, it has been used as a signal reporter gene in various biosensors. More importantly, G-quadruplexes can be divided into multiple independent fragments and reassembled in the presence of target sequences. Despite the multiple advantages of G-quadruplexes, it is still a challenge to use them for extracellular biosensing and detection in living cells due to their poor cell permeability and high background signals. Therefore, trying to combine DNA nanomaterials with G-quadruplexes is another novel strategy to enhance cell uptake and detection efficiency. Summary of the invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the object of the present invention is to provide a DNA framework-wrapped G-quadruplex (G4-F) structure and a preparation method and application thereof.

[0005] The present invention is achieved in this way: a G-quadruplex structure wrapped by a DNA framework, the G-quadruplex structure includes a framework structure composed of DNA chains that can enter cells and a linear G-quadruplex probe with miR-122a as a target wrapped in the framework structure, the two ends of the probe are respectively fixed on the borders of a pair of diagonal positions of the framework, and the middle of the probe is broken to modify Cy3 and Cy5 respectively; wherein, in the case of the absence of the target sequence miR-122a, only green fluorescence from Cy3 appears; when the target sequence exists, it can promote the fluorescence resonance energy transfer (FRET) process, so that the Cy3 fluorescence is weakened and the Cy5 fluorescence is enhanced.

[0006] Preferably, the framework structure is a DNA framework consisting of 10×21×21 bases.

[0007] The present invention further discloses a method for preparing the G-quadruplex (G4-F) structure wrapped by the above-mentioned DNA framework, which comprises the following steps: uniformly mixing 6 DNA sequences required for assembling the framework structure, and Cy3 sequence and Cy5 sequence required for constituting the G-quadruplex probe in a buffer solution at a final concentration of 0.6 μM, placing the sample in a PCR instrument and annealing the sample from 95° C. to 4° C. within 3.5 hours to obtain a G-quadruplex (G4-F) structure.

[0008] The present invention further discloses the application of the G-quadruplex (G4-F) structure wrapped by the DNA framework in the detection of miR-122a.

[0009] Preferably, the G-quadruplex (G4-F) structure wrapped by the DNA framework is used as a detector for intracellular miR-122a.

[0010] The present invention overcomes the deficiencies of the prior art and provides a DNA framework-wrapped G-quadruplex (G4-F) structure and a preparation method and application thereof. Figure 1 As shown, the present invention forms G4-F by integrating a G4 probe split into a Cy3 sequence and a Cy5 sequence into a DNA framework, and the G4 probe is evenly distributed in the solution. In this spatial orientation controllable framework, the spatial distance prevents the separated G-quadruplex fragments from forming a complete structure. The G4-F targets miR-122a. In the absence of miR-122a, only green fluorescence from Cy3 appears, indicating that no FRET occurs. When miR-122a is present, after the Cy3 sequence and the Cy5 sequence hybridize with the miRNA, the target assembles the split parts together to initiate FRET, that is, when the target is present, the target promotes the assembly of the complete G-quadruplex probe, resulting in the spatial proximity of the acceptor and donor fluorophores, thereby effectively allowing FRET to occur.

[0011] In the present invention, when the target concentration is in the range of 0 to 125 nM, the fluorescence signal is linearly correlated with the target concentration. The G4-F has a high specificity for the target, can specifically identify a fully matched target, and has low specificity for single-base and multi-base mutations. In addition, the G4-F of the present invention has structural stability and will not degrade in the presence of 0.3 U / ml DNaseI or 10% FBS. In addition, the G4-F has biocompatibility and detection stability, can work stably in complex biological environments, can successfully achieve intracellular miR-122a sensing, and can effectively protect the G-quadruplex probe relative to a single G-quadruplex, and has higher cell permeability and target hybridization ability.

[0012] Compared with the shortcomings and deficiencies of the prior art, the present invention has the following beneficial effects:

[0013] (1) The preparation method of the present invention is simple, environmentally friendly and low in cost;

[0014] (2) The G4-F prepared by the present invention can specifically detect the target, is not interfered by external environmental factors, and has high stability;

[0015] (3) The G4-F of the present invention can effectively protect the probe from being degraded by intracellular substances in cells, can efficiently identify the target sequence and realize intracellular imaging detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the structure formation and detection strategy of G4-F of the present invention;

[0017] Figure 2 This is an electrophoretic diagram of the products obtained by stepwise assembly of G4-F (0.5 μM) using 6% PAGE;

[0018] Figure 3 This is a result diagram of verifying the hybridization ability of the target with the split G-quadruplex by 8% PAGE;

[0019] Figure 4 is the AFM characterization image of the prepared G4-F;

[0020] Figure 5 It is the fluorescence spectra of G4-F (250 nM) after reacting with different concentrations of miR-122a (0-250 nM); wherein the wavelength recording range is 530 nm to 750 nm;

[0021] Figure 6 is Δ(F A / F D ) and the linear relationship between miR-122a concentration;

[0022] Figure 7It is a diagram of the mutation location of the mutation chain;

[0023] Figure 8 is the normalized F of the target and mutant chains A / F D ;

[0024] Fig. 9 is the structural integrity of G4-F analyzed by PAGE after incubation of G4-F with DNaseI (0.3 U / mL) or FBS (10% v / v) for different time intervals;

[0025] Fig.10 is the response of G4-F in different matrices containing different concentrations of target;

[0026] Fig.11 The results of G4-F imaging of cells using confocal laser scanning microscopy, scale bar: 10 μm; Fig.11 A is a confocal microscopy image of HeLa cells after incubation with target / G4-F; Fig.11 B is a confocal microscopy image of HeLa cells after incubation with target / G4-a / G4-b; Fig.11 C is a confocal microscopy image of HeLa cells after incubation with G4-F; Fig.11 D is a confocal microscopy image of Mir-122a-loaded HeLa cells incubated with G4-F. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0028] Example 1

[0029] The eight sequences used to assemble the DNA framework were first quantified to 100 μM, wherein the eight sequences included the six DNA sequences C1 to C6 required for assembling the framework structure, the Cy3 sequence C7a and the Cy5 sequence C7b required for constituting the G-quadruplex probe, and the linear G-quadruplex probe used miR-122a as the target, as shown in Table 1 below:

[0030] Table 1 DNA sequences related to the assembly of G-quadruplex framework

[0031]

[0032]

[0033] Then, the final concentration was 0.6 μM and mixed evenly in 100 μL of 1×TAMg buffer. The centrifuge tube was placed in a PCR instrument and the temperature was lowered from 95°C by 4°C for 3.5 hours to obtain a G-quadruplex structure wrapped by a DNA framework. Figure 1 shown.

[0034] Example 2

[0035] Prepare 6% PAGE gel with the formula of 5×TBE1.2mL, 30% Arc.Bis.1.2mL, triple distilled water 3.6mL, ammonium persulfate 60μL, TEMED6μL, and let it solidify at room temperature for 30 minutes. Anneal the eight chains, seven chains, six chains, five chains, four chains, three chains, two chains and single chain that form the tetrahedral DNA nanoframe to obtain samples of corresponding structures. Add 2μL of loading buffer to every 10μL of sample solution, mix well and add 10uL to the loading well, run at 90V in 1xTBE buffer for 1 hour, then stain the gel in 1% gel-red aqueous solution for 10 minutes, and finally develop in an imager. Figure 2 As can be seen in the figure, as the number of bands increases, the mobility gradually decreases, indicating the correct assembly of G4-F. In order to verify the hybridization ability of the target with the split G-quadruplex, the sequences corresponding to C7a, C7b, miR-122a, C7a / miR-122a and C7a / C7b / miR-122a were annealed to obtain samples of the corresponding structure, and the samples were characterized by 8% PAGE in the same way as above. Figure 3 ,It can be seen from the figure that the mobility of lanes 3 to 5 gradually decreases, indicating that the separated G-quadruplex can hybridize with the target.

[0036] Example 3

[0037] After incubation of the mica with 40 μL ((3-aminopropyl) triethoxysilane, APTES) (0.5%) for 5 minutes, the mica was rinsed with Milli-Q water and dried with N2. 10 μL of the sample dissolved in the buffer was incubated on the treated mica for 5 minutes. After rinsing, the buffer was added to a total volume of 100 μL. The G4-F structure was scanned for AFM imaging in DimensionIcon (Bruker) mode. The results are shown in Figure 2. Figure 4 shown.

[0038] Example 4

[0039] After annealing, G4-F was incubated with target sequences of different concentrations in 100 μL of medium at room temperature for 1 hour, and then the fluorescence signal was recorded with an emission wavelength of 488 nm and a wavelength range of 530 to 750 nm. Figure 5 As can be seen from the figure, as the target concentration gradually increases, the Cy3 fluorescence gradually decreases, while the Cy5 fluorescence gradually increases. Figure 6 It can be seen that when the target concentration is in the range of 0 to 250 nM, the relative fluorescence intensity is positively correlated with the target concentration.

[0040] Example 5

[0041] In order to verify the specific recognition ability of G4-F to the target, 6 base mutation sequences were designed, and the sequences are shown in Table 2 below:

[0042] Table 2 Base mutation sequence

[0043] name 5’-3’ M4 <![CDATA[UGG U GUGUGACAAUGGUGUGUUUG]]> M8 <![CDATA[UGGAGUG A GACAAUGGUGUUG]]> M15 <![CDATA[UGGAGUGUGACAAU C GUGUUUU]]> M19 <![CDATA[UGGAGUGUGACAAUGGUG A UUG]]> M4-8 <![CDATA[UGG U GUG A GACAAUGGUGUUG]]> M4-8-15 <![CDATA[UGG U GUG A GACAAU C GUGUUUU]]> Random AACTATACAACCTACTACCTCA miR-122a(Target) UGGAGUGUGACAAUGGUGUUUG

[0044] The corresponding mutation sites are Figure 7 As shown in the boxed bases, the prepared G4-F was incubated with the target and different mutant sequences for 1 hour, and the fluorescence signal was recorded. The emission wavelength was 488nm and the wavelength measurement range was 530-750nm. Figure 8 It can be seen that the fluorescence intensity of miR-122a is significantly higher than that of other mutant sequences, indicating that the G4-F prepared by the present invention has a specific recognition ability for the correct target.

[0045] Example 6

[0046] In order to verify the stability of G4-F, the stability of G4-F was characterized by non-denaturing PAGE. A 6% PAGE gel was prepared with a formula of 5×TBE1.2mL, 30% Arc.Bis.1.2mL, triple distilled water 3.6mL, ammonium persulfate 60μL, and TEMED6μL, and left at room temperature for 30 minutes to solidify. A 0.5μM G4-F sample was incubated with 0.3U / mlDnaseI or 10% FBS for 0, 10, 20, 30, 40, 50, and 60 minutes, respectively. Add to the gel loading wells and run at 90V for 1 hour in 1xTBE buffer, then the gel was stained in 1% gel-red aqueous solution for 10 minutes and finally developed in an imager. From Fig. 9 It can be seen that the band intensity did not change significantly within 60 minutes, indicating that G4-F is not easily degraded in complex biological matrices and has good stability.

[0047] Example 7

[0048] Human cervical cancer cells (HeLa) were cultured in DMEM medium supplemented with 10% fetal bovine serum, 100U / ml penicillin and 100μg / ml streptomycin at 37°C in an incubator containing 5% CO2. The cells were scraped off with a scraper and dispersed in PBS. The cell solution was ultrasonically crushed to obtain a cell lysate. The prepared G4-F was incubated with different concentrations of the target (0nM, 10nM, 100nM) in the buffer and cell lysate for 1 hour, and the fluorescence signal was recorded. Fig.10 It can be seen that the detection ability of G4-F for the target in cell lysate is similar to that in buffer, indicating that G4-F can operate robustly in complex biological matrices.

[0049] Example 8

[0050] Human cervical cancer cells (HeLa) were cultured in DMEM medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin and 100 μg / ml streptomycin at 37°C in an incubator containing 5% CO2. HeLa cells seeded in a confocal culture dish (15 mm) were incubated for 24 hours. After rinsing 3 times with PBS, 160 μL of DMEM medium containing 75 nM of different DNA structures was added. After incubation for 2 hours, the cells were rinsed 3 times to remove the DNA structures that were not internalized by the cells.

[0051] To monitor miRNA in cells, the miR-122a sequence (140 nM) was transfected into cells using LipoHigh transfection reagent. After rinsing with PBS, they were incubated with the corresponding DNA framework for 2 hours. Confocal laser scanning microscopy was used to image the miR-122a-loaded cells. Fig.11 As shown in the figure, Fig.11 The fluorescence of target / G4-a / G4-b in B is relative to Fig.11 The target / G4-F in A is weak, indicating that the single G-quadruplex probe is easily degraded by intracellular substances, while the DNA nanoframe can effectively protect the probe. Fig.11 The fluorescence intensity in C is low. Fig.11 In D, miR-122a-loaded HeLa cells were used. G4-F can effectively sense the target in miR-122a-loaded HeLa cells, and the FRET effect is obvious, and significantly enhanced Cy5 fluorescence can be seen, indicating that G4-F can successfully sense the target in cells and image in cells.

[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention. Sequence Listing <110> Nantong University <120> A DNA framework-wrapped G-quadruplex structure and its preparation method and application <141> 2020-10-09 <160> 16 <170> SIPOSequenceListing 1.0 <210> 1 <211> 68 <212> DNA <213> Artificial Sequence <400> 1 ccagccgccg ttctcctgga tccaaggctc taggtggtca ttcaggtaag tggccatcca 60 agctgcga 68 <210> 2 <211> 70 <212> DNA <213> Artificial Sequence <400> 2 ccactcccgt ttctgggatg ccatactcta actcagattc gctgattctg aatgaccttt 60 agcgttggct 70 <210> 3 <211> 67 <212> DNA <213> Artificial Sequence <400> 3 gataaggatt taggtctgcc ctttcgcagc ttggatggcc actttttcag cgaatctgag 60 ttagagt 67 <210> 4 <211> 68 <212> DNA <213> Artificial Sequence <400> 4 gagacagcca ggagaaatca aacagaggcc gcatgctggg gccgtacagt tccacaaagg 60 catcccag 68 <210> 5 <211> 70 <212> DNA <213> Artificial Sequence <400> 5 aatccttatc tttgcggcct ctttccgtat attcacgaaa aggagttcgg cggctggttg 60 ggcagaccta 70 <210> 6 <211> 67 <212> DNA <213> Artificial Sequence <400> 6 ctccttttcg tgaatatacg gtattgattt ctcctggctg tctcttacgg gagtggagcc 60 aacgcta 67 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <400> 7 tggaactgta catgaaacaa acaccatttt tgggtaggg 39 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <400> 8 gggttgggtt ttcacactcc atgaaaattg gatccagg 38 <210> 9 <211> 22 <212> RNA <213> Artificial Sequence <400> 9 ugguguguga caaugguguu ug 22 <210> 10 <211> 22 <212> RNA <213> Artificial Sequence <400> 10 uggagugaga caaugguguu and 22 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <400> 11 uggaguga caaucguguu and 22 <210> 12 <211> 22 <212> RNA <213> Artificial Sequence <400> 12 uggaguga caauggugau and 22 <210> 13 <211> 22 <212> RNA <213> Artificial Sequence <400> 13 uggugugaga caaugguguu and 22 <210> 14 <211> 22 <212> RNA <213> Artificial Sequence <400> 14 uggugugaga caaucguguu and 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <400> 15 aactatacaa cctactacct ca 22 <210> 16 <211> 21 <212> RNA <213> Artificial Sequence <400> 16 ggagugugac aaugguguuu g 21

Claims

1. A G-quadruplex structure wrapped by a DNA framework, characterized in that: The G-quadruplex structure includes a framework structure composed of DNA chains that can enter cells and a linear G-quadruplex probe with miR-122a as a target wrapped in the framework structure, wherein the two ends of the probe are respectively fixed on the borders of a pair of diagonal positions of the framework, and the middle of the probe is disconnected to modify Cy3 and Cy5 respectively; wherein, in the case of the absence of the target sequence miR-122a, only green fluorescence from Cy3 appears; when the target sequence exists, the fluorescence resonance energy transfer process can be promoted, so that the fluorescence of Cy3 is weakened and the fluorescence of Cy5 is enhanced; The framework structure is specifically a DNA framework consisting of 10×21×21 bases; The six DNA sequences required to assemble the framework structure are: C1: 5'-CCAGCCGCCGTTCTCCTGGATCCAAGGCTCTAGGTGGTCATTCAGGTAAGTGGCCATCCAAGCTGCGA-3'; C2: 5'-CCACTCCCGTTTCTGGGATGCCATACTCTAACTCAGATTCGCTGATTCTGAATGACCTTTAGCGTTGGCT-3'; C3: 5'-GATAAGGATTTAGGTCTGCCCTTTCGCAGCTTGGATGGCCACTTTTTCAGCGAATCTGAGTTAGAGT-3'; C4: 5'-GAGACAGCCAGGAGAAATCAAACAGAGGCCGCATGCTGGGGCCGTACAGTTCCACAAAGGCATCCCAG-3'; C5: 5'-AATCCTTATCTTTGCGGCCTCTTTCCGTATATTCACGAAAAGGAGTTCGGCGGCTGGTTGGGCAGACCTA-3'; C6: 5'-CTCCTTTCGTGAATATACGGTATTGATTTCTCCTGGCTGTCTCTTACGGGAGTGGAGCCAACGCTA-3'; The Cy3 sequence C7a and Cy5 sequence C7b required to form the G-quadruplex probe are: C7a: 5'-TGGAACTGTACA TGAAA CAAACACCATT TTTGGGTAGGG-Cy3-3'; C7b: 5'-Cy5-GGGTTTGGGTTT TCACACTCCA TGAAAATTGGATCCAG G-3'; The sequence of miR-122a is: miR-122a: 5'-UGGAGUGUGACAAUGGUGUUUG-3'.

2. The method for preparing the G-quadruplex structure wrapped by the DNA framework according to claim 1, characterized in that: The method comprises the following steps: mixing 6 DNA sequences required for assembling a framework structure, and Cy3 and Cy5 sequences required for forming a G-quadruplex probe in a buffer at a final concentration of 0.6 μM, placing the sample in a PCR instrument and annealing from 95° C. to 4° C. within 3.5 hours to obtain a G-quadruplex structure.

3. Use of the G-quadruplex structure wrapped by the DNA framework according to claim 1 in preparing a detection object of miR-122a.

4. The use according to claim 3, characterized in that The G-quadruplex structure wrapped by the DNA framework is used to prepare a detection object for intracellular miR-122a.

Images