Expression system for producing hyaluronic acid using non-pathogenic bacteria and method for producing hyaluronic acid using the expression system

Abstract

The present invention provides a hyaluronan synthase expression system, a transformation strain comprising the expression system, and a method for producing hyaluronan using the transformation strain. The expression system can synthesize hyaluronan and perform constitutive expression in a non-pathogenic strain even in the absence of an inducer.

Description

Technical Field

[0001] The present invention relates to an expression system using a constitutive expression promoter for producing hyaluronic acid using non-pathogenic bacteria, non-pathogenic bacteria including the expression system, and a method for producing hyaluronic acid using the non-pathogenic bacteria. Background Art

[0002] Hyaluronic acid is a biopolymer composed of disaccharide units of D-gluconic acid and N-acetyl-D-glucosamine, and is used for various purposes, such as a filler for molding, an arthritis therapeutic agent, and an adhesion inhibitor, depending on its molecular weight.

[0003] The hyaluronic acid can be produced by fermentation of Streptococcus spp. strains, which are infectious microorganisms and may be contaminated by pyrogenic substances during purification. In order to improve these problems, a method for producing hyaluronic acid by transforming GRAS (Generally Recognized As Safe) strains with recombinant vectors has been developed.

[0004] Korean Patent Registration Nos. 10-0879908 and 10-0885163 (US 2003 / 175902) disclose that an operon (composed of a hyaluronan synthase gene (hasA) derived from Streptococcus equisimilis, a UDP-glucose 6-dehydrogenase gene (tuaD) derived from Bacillus subtilis, and a UDP-glucose pyrophosphorylase (gtaB)) regulated by a constitutive expression promoter (Bacillus amyloliquefaciens α-amylase gene (amyQ) promoter) is inserted into the Bacillus subtilis genome to enable production of hyaluronic acid.

[0005] Subsequently, US 2016 / 0237465 disclosed that in order to increase the yield and molecular weight of hyaluronic acid, Bacillus subtilis was transformed with a plasmid containing an operon (composed of the hasA gene derived from Streptococcus zooepidemicus and the tuaD gene derived from Bacillus subtilis) regulated by an IPTG-inducible strong promoter (Pgrac), thereby showing improved yield and molecular weight.

[0006] However, in the case of the IPTG induction type, not only must the expensive inducer IPTG be used, but also the production process of the inducer treatment must be further performed. Therefore, if the yield of hyaluronic acid is not low, the constitutive expression type is more preferred. Summary of the invention

[0007] Technical issues

[0008] The object of the present invention is to provide an expression system or a recombinant vector which enables the synthesis of hyaluronic acid in a non-pathogenic strain in the absence of an inducer.

[0009] Another object of the present invention is to provide a strain into which an expression system has been introduced or a strain transformed by a recombinant vector and a method for producing hyaluronic acid using the strain.

[0010] Technical Solution

[0011] Provided herein is an expression system for producing hyaluronic acid, which comprises a UDP-glucose 6-dehydrogenase gene and a hyaluronan synthase gene; preferably, provided is an expression system for producing hyaluronic acid, which comprises an operably linked transcription promoter, a hyaluronan synthase gene, a ribosome binding site (RBS) of a UDP-glucose 6-dehydrogenase gene, and a UDP-glucose 6-dehydrogenase gene.

[0012] The inventors of the present invention are committed to creating a constitutive expression system with a high hyaluronic acid production yield, as will be described later, by selecting various promoters, the best promoter was selected, and the various ribosome binding sites (RBS) required for the expression of the tuaD gene in the operon composed of the hasA gene and the tuaD gene were compared, and the results confirmed the suitable site. Thus, the inventors of the present invention have produced an expression system for the production of hyaluronic acid and a non-pathogenic strain containing the expression system, the expression system is composed of a promoter and RBS with a higher hyaluronic acid production efficiency than using the IPTG inducible Pgrac promoter, and a method for producing hyaluronic acid using the expression system has been developed, thereby completing the present invention.

[0013] One embodiment of the present invention relates to a kind of expression system for producing hyaluronic acid, it comprises the transcription promoter, ribosome binding site, UDP-glucose 6-dehydrogenase gene and hyaluronan synthase gene that are operably connected.UDP-glucose 6-dehydrogenase gene and hyaluronan synthase gene can preferably configure an operon, and more preferably, it can be wherein hyaluronan synthase gene, RBS of UDP-glucose 6-dehydrogenase gene and UDP-glucose 6-dehydrogenase gene are sequentially connected by 5 ' to 3 ' direction.

[0014] Another embodiment of the present invention relates to a transformed strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, wherein the transformed strain comprises an expression system for producing hyaluronic acid.

[0015] Another embodiment of the present invention relates to a transformation strain for producing hyaluronic acid, the transformation strain comprises an expression system for producing hyaluronic acid, and preferably relates to a composition for producing hyaluronic acid, the composition comprises non-pathogenic bacteria. In addition, the present invention relates to a transformation strain for producing hyaluronic acid, the transformation strain comprises an expression system for producing hyaluronic acid, and preferably relates to a method for producing hyaluronic acid, the method comprising the step of culturing non-pathogenic bacteria.

[0016] The expression system for producing hyaluronic acid according to the present invention improves the production yield of hyaluronic acid and the molecular weight of hyaluronic acid, increases the safety in the hyaluronic acid building-up process, does not use expensive IPTG inducing agent, and therefore has the effect of reducing production costs. The molecular weight of the hyaluronic acid produced according to the present invention is 500kDa to 10000kDa, and has excellent advantages, such as moisturizing effect, viscosity increase, joint lubrication, hygroscopicity, elasticity, etc.

[0017] Hereinafter, the present invention will be described in more detail.

[0018] One embodiment of the present invention relates to an expression system for producing hyaluronic acid, which comprises a UDP-glucose 6-dehydrogenase gene and a hyaluronan synthase gene, and preferably relates to an expression system for producing hyaluronic acid, which comprises an operably linked transcription promoter, a ribosome binding site (RBS), a UDP-glucose 6-dehydrogenase gene and a hyaluronan synthase gene.

[0019] The expression system for producing hyaluronic acid provided by the present invention comprises UDP-glucose 6-dehydrogenase and hyaluronic acid synthase genes required for synthesizing hyaluronic acid, and can provide RBS and constitutive expression promoter required for gene expression, thereby producing hyaluronic acid even in the absence of a separate inducer.

[0020] The expression system for producing hyaluronic acid according to the present invention can be applied to Bacillus spp. strains, such as Bacillus subtilis or Bacillus licheniformis, but is not limited thereto.

[0021] The transcription promoter that is suitable for expression system of the present invention can be the constitutive expression promoter used in bacillus strain, therefore, this expression system produces the hyaluronan synthase of constitutive expression when there is no expression inducing agent.In addition, the transcription promoter can have following transcription level, and promptly hyaluronan output is 1.1 to 10 times of hyaluronan output of the transformed strain with the expression system that comprises P43 promoter.

[0022] The constitutive expression promoter can be, for example, P43, Pmsm, Ppbp, Pylb, Pyob, Pyqe or Pyvl, preferably, it can be Psigx, Pyob or Pyqe, but is not limited thereto. A constitutive expression promoter can be selected and used without limitation, as long as the constitutive expression promoter can obtain a hyaluronic acid yield similar or higher than that of an inducible promoter. The Psigx promoter can be obtained from the genome of Bacillus subtilis 168 strains using primers of SEQ ID NO:53 and 54 by PCR (Bacillus Genetic Stock Center). Psigx, Pyob or Pyqe promoters can include the nucleotide sequences of SEQ ID NO:62, SEQ ID NO:63 or SEQ ID NO:64, respectively. Specific examples of promoters that can be used for the present invention are shown in Table 1 below, and specific primer sets for producing each promoter are shown in Table 2 below.

[0023] [Table 1]

[0024]

[0025]

[0026] [Table 2]

[0027]

[0028] In one embodiment of the present invention, as a result of transforming a vector containing an operon into Bacillus subtilis using the Psigx promoter, the production yield of hyaluronic acid is almost the same as that of the case of using an inducible promoter requiring an IPTG inducer ( Figure 4 ). Therefore, it can be seen that the Psigx promoter is a constitutive expression promoter suitable for hyaluronic acid production.

[0029] The transcription promoter may be a promoter having a hyaluronic acid-producing ability that is 1.1 to 10 times, 1.15 to 10 times, 1.5 to 10 times, 2 to 10 times, 3 to 10 times, 4 to 10 times, 5 to 10 times, 1.1 to 9 times, 1.15 to 9 times, 1.5 to 9 times, 2 to 9 times, 3 to 9 times, 4 to 9 times, 5 to 9 times, 1.1 to 8 times, 1.15 to 8 times, 1.5 to 8 times, 2 to 8 times, 3 to 8 times, 4 to 8 times, 5 to 8 times, 1.1 to 10 times, 1.15 to 10 times, 1.5 to 10 times, 2 to 10 times, 3 to 10 times, 4 to 10 times, 5 to 10 times, 1.1 to 9 times, 1.15 to 9 times, 1.5 to 9 times, 2 to 9 times, 3 to 9 times, 4 to 9 times, 5 to 9 times, From 1 to 7 times, 1.15 to 7 times, 1.5 to 7 times, 2 to 7 times, 3 to 7 times, 4 to 7 times, 5 to 7 times, 1.1 to 6.5 times, 1.15 to 6.5 times, 1.5 to 6.5 times, 2 to 6.5 times, 3 to 6.5 times, 4 to 6.5 times, 5 to 6.5 times, 1.1 to 6 times, 1.15 to 6 times, 1.5 to 6 times, 2 to 6 times, 3 to 6 times, 4 to 6 times, 5 to 6 times, 1.1 to 5.5 times, 1.15 to 5.5 times, 1.5 to 5.5 times, 2 to 5.5 times, 3 to 5.5 times, 4 to 5.5 times, or 5 to 5.5 times.

[0030] The ribosome binding site (RBS) suitable for the expression system of the present invention can produce hyaluronic acid in Bacillus by expressing tuaD gene and hasA gene. RBS can translate the gene encoding UDP-glucose 6-dehydrogenase at a high level, and the ribosome binding site can show that the hyaluronic acid yield is 1.1 to 3 times, 1.15 to 3 times, 1.2 to 3 times, 1.1 to 2.5 times, 1.15 to 2.5 times, 1.2 to 2.5 times, 1.1 to 2 times, 1.15 to 2 times, 1.2 to 2 times, 1.1 to 1.5 times, 1.15 to 1.5 times, 1.15 to 1.5 times, 1.1 to 1.3 times, 1.15 to 1.3 times, or 1.2 to 1.3 times of the hyaluronic acid yield when using tuaD RBS.

[0031] For example, the RBS can be BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035, the RBS of the tuaD gene (tuaD RBS) or the RBS of the pET plasmid, each of which can include the nucleotide sequence of SEQ ID NO: 65 to 72, as shown in Table 3 below.

[0032] [Table 3]

[0033] name SEQ ID NO Nucleotide sequence BBa_B0030-RBS 65 attaaagaggagaaatactag BBa_B0031-RBS 66 tcacacaggaaacctactag BBa_B0032-RBS 67 tcacacaggaaagtactag BBa_B0033-RBS 68 tcacacaggactactag BBa_B0034-RBS 69 aaagaggagaaatactag BBa_B0035-RBS 70 attaaagaggagaatactag RBS_tuaD 71 gacactgcgaccattataaattggaagatcattttacaggagagggttgagcgct RBS_pET 72 aataattttgtttaactttaagaaggagatatacat

[0034] In one embodiment of the present invention, when BBa_B0034 was used as RBS, it showed a better yield than when tuaDRBS was used, and unlike the fact that BBa_B0035 showed excellent expression efficiency compared to BBa_B0034 as previously known, when the BBa_B0034 RBS sequence was used, the production yield of hyaluronic acid was the highest ( Figure 5 ). The expression system for producing hyaluronic acid according to the present invention comprises a UDP-glucose 6-dehydrogenase gene and a hyaluronan synthase gene, wherein the two genes can preferably configure an operon, and more preferably, wherein the hyaluronan synthase gene, the RBS of the UDP-glucose 6-dehydrogenase gene and the UDP-glucose 6-dehydrogenase gene are sequentially connected in the 5' to 3' direction.

[0035] The UDP-glucose 6-dehydrogenase gene according to the present invention can be, for example, a tuaD gene or a variant thereof. As the tuaD gene, the tuaD gene derived from a species known to have the tuaD gene can be used without restriction. For example, it can be a tuaD gene derived from a Bacillus strain, preferably a tuaD gene derived from a Bacillus subtilis strain. The tuaD gene can preferably be a tuaD gene of a Bacillus subtilis 2217 strain, but is not limited thereto. The tuaD gene can be a tuaD gene into which appropriate mutations are introduced when necessary. The tuaD gene can be freely modified and used within the scope of not affecting the UDP-glucose 6-dehydrogenase activity. In one embodiment of the present invention, the tuaD gene can include the nucleotide sequence of SEQ ID NO:73.

[0036] In one embodiment of the present invention, the ribosome binding site and tuaD were obtained from Bacillus subtilis 2217 strain by polymerase chain reaction (PCR) using the primer pair of SEQ ID NO: 37 and 38.

[0037] The hyaluronan synthase gene can be, for example, a hasA gene or a mutant thereof. As the hasA gene, the hasA gene derived from a species known to have the hasA gene can be used without restriction, for example, it can be a Streptococcus spp. strain, preferably a strain derived from Streptococcus zooepidemicus. The mutant of the hasA gene can include the mutation of all genes in the range of maintaining the active synthesis of hyaluronic acid. In one embodiment of the invention, the hasA gene can be a gene encoding a protein consisting of an amino acid sequence of SEQ ID NO:74 or 76, and preferably can include a nucleotide sequence of SEQ ID NO:75 or 77.

[0038] In one embodiment of the present invention, the hasA gene as the hyaluronan synthase gene was obtained from Streptococcus zooepidemicus by a two-step DNA synthesis method based on PCR using primers of SEQ ID NOs: 1 to 36 (Table 4).

[0039] Specifically, DNA fragment 1 was prepared using primers of SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were prepared using SEQ ID NOs: 12 to 24 and SEQ ID NOs: 25 to 36, respectively. In order to obtain the full-length hasA gene, the obtained DNA fragments 1, 2, and 3 were mixed, and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36.

[0040] [Table 4]

[0041]

[0042]

[0043] One embodiment of the present invention can be a transformed strain or a recombinant strain for the production of hyaluronic acid, and the transformed strain or the recombinant strain comprise an expression system for the production of hyaluronic acid. The strain can be a GRAS level strain, and can be a gram-positive bacteria, such as bacillus (Bacillus spp.) strain, preferably bacillus subtilis or bacillus licheniformis. The safety in the hyaluronic acid building-up process can be improved by using GRAS level strains. In one embodiment of the present invention, the expression system for the production of hyaluronic acid is introduced into bacillus subtilis 2217 strains, even if there is no inducing agent such as IPTG to obtain the bacterial strain producing hyaluronic acid.

[0044] The present invention relates to a method for producing hyaluronic acid using non-pathogenic bacteria, the method comprising the step of cultivating a transformed strain containing a hyaluronic acid expression system for producing hyaluronic acid. More specifically, in addition to the step of cultivating a transformed strain for producing hyaluronic acid, the method for producing hyaluronic acid according to the present invention may further comprise the step of separating and / or purifying hyaluronic acid. For example, the method may comprise the step of removing the strain from the culture medium, and the step of precipitating hyaluronic acid in the culture medium having removed the strain.

[0045] In the transformed strain for producing hyaluronic acid and the method for producing hyaluronic acid, the transcription promoter, the hyaluronic acid synthase gene, the ribosome binding site for expression of the UDP-glucose 6-dehydrogenase gene, the UDP-glucose 6-dehydrogenase gene and the like are as described above.

[0046] By constitutively expressing the promoter, the method for producing hyaluronic acid using the recombinant strain according to the present invention can show a hyaluronic acid yield equal to or higher than that when using an inducible promoter even in the absence of an inducer (such as IPTG).

[0047] The step of culturing the strain may use sucrose as a carbon source, but is not limited thereto. The culturing of the strain, the removal of the strain and the precipitation of hyaluronic acid may be performed by methods known in the art, and may be appropriately modified and used by those skilled in the art as needed.

[0048] The method of producing hyaluronic acid may further include a step of concentrating, purifying, or concentrating and purifying the hyaluronic acid after the precipitation step of the hyaluronic acid.

[0049] The molecular weight of the hyaluronic acid obtained using the above production method may be 100 to 10,000 kDa, 500 to 10,000 kDa, 500 to 8,000 kDa, 3,000 to 8,000 kDa, or 5,000 to 6,000 kDa.

[0050] In one embodiment of the present invention, the ultra-high molecular weight hyaluronic acid of 5,455kDa can be obtained from the bacillus bacteria introduced into the hyaluronic acid synthesis system.Compared with low molecular weight hyaluronic acid, this high molecular weight hyaluronic acid has excellent properties, such as moisturizing effect, viscosity increase, joint lubrication, hygroscopicity, elasticity etc. Therefore, high molecular weight hyaluronic acid has very high practical value as the pharmaceutical product of such as knee injection, eye drops and the filler for molding.Especially, the decomposition rate in vivo of hyaluronic acid (such as hyaluronic acid produced by using expression system provided by the invention) with ultra-high molecular weight of 3000kDa or higher is slower, therefore can be used as adhesion inhibitor.

[0051] In addition, in order to convert low molecular weight hyaluronic acid into high molecular weight hyaluronic acid, it is troublesome to handle a crosslinking agent or a compound and go through a complicated process, while the process of converting high molecular weight hyaluronic acid into low molecular weight hyaluronic acid has an advantage of being relatively easy using a physical or chemical method.

[0052] Beneficial Effects

[0053] The strain for synthesizing hyaluronic acid of the present invention is a non-pathogenic strain, which increases the safety during the synthesis of hyaluronic acid and does not use expensive IPTG inducer as an expression inducer, thereby reducing production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1A vector map of the pHCMC02-hasA-RBS34-tuaD plasmid produced according to one embodiment of the present invention is shown.

[0055] Figure 2 Schematic diagram of the cloning process of pHCMC02-hasA-RBS34-tuaD plasmid produced according to one embodiment of the present invention.

[0056] Figure 3 Graph showing the relative concentrations of hyaluronic acid produced after introduction of expression systems comprising various promoters into Bacillus strains according to one embodiment of the present invention.

[0057] Figure 4 Graph showing the relative concentrations of hyaluronic acid produced when using the constitutive expression promoter Psigx and the IPTC-inducible promoter Pgrac according to one embodiment of the present invention.

[0058] Figure 5 Graph depicting the relative concentrations of hyaluronic acid produced when various ribosome binding sites are used, according to one embodiment of the present invention.

[0059] Figure 6 : is a graph showing the results of infrared spectroscopic analysis of a commercially available hyaluronic acid standard and hyaluronic acid purified from the culture medium of a recombinant strain according to one embodiment of the present invention.

[0060] Figure 7 is the result of measuring the molecular weight of hyaluronic acid purified from the culture medium of the recombinant strain according to one embodiment of the present invention using a multi-angle laser light scattering (MALLS) detector. DETAILED DESCRIPTION

[0061] Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following Examples are for explaining the present invention, and the scope of the present invention is not limited to the description of these Examples.

[0062] Example 1: Cloning of hasA and tuaD operons

[0063] 1-1: Cloning of the hyaluronan synthase gene (hasA)

[0064] Using the primers of SEQ ID NO: 1 to 36 shown in Table 4, the hyaluronic acid synthase gene (hasA, Genbank No. AY173078 nucleotide sequence 1 to 1254) (SEQ ID NO: 75) derived from Streptococcus zooepidemicus was synthesized by a two-step DNA synthesis method based on PCR (PTDS; Xiong, 2004, Nucleic Acids Research 32: e98). Specifically, DNA fragment 1 was prepared using SEQ ID NO: 1 to 12, and similarly, DNA fragments 2 and 3 were prepared using SEQ ID NO: 13 to 24 and 25 to 36, respectively. In order to obtain the full-length hasA gene, the obtained DNA fragments 1, 2 and 3 were mixed, and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36 to obtain the hasA gene. The PCR conditions were: using Thermal cycler (applied biosystem), 94 ℃ denaturation 15 seconds, 55 ℃ annealing 15 seconds, 72 ℃ extension 1 minute 30 seconds, these steps are carried out 25 cycles in total. The hasA gene derived from zooepidemic streptococcus is used as the hyaluronan synthase gene, and the primers (Table 4) of SEQ ID NO:1 to 36 are used to obtain the full-length hasA gene by the above method. The full-length hasA gene obtained is cut with restriction enzymes BamHI and XbaI, and the pHCMC02 (Bacillus Genetic Reserve Center) plasmid cut by BamHI and XbaI is connected with T4 DNA ligase (NEB). The vector is imported into Escherichia coli DH5α (Enzynomics), coated on an agar plate medium containing ampicillin, and the plasmid pHCMC02-hasA is isolated from the ampicillin-resistant transformant obtained. The plasmid pHCMC02-hasA obtained has been confirmed by nucleotide sequence analysis, and the hasA gene is normally cloned.

[0065] 1-2: Cloning of UDP-glucose 6-dehydrogenase gene (tuaD)

[0066] In order to produce hyaluronic acid in Bacillus strains, hyaluronic acid synthase alone is insufficient and UDP-glucose 6-dehydrogenase must be co-expressed (Winder, 2005, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 71: 3747-3752). For this purpose, the operon consisting of hasA and tuaD must be complete.

[0067] In order to configure the operon, since RBS (ribosome binding site) must be present in front of the tuaD gene, the tuaD gene was amplified by using DNA of Bacillus subtilis 2217 strain (Korean Collection of Type Cultures (KCTC)) as a template and using RBS tuaD_forward primer of SEQ ID NO: 37 and RBS_tuaD_reverse primer of SEQ ID NO: 38 so that RBS34 (BioBrick BBa_B0034) was included at the 5' end of the tuaD gene. PCR was performed, the steps of which were: using Thermal cycler (applied biosystem), denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute 30 seconds, for a total of 30 cycles.

[0068] SEQ ID NO:37:5'-aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg-3'

[0069] SEQ ID NO:38:5'-gggttataaattgacgcttcccaagtctttagccaatt-3'

[0070] The amplified RBS34-tuaD gene was cut with restriction enzyme XbaI, and the pBluescriptII SK+ (Stratagene) plasmid cut with XbaI and SmaI was ligated with T4 DNA ligase (NEB). It was introduced into Escherichia coli DH5α (Enzynomics), spread on agar plate medium containing ampicillin, and the plasmid pBSIISK-RBS34-tuaD was isolated from the obtained ampicillin-resistant transformant. The nucleotide sequence of the obtained plasmid pBSIISK-RBS34-tuaD, Genbank No. AF015609, was confirmed by nucleotide sequence analysis. bp (protein coding site of tuaD gene, SEQ ID NO: 73) was cloned normally.

[0071] 1-3: Cloning of hasA and tuaD operons

[0072] In order to complete the operon consisting of hasA and tuaD genes, pBSIISK-RBS34-tuaD obtained in Example 1-2 was cut with restriction enzymes XbaI and SmaI, the cut RBS34-tuaD gene was treated with the same restriction enzymes, and the pHCMC02-hasA plasmid obtained in Example 1-1 was ligated with T4 DNA ligase (NEB). It was introduced into Escherichia coli DH5α (Enzynomics), spread on an agar plate medium containing ampicillin, and the plasmid pHCMC02-hasA-RBS34-tuaD was isolated from the obtained ampicillin-resistant transformant. Figure 1 and Figure 2 The vector map and schematic diagram of the cloning process of pHCMC02-hasA-RBS34-tuaD are shown respectively.

[0073] Example 2: Selection of a promoter for expression of the hasA-tuaD operon

[0074] The expression of the hasA-tuaD operon in the plasmid pHCMC02-hasA-RBS34-tuaD prepared in Example 1 is regulated by the PlepA promoter, and it is known that the PlepA promoter has weak activity. Therefore, the PlepA promoter is replaced with various promoters to select a promoter with high hasA-tuaD operon expression activity. The candidate promoter is selected as a promoter with higher expression activity compared to the constitutive expression promoter P43 used in Bacillus strains (Yu, 2015, Scientific Reports, 5: 18405; Song, 2016, PLoS One. 11: e0158447).

[0075] To construct plasmids regulated by each tested promoter, Bacillus subtilis 168 strain DNA (Bacillus Genetic Stock Center) was used as a template and amplified by PCR using the primers listed in Table 2 above. Specifically, forward and reverse primers for the PP43 promoter (SEQ ID NOs: 39 and 40), forward and reverse primers for the Pmsm promoter (SEQ ID NOs: 41 and 42), forward and reverse primers for the Ppbp promoter (SEQ ID NOs: 43 and 44), forward and reverse primers for the Pylb promoter (SEQ ID NOs: 45 and 46), forward and reverse primers for the pyob promoter (SEQ ID NOs: 47 and 48), forward and reverse primers for the Pyqe promoter (SEQ ID NOs: 49 and 50), forward and reverse primers for the Pyv1 promoter (SEQ ID NOs: 51 and 52), and forward and reverse primers for the Psigx promoter (SEQ ID NOs: 53 and 54) were used.

[0076] Each promoter amplified by PCR was cut with restriction enzymes NheI and BamHI, and pHCMC02-hasA-RBS34-tuaD of Example 1 cut with the same restriction enzymes was ligated with T4 DNA ligase (NEB). It was introduced into Escherichia coli DH5α (Enzynomics), spread on an agar plate medium containing ampicillin, and each plasmid was isolated from the obtained ampicillin-resistant transformant. It was confirmed by nucleotide sequence analysis that each promoter was normally cloned in each isolated plasmid.

[0077] Plasmids having different promoters were introduced into Bacillus 2217 strain by electroporation (Sun, 2015, Applied Microbiology and Biotechnology, 99: 5151-5162) to prepare a transformed strain resistant to chloramphenicol.

[0078] Next, each transformed strain was inoculated into LB medium and cultured overnight. 0.2 mL of the strain cultured overnight was inoculated into 20 mL of sucrose medium (50 g sucrose, 20 g yeast extract and 1.5 g magnesium sulfate (MgSO4) 50 mM potassium phosphate (pH 7.0)) contained in a 250 mL conical flask, and then cultured at 37 ° C with 180 rpm shaking. Each culture solution was taken out 65 hours after the start of culture, centrifuged at 10,000 rpm for 1 minute, and then passed through a 0.45 μm filter to remove the strain.

[0079] 3 volumes of ethanol were added to the culture medium from which the strain was removed, allowed to stand at 4°C for 2 hours, and centrifuged at 15,000 rpm for 10 minutes at 4°C to precipitate hyaluronic acid. The precipitated hyaluronic acid was dried and dissolved in water, and then the hyaluronic acid content was measured using a HA quantitative detection kit (Corgenix, Westminster, CO, USA). The content (g / L) of hyaluronic acid produced by the transformant strain containing the constitutively expressed promoter P43 was set to 100, and the relative content of hyaluronic acid produced by the transformant strain containing the test promoter was indicated, and is shown in Tables 5 and 6. Figure 3 The percentage is shown in %.

[0080] [Table 5]

[0081] Promoter Relative production capacity of hyaluronic acid (%) P43 100.0±4.2 Pm 15.1±1.9 Ppb 3.9±0.8 Pylb 38.1±2.3 pyob 31.6±7.1 Pyq 134.3±6.7 Pyvl 15.0±11.1 Psig 488.2±13.4

[0082] Figure 3The relative hyaluronic acid content produced by the transformation strain containing every kind of promoter is illustrated.Confirmed that Psigx promoter (SEQ ID NO:62), Pyob promoter (SEQ ID NO:63) and pyqe promoter (SEQ ID NO:64) have higher expression level than P43 promoter, and especially, Psigx promoter produces hyaluronic acid more effectively than other promoters.Subsequently, the plasmid having cloned Psigx promoter was named as pSigx-hasA-RBS34-tuaD.

[0083] Example 3: Hyaluronic acid yield of Psigx promoter

[0084] In order to compare the expression efficiency of the IPTG-inducible promoter Pgrac with the expression efficiency of the Psigx promoter selected as a constant expression promoter with high expression efficiency in Example 2, the Psigx promoter of the pSigx-hasA-RBS34-tuaD plasmid was replaced with the IPTG-inducible Pgrac promoter to produce pgrac-hasA-RBS34-tuaD.

[0085] Specifically, in order to replace the promoter, pHT01 plasmid (Mobitec) was cut with restriction enzymes NheI and BamHI to separate Laci and Pgrac promoters, Laci and Pgrac promoters were cut with the same restriction enzymes, and pSigx-hasA-RBS34-tuaD having removed the Psigx promoter was connected with T4 DNA ligase (NEB). It was imported into Escherichia coli DH5α (Enzynomics), coated on an agar plate medium containing ampicillin, and plasmid Pgrac-hasA-RBS34-tuaD was isolated from the ampicillin-resistant transformant obtained. The isolated plasmid was imported into the bacillus 2217 strain by electroporation to complete the transformed strain resistant to chloramphenicol.

[0086] The production yield of hyaluronic acid of the transformed strain in which the expression of the synthase associated with hyaluronic acid production was regulated by the intact PTG inducible Pgrac promoter was compared with the production yield of hyaluronic acid of the strain in which the synthase associated with hyaluronic acid production was constitutively expressed in the Psigx promoter according to Example 2. Each strain was cultured in substantially the same manner as in Example 2, and the culture fluid was taken after 65 hours of cultivation. However, in the case of the IPTG induction type, the strain cultured overnight was inoculated into a sucrose medium to induce the expression of the synthase. After 2 hours, IPTG was added so that IPTG became 0.5mM. In the case of the induction type, the culture fluid was taken out at 72 hours. The hyaluronic acid production capacity of the two strains was measured in substantially the same manner as in Example 2, and the results are shown in Figure 4 middle.

[0087] like Figure 4 As shown, it was confirmed that the two strains had almost the same yield. Thus, a method for producing hyaluronic acid was established cheaply and simply compared to the induction type using expensive IPTG.

[0088] Example 4: Selection of RBS for overexpression of tuaD gene

[0089] D-glucuronic acid is a component of hyaluronic acid, and it can be produced by the tuaD gene originally possessed by bacillus. However, in order to effectively produce hyaluronic acid, it is necessary to overexpress the tuaD gene. For this reason, as mentioned above, hasA gene and tuaD gene are produced in the form of an operon, to induce tuaD gene to overexpress together with hasA gene. In order to configure the operon, it is necessary to have a highly active RBS sequence at the 5' end of the tuaD gene to regulate the translation of the tuaD gene. Because the activity of RBS depends on the background of the sequence, it can be different (Mutalik, 2013, Nature Methods, 10: 347-353) according to the sequence of the gene to be regulated. Due to these reasons, the RBS selection process that is advantageous to the actual translation of tuaD and is therefore suitable for hyaluronic acid production has been carried out.

[0090] Specifically, for RBS selection, 6 synthetic RBSs (BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035) from the BioBrick Registry of standard biological parts, the natural RBS of the tuaD gene (tuaD RBS) and the RBS of commonly used plasmids (such as pET) (RBS) were compared. The 8 RBS sequences tested are shown in Table 3. In order to ensure that the tuaD gene is included at the 5' end of each RBS sequence, PCR was performed by using the primers shown in Table 4 and SEQ ID NO:38 and using DNA from Bacillus subtilis 168 strain (Bacillus Genetic Reserve Center) as a template.

[0091] The tuaD gene including each amplified RBS was cut with XbaI, and the pSigx-hasA-RBS34-tuaD plasmid in which RBS34-tuaD was deleted by cutting with XbaI and SmaI was ligated with T4 DNA ligase (NEB). This was introduced into Escherichia coli DH5α (Enzynomics), spread on an agar plate medium containing ampicillin, and each plasmid was isolated from the obtained ampicillin-resistant transformant. It was confirmed by nucleotide sequence analysis that the tuaD gene including RBS corresponding to each isolated plasmid was cloned.

[0092] [Table 6]

[0093]

[0094]

[0095] By electroporation therapy, the plasmid with mutually different RBS obtained above is imported into Bacillus subtilis 2217 strains, to produce the transformed strain resistant to chloramphenicol. Next, the strain of each transformation is cultivated in a manner substantially the same as Example 2, culture medium is taken, and the content of hyaluronic acid is measured. The content (g / L) of hyaluronic acid produced by the strain transformed with the RBS of pET plasmid is set to 100, indicating the relative content of hyaluronic acid produced by the transformed strain comprising the test RBS sequence, and the results are shown in Tables 7 and 8. Figure 5 Displayed in.

[0096] [Table 7]

[0097] RBS Type Relative production capacity of hyaluronic acid (%) BBa_B0030-RBS 83.6±8.9 BBa_B0031-RBS 4.2±1.4 BBa_B0032-RBS 4.7±0.5 BBa_B0033-RBS 5.7±0.9 BBa_B0034-RBS 123.3±1.8 BBa_B0035-RBS 80.5±1.0 TUaD 75.7±9.5 pET RBS 100.0±6.4

[0098] According to the comparison results of the standard biological element registration library (http: / / parts.igem.org / Ribosome_Binding_Sites / Prokaryotic / Constitutive / Community_Collection), it is known that BBa_B0035 has a more excellent expression efficiency than BBa_B0034 (corresponding to the RBS of Example 1-2). However, according to the experimental results of this embodiment, different from the characteristics of RBS itself, in the case of the expression system according to the present invention, when using the BBa_B0034 RBS sequence, the highest production yield of hyaluronic acid was confirmed.

[0099] Example 5: Measurement of the Molecular Weight of the Produced Hyaluronic Acid

[0100] The hyaluronic acid produced by the same method as described in Example 2 is purified by ultrafiltration, and then the molecular weight is measured. First, the process of purifying the hyaluronic acid produced is as follows. The culture fluid is centrifuged at 10,000rpm for 10 minutes, and then passed through a 0.45μm filter to remove the strain. The culture fluid from which the strain has been removed is filtered through an ultrafiltration membrane with a cutoff value of 100kDa to obtain the product. In the entire product obtained above, hexadecyl trimethylammonium bromide is added to a concentration of 1% (v / v), stirred and centrifuged for 1 hour (7,000rpm, 30 minutes) to obtain a precipitate. The precipitate is dissolved in a 0.25M sodium iodide solution for 10 minutes under stirring, so that hexadecyl trimethylammonium bromide reacts with iodine and sodium. The reaction solution is centrifuged (7,000rpm, 30 minutes), and the supernatant is taken to remove the reaction product of hexadecyl trimethylammonium bromide and sodium iodide. 2% activated carbon is added to the supernatant, stirred for 1 hour to adsorb impurities, and the supernatant is passed through a 0.22μm filter to obtain a purified sample.

[0101] The purified sample was confirmed to be consistent with the hyaluronic acid standard (sigma) by infrared spectroscopy. The results of the spectral analysis are shown in Figure 6 .

[0102] Next, the molecular weight of the purified sample was measured using multi-angle laser light scattering (MALLS). The measurement conditions are shown in Table 8 below, and the analysis results are shown in Figure 7 .

[0103] As Figure 7 The results of multi-angle laser scattering measurements shown, the molecular weight of the purified hyaluronic acid shows a peak value in the range of 1,000 to 7,000 kDa belonging to the ultra-high molecular weight range, and in particular, the main peak is measured to be 5,455 kDa. Compared with low molecular weight hyaluronic acid, this high molecular weight hyaluronic acid has excellent properties, such as moisturizing effect, increased viscosity, joint lubrication, hygroscopicity, elasticity, etc. In particular, in the case of 3000 kDa or higher ultra-high molecular weight hyaluronic acid (such as hyaluronic acid produced using the expression system of the present invention), its decomposition rate in vivo is slow, so it can be used as an adhesion inhibitor.

[0104] [Table 8]

[0105]

Claims

1. An expression system for producing hyaluronic acid in a Bacillus spp. strain, comprising: an operably linked transcription promoter, a hyaluronan synthase gene, a ribosome binding site for expression of a UDP-glucose 6-dehydrogenase gene, and a UDP-glucose 6-dehydrogenase gene, wherein: The transcription promoter is Psigx promoter, Pyob promoter or Pyqe promoter; The ribosome binding site is BBa_B0034 shown in SEQ ID NO:69; and The molecular weight of the hyaluronic acid is 500 kDa to 10,000 kDa.

2. The expression system according to claim 1, wherein The expression system produces constitutively expressed hyaluronan synthase in the absence of an expression inducer.

3. The expression system according to claim 1, wherein The expression system produces hyaluronic acid in Bacillus subtilis or Bacillus licheniformis.

4. The expression system according to claim 1, wherein The hyaluronic acid production was 1.1 to 10 times that of the transformed strain having an expression system comprising the P43 promoter.

5. The expression system according to claim 1, wherein The transcription promoter is the Psigx promoter.

6. The expression system according to claim 1, wherein The ribosome binding site (RBS) showed hyaluronic acid yields 1.1 to 3 times higher than that of the RBS of tuaD itself.

7. The expression system according to claim 1, wherein The UDP-glucose 6-dehydrogenase gene is derived from the tuaD gene of Bacillus subtilis.

8. The expression system according to claim 1, wherein The hyaluronan synthase gene is hasA derived from a Streptococcus strain.

9. A recombinant Bacillus strain for producing hyaluronic acid, comprising the expression system for producing hyaluronic acid according to any one of claims 1 to 8.

10. The recombinant Bacillus strain for producing hyaluronic acid according to claim 9, wherein The strain is Bacillus subtilis or Bacillus licheniformis.

11. A method for producing hyaluronic acid using a recombinant Bacillus strain, the method comprising the following steps: A recombinant Bacillus strain for producing hyaluronic acid is cultivated to obtain a culture, and hyaluronic acid is obtained from the culture, wherein the recombinant Bacillus strain for producing hyaluronic acid comprises the expression system for producing hyaluronic acid according to any one of claims 1 to 8, wherein the molecular weight of the hyaluronic acid is 500 kDa to 10,000 kDa.

12. The method according to claim 11, wherein: The strain is Bacillus subtilis or Bacillus licheniformis.

13. The method according to claim 11, wherein: The molecular weight of the hyaluronic acid is 3,000 kDa to 10,000 kDa.

Images