Acetylcholine receptor inhibitory peptide and use thereof

Abstract

The present invention relates to an acetylcholine receptor inhibitory peptide and its use. A phage with high binding force to the acetylcholine receptor is screened by using random peptide recombinant phage, and an acetylcholine receptor binding peptide is screened by using the phage DNA. By using the selected peptide, the binding force to the acetylcholine receptor and the inhibitory effect of the acetylcholine receptor are confirmed, and by modifying the peptide, the peptide site and sequence important for binding to the acetylcholine receptor are confirmed. Therefore, it is expected that by using the acetylcholine receptor inhibitory peptide of the present invention, a cosmetic composition for improving wrinkles, a drug for preventing or treating acetylcholine receptor-related diseases, and a health functional food for improving acetylcholine receptor-related diseases can be developed.

Description

Technical Field

[0001] The present invention relates to an acetylcholine receptor inhibitory peptide and uses thereof. Background Art

[0002] Acetylcholine is a chemical substance present in animal nerve tissue, which is secreted from nerve endings and plays a role in transmitting nerve stimulation to muscles. As a transmitter secreted from nerve endings, acetylcholine is known in motor nerves and parasympathetic nerves, and adrenaline is known in sympathetic nerves. When acetylcholine is secreted, it exhibits physiological effects such as lowering blood pressure, inhibiting heart rate, contracting intestines, and contracting skeletal muscles. In order to make muscles contract, nerves send contraction commands to muscles, thereby causing muscles to contract. This command causes nerves to secrete acetylcholine at the part where nerves and muscles meet (neuromuscular junction), and this substance binds to the acetylcholine receptors of muscles, thereby causing muscles to contract (Vincent, A., 1985; Lindstrom, JM, et al., 1976). Blocking the acetylcholine receptors at the ends of the skeletal muscles that control the thigh will cause muscle movement paralysis, and blocking the acetylcholine receptors in the smooth muscles and myocardium responsible for breathing or cardiac movement will cause respiratory and cardiac movement paralysis.

[0003] Acetylcholine receptors are divided into muscarinic acetylcholine receptors (mAchR) and nicotinic acetylcholine receptors (nAchR). Muscarinic acetylcholine receptors are a type of G protein-coupled receptor that can be activated by muscarine and activate different signaling mechanisms depending on the subtype. Muscarinic acetylcholine receptors are distributed throughout the body, including the central nervous system and peripheral organs, and mainly play a role in mediating the physiological effects of acetylcholine secreted by postganglionic fibers of the parasympathetic nervous system.

[0004] The nicotinic acetylcholine receptor is a receptor that mimics the pharmacological effects of nicotine and is an ion channel manipulated by neurotransmitters. It is a non-selective cation channel that regulates electronic signaling between nerve cells and muscle cells by opening and closing ion channels and non-selectively passing ions such as sodium, potassium, and calcium. Nicotinic acetylcholine receptors can be divided into muscle type and neuronal type according to the site of expression. Muscle type nicotinic acetylcholine receptors are expressed at the neuromuscular junction where motor neurons and skeletal muscles intersect. Acetylcholine secreted by motor neurons participates in inducing the end plate potential (EPP) of skeletal muscle cell membranes. On the other hand, neuronal nicotinic acetylcholine receptors are expressed in peripheral ganglia of the autonomic nervous system (ANS) and participate in the excitation of postganglionic fibers by acetylcholine secreted by preganglionic fibers.

[0005] Drugs that interfere with or inhibit acetylcholine activity or mimic behavior are very useful. Acetylcholine receptor agonists are used to treat myasthenia gravis and Alzheimer's disease. Myasthenia gravis is an autoimmune disease that occurs when the body produces antibodies against nicotinic acetylcholine receptors and inhibits normal acetylcholine signaling. Myasthenia gravis can be treated by using acetylcholine esterase (AChE) inhibitors, which increase the time that acetylcholine interacts with each receptor before it becomes inactive in the synaptic cleft between nerves and muscles.

[0006] In addition, when the secretion of acetylcholine is inhibited, muscle contraction is inhibited and the muscles are paralyzed, thereby smoothing wrinkles. Botulinum toxin uses this principle. Botulinum toxin prevents the release of acetylcholine, which is an essential substance for muscle contraction, from the motor nerve endings. As a result, the muscles become unable to move, and the wrinkles caused by the muscles disappear. Since the muscle relaxant effect of botulinum toxin gradually disappears after 3 to 6 weeks, repeated administration is required.

[0007] Therefore, the present inventors screened and obtained peptides with high binding affinity to acetylcholine receptors during the process of studying acetylcholine receptor binding peptides, confirmed that these peptides bind to acetylcholine receptors and prevent acetylcholine from binding, thereby preventing the action of acetylcholine receptors, and completed the present invention.

[0008] In addition, the specified arrangement order of specific amino acids that are key in the above-screened peptides binding to the acetylcholine receptor and inhibiting its action was confirmed, and the peptide library expressed by the specific molecular formula was confirmed to bind to the acetylcholine receptor as a whole and was able to inhibit its action, thereby completing the present invention.

[0009] In Korean Patent No. 1216008, which is the prior art, peptides that bind to acetylcholine receptors selected using bio-panning are described, but peptides and libraries containing the amino acid sequence of the present invention are not described. In addition, Korean Patent No. 2018-0028748 discloses a neurotransmitter release-controlling peptide containing acetylcholine and its anti-wrinkle effect, but does not describe the acetylcholine receptor binding ability of the peptide containing the amino acid sequence of the present invention and the acetylcholine receptor action inhibitory effect achieved thereby. Korean Patent No. 2014-0139010 discloses a peptide that promotes transdermal penetration, but the composition is different from the peptide of the present invention that achieves an inhibitory effect by binding to the acetylcholine receptor. Summary of the invention

[0010] Problem that the invention aims to solve

[0011] The object of the present invention is to provide an acetylcholine receptor inhibitory peptide and a composition containing the same.

[0012] Means used to solve problems

[0013] The present invention relates to an acetylcholine receptor binding peptide comprising an amino acid sequence represented by the following Chemical Formula 1.

[0014] [Chemical formula 1]

[0015] X L -(K or R)-X-(K or R)-X M -(K or R)-X N

[0016] The above X L , X M , X N Each independently represents 1 to 8, X represents a sequence consisting of one arbitrary amino acid, preferably, X L , X M , X N Each independently represents 1 to 4, and X can be any amino acid.

[0017] The present invention relates to an acetylcholine receptor binding peptide comprising an amino acid sequence represented by the following Chemical Formula 2.

[0018] [Chemical formula 2]

[0019] (K or R)-X-(K or R)-(K or R)-X M-1 -(K or R)

[0020] The above X M-1 is 1 to 3, X can be a sequence consisting of 1 arbitrary amino acid, preferably, X M-1 The number of R is 3, and X can be one arbitrary amino acid.

[0021] The above-mentioned peptide may be a peptide having any sequence selected from the group consisting of SEQ ID NOs: 1 to 200 (see Table 10).

[0022] The present invention relates to an acetylcholine receptor binding peptide comprising an amino acid sequence represented by the following Chemical Formula 3 or 3-1.

[0023] [Chemical formula 3]

[0024] X L -(K or R)-X-(K or R)-(K or R)-X M-1 -(K or R),

[0025] The above X L , X M-1 Each independently is 1 to 3, X can be a sequence consisting of one arbitrary amino acid, preferably, the above X L , X M-1 There are 3 of them independently, and X can be one arbitrary amino acid.

[0026] [Chemical formula 3-1]

[0027] (K or R)-X-(K or R)-(K or R)-X M-1 -(K or R)-X N

[0028] The above X M-1 , X N Each independently is 1 to 3, X can be a sequence consisting of one arbitrary amino acid, preferably, the above X M-1 , X N There are 3 of them independently, and X can be one arbitrary amino acid.

[0029] The above-mentioned peptide may be a peptide having any sequence selected from the group consisting of SEQ ID NOs: 201 to 400 (see Table 11).

[0030] The present invention relates to an acetylcholine receptor binding peptide comprising an amino acid sequence represented by the following Chemical Formula 4.

[0031] [Chemical formula 4]

[0032] X L-(K or R)-X-(K or R)-(K or R)-X M-1 -(K or R)-X N

[0033] The above X L , X M-1 , X N Each independently is 1 to 3, X can be any amino acid, preferably, the above X L , X M-1 , X N There are 3 of them independently, and X can be one arbitrary amino acid.

[0034] The above-mentioned peptide is an acetylcholine receptor binding peptide, characterized in that it is a peptide having any sequence selected from the group consisting of SEQ ID NOs: 401 to 600 (see Table 12).

[0035] The peptide may be composed of an amino acid sequence of 8 to 28, preferably 8 to 16, more preferably 8 to 14, further preferably 11 to 16, and most preferably 14.

[0036] In the above acetylcholine receptor binding peptide, based on the amino acid sequence represented by the above chemical formula 1, the first, third and eighth amino acids K or R may be important sites for acetylcholine receptor binding.

[0037] In addition, in the above acetylcholine receptor binding peptide, based on the amino acid sequence represented by the above Chemical Formula 2, the 1st, 3rd, 4th and 8th amino acids K or R may be important sites for acetylcholine receptor binding.

[0038] The amino acid sequence of the acetylcholine receptor binding peptide excludes the amino acid sequence described in Korean Patent No. 10-1971092, which is a prior patent of the present invention. The amino acid sequence described in Korean Patent No. 10-1971092 includes WTWKGRKSLLR.

[0039] The amino acid sequence of the acetylcholine receptor binding peptide described above excludes the amino acid sequence described in Korean Patent Publication No. 10-2014-0139010. The amino acid sequence described in Korean Patent Publication No. 10-2014-0139010 is (gly) n1 -(arg) n2 、(gly) p -RGRDDRRQRRR-(gly) q 、(gly) p -YGRKKRRQRRR-(gly) q 、(gly) p -RKKRRQRRR-(gly)q , the subscripts p and q are each independently an integer from 0 to 20, the subscript n1 is independently an integer from 1 to 8, and the subscript n2 is independently an odd-numbered sequence peptide from 7 to 17.

[0040] The present invention relates to an acetylcholine receptor binding peptide, characterized in that the N-terminus or C-terminus of the above peptide is modified.

[0041] The N-terminal or C-terminal modification refers to palmitoylation, acetylation, amidation, formylation or PEGylation, or modification by 2-mercaptoacetic acid, 3-mercaptopropionic acid, 6-mercaptohexanoic acid, pyroglutamic acid, succinimide acid, cystramine, cysteamine, methyl ester, ethyl ester, benzyl ester and fatty acids (e.g., myristic acid, stearic acid, palmitic acid, cholesterol, 6-aminohexanoic acid and 8-aminooctanoic acid). The modification is achieved by combining one or more selected from the group consisting of octanoic acid).

[0042] The present invention relates to acetylcholine receptor binding peptides.

[0043] In the present invention, "peptide" refers to a polymer composed of two or more amino acids linked by an amide bond or a peptide bond.

[0044] In the present invention, "amino acid" refers to natural amino acids and other amino acids used in the peptide field to prepare synthetic amino acids, for example, including L- and D-isomers of natural amino acids, non-natural amino acids, amino acids not encoded by nucleotide sequences, etc.

[0045] The above natural amino acids can be alanine (Ala, A), cysteine ​​(Cys, C), aspartic acid (Asp, D), glutamic acid (Glutamic acid, Glu, E), phenylalanine, Phe, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine.

[0046] The above other amino acids may be 2-aminoadipic acid (2-aminohexanedioic acid), α-asparagine, 2-aminobutanoic acid, 2-aminocapric acid, 2-aminodecanoic acid, α-glutamine, α-aminoisobutyric acid (α-methylalanine), 2-aminopimelic acid (2-aminohepanedioic acid), γ-amino-β-hydroxybenzenepentanoic acid, 2-aminosuberic acid (2-aminooctanedioic acid), 2-carboxyazetidine, β-alanine, β-aspartic acid, acid), 3,6-diaminohexanoic acid (β-lysine), butanoic acid, 4-amino-3-hydroxybutanoic acid, γ-amino-β-hydroxycyclohexanepentanoic acid, 3-cyclohexylalanine, N5-aminocarbonylornithine, 3-sulfoalanine, 2,3-diaminopropanoic acid, 2,7-diaminosuberic acid, 2,7-diaminooctanedioic acid, S-ethylthiocysteine, γ-glutamic acid, γ-carboxylglutamic acid acid), hydroxyacetic acid,glycolic acid), pyroglutamic acid, homoarginine, homocysteine, homohistidine, 2-hydroxyisovaleric acid, homoserine, 2-hydroxypentanoic acid, 5-hydroxylysine, 4-hydroxyproline, isovaline, 2-hydroxypropanoic acid, lactic acid, mercaptoacetic acid, mercaptobutanoic acid, 3-hydroxy-4-methylproline, mercaptopropanoic acid acid), 3-naphthylalanine, norleucine, nortyrosine, norvaline, 2-carboxyoctahydroindole, ornithine, penicillamine (3-mercaptovaline), 2-phenylglycine, 2-carboxypiperidine, sarcosine (N-methylglycine), 1-amino-1-carboxycyclopentane (1-amino-1-carboxycyclopentane ino-1-carboxycyclopentane), statin (4-amino-3-hydroxy-6-methylheptanoic acid), 3-thienylalanine, 3-carboxyisoquinoline, 3-methylvaline, ε-N-trimethyllysine, 3-thiazolylalanine, α-amino-2,4-dioxopyrimidinepropanoic acid, etc.

[0047] The peptides of the present invention can be obtained by methods known in the art. Specifically, they can be prepared using gene recombination and protein expression systems, and can also be prepared using methods for in vitro synthesis by chemical synthesis methods such as peptide synthesis and cell-free protein synthesis methods. More specifically, they can be synthesized by methods known in the art, such as automatic peptide synthesizers, and can also be produced by gene manipulation techniques, but are not limited thereto. For example, a gene encoding a fusion protein consisting of a fusion partner and the peptide of the present invention is prepared by gene manipulation, and the prepared gene is transformed into a host microorganism, and then expressed in the form of a fusion protein in the host microorganism, and the desired peptide can be produced by cutting and separating the peptide of the present invention from the fusion protein using a proteolytic enzyme or a compound.

[0048] The peptide of the present invention can exist in the form of salt. The form of the salt that can be used for the present invention can be the salt form prepared in the final separation and purification process of the compound or by reacting an amino group with a suitable acid. For example, as an acid addition salt, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, mesitylenesulfonate, mesylate, naphthylenesulfonate (naphthylenesulfonate), nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, trichloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, p-toluenesulfonate and undecanoate can be used, but are not limited to this. In addition, examples of acids that can be used to form acid addition salts include, but are not limited to, inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid, and organic acids such as oxalic acid, maleic acid, succinic acid, and citric acid.

[0049] For the above-mentioned peptides, amino acid sequences can be added to increase targeting sequences, tags, labeling residues, half-life or stability of the peptides, binding with antibodies or antibody fragments, human serum albumin, etc. can be performed to increase targeting, efficacy or stability, or the N-terminus or C-terminus of the peptides can be modified.

[0050] The above-mentioned "antibody" refers to a specific protein molecule targeting an antigenic site. Preferably, the above-mentioned antibody refers to an antibody that specifically binds to a specific protein or an immunogenic fragment thereof, and may include a monoclonal antibody (mAb), a polyclonal antibody (pAb) and a recombinant antibody. The above-mentioned antibody can be easily prepared using techniques known in the art.

[0051] The above antibodies include not only complete forms with two full-length light chains and two full-length heavy chains, but also functional fragments of antibody molecules. Functional fragments of antibody molecules refer to fragments that have at least antigen binding function, including Fab, F(ab'), F(ab')2, F(ab)2, Fv, etc.

[0052] The above peptides may be encapsulated or immobilized in nanoparticles, microparticles, metal particles, ceramic particles, hydrogels, etc., to be delivered to specific tissues or to ensure stability, but are not limited thereto.

[0053] The above-mentioned nanoparticles, microparticles, metal particles, ceramic particles, hydrogels, etc. can be biocompatible, non-toxic materials.

[0054] In the present invention, "acetylcholine receptor (AchR)" is a receptor to which acetylcholine secreted by nerve endings binds, and functions as a pathway for transmitting nerve stimulation of acetylcholine. For example, when muscle contraction is required, when the nerve sends a contraction command to the muscle, the nerve secretes acetylcholine at the junction of the nerve and the muscle, and when the secreted acetylcholine binds to the acetylcholine receptor of the muscle, the muscle contracts.

[0055] The acetylcholine receptors of the present invention are divided into muscarinic acetylcholine receptors and nicotinic acetylcholine receptors, and the acetylcholine receptors of the present invention are preferably nicotinic acetylcholine receptors.

[0056] The acetylcholine receptor binding peptide binds to the acetylcholine receptor, preventing acetylcholine from binding to the receptor, thereby inhibiting the action of the acetylcholine receptor. Preferably, by inhibiting muscle contraction, it exhibits the effects of improving wrinkles and inhibiting abnormal muscle contraction, and promotes muscle relaxation during surgery to ensure the convenience of surgery.

[0057] In addition, the present invention provides a polynucleotide encoding the above-mentioned acetylcholine receptor binding peptide. As long as it can encode a peptide that exhibits binding activity to the above-mentioned acetylcholine receptor, a polynucleotide comprising a nucleotide sequence homologous to the nucleotide sequence constituting the above-mentioned polynucleotide is also within the scope of the polynucleotide provided by the present invention. Preferably, it can be a polynucleotide comprising a nucleotide sequence exhibiting more than 80% homology, more preferably, it can be a polynucleotide comprising a nucleotide sequence exhibiting more than 90% homology, and most preferably, it can be a polynucleotide comprising a nucleotide sequence exhibiting more than 95% homology.

[0058] The present invention also provides a wrinkle-improving cosmetic composition comprising the acetylcholine receptor-binding peptide.

[0059] The above-mentioned acetylcholine receptor binding peptide can prevent muscle contraction by inhibiting the action of acetylcholine receptors, thereby improving wrinkles.

[0060] The above-mentioned cosmetic composition may contain the above-mentioned acetylcholine receptor binding peptide and auxiliary agents commonly used in the cosmetic field, such as hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic active agents, preservatives, antioxidants, solvents, fragrances, fillers, blocking agents, pigments, deodorants or dyes.

[0061] The amounts of the abovementioned adjuvants are those customary in the art and, in any case, the adjuvants and their proportions can be chosen in such a way as not to negatively affect the preferred properties of the cosmetic composition according to the invention.

[0062] The above-mentioned wrinkle-improving cosmetic composition may be prepared by including additional additives.

[0063] The additives mentioned above may be moisturizers, functional raw materials, thickeners, softeners, emulsifiers, surfactants, pH adjusters, and the like.

[0064] The moisturizer may be glycerin, propylene glycol, butylene glycol, hyaluronic acid, ceramide, etc., but is not limited thereto.

[0065] The thickener may be a polymer, xanthan gum, or guar gum, but is not limited thereto.

[0066] The softener may be mineral oil, shea butter, or paraffin, but is not limited thereto.

[0067] The above-mentioned emulsifier can be dimethicone, beeswax, etc.

[0068] The wrinkle-improving cosmetic composition may be used in combination with a raw material having a wrinkle-improving effect.

[0069] The above-mentioned raw materials having wrinkle-improving effects are vitamin A, vitamin A derivatives (retinol palmitate, retinol acetate, etc.), adenosine, and polyethoxylated retinamide, but are not limited thereto.

[0070] The cosmetic composition can be prepared into one or more dosage forms selected from the group consisting of lotion, softener, toner, astringent, cream, foundation, essence, film, facial mask, soap, shower gel, cleansing foam, body oil and body lotion, but is not limited thereto.

[0071] The above cosmetic composition can be used every day or indefinitely. Preferably, the usage amount, usage frequency and usage period can be adjusted according to the user's age, skin condition or skin type.

[0072] In addition, the present invention provides a pharmaceutical composition for preventing or treating diseases related to overactive acetylcholine receptors, comprising the above-mentioned acetylcholine receptor binding peptide.

[0073] The pharmaceutical composition can prevent or treat diseases associated with the overactive acetylcholine receptor by binding to the acetylcholine receptor and inhibiting the activation of the acetylcholine receptor.

[0074] The above-mentioned diseases related to overactivity of acetylcholine receptors are diseases with abnormal excessive muscle contraction, including cervical dystonia, limb dystonia, truncal dystonia, blepharospasm (facial tremor), spasticity, hemifacial spasm, strabismus, nystagmus, tics, chronic pain, chronic migraine, neurogenic bladder, detrusor-sphincter dyssynergia, achalasia cardia, hyperhidrosis, sialorrhea, cerebral palsy in children, muscle rigidity after stroke, low back pain, prostatic hypertrophy, urinary incontinence, vocal cord nodules and correction, hemorrhoids, anal fissures, etc.

[0075] In addition, the above-mentioned pharmaceutical composition can be used to ensure the convenience of surgery by promoting muscle relaxation during surgery, and can be used as a therapeutic agent or adjuvant for diseases caused by nicotine addiction, and can be used for wrinkle removal, square jaw or calf correction, etc., but is not limited to these.

[0076] The pharmaceutical composition may include the acetylcholine receptor binding peptide and a pharmaceutically acceptable excipient.

[0077] The above-mentioned pharmaceutical composition can be made into oral dosage forms such as powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., as well as external preparations, suppositories and sterile injections according to conventional methods. The carriers, excipients and diluents that can be included in the above-mentioned pharmaceutical composition can include: lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. Oral solid preparations include tablets, pills, powders, granules, capsules, etc. Such solid preparations are prepared by mixing at least one excipient into the acetylcholine receptor binding peptide, for example, mixed starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, oral liquids, emulsions, syrups, etc., in addition to water and liquid paraffin as commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics and preservatives may also be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized agents and suppositories. Non-aqueous solvents and suspensions can use propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, semi-synthetic fatty acid ester (witepsol), polyethylene glycol, Tween 61, cocoa butter, lauric acid glyceryl, glyceryl gelatin and the like can be used.

[0078] In addition, there is no particular limitation on the dosage form, but it can be used as a skin external preparation having a dosage form selected from ointments, emulsions, sprays, patches, creams, gels and colloids. Preparations that increase percutaneous absorption, for example but not limited to, may include dimethyl sulfoxide, dimethylacetamide, dimethylformamide, surfactants, alcohols, acetone, propylene glycol or polyethylene glycol, etc. The frequency of application may vary greatly depending on the age, sex, weight, specific disease or pathological state to be treated, severity of the disease or pathological state, route of administration and the judgment of the prescriber of the subject being treated, and the frequency of application may be from monthly to 10 times a day, preferably, from weekly to 4 times a day, more preferably, from 3 times a week to 3 times a day, more preferably once or twice a day.

[0079] The pharmaceutical composition of the present invention can be administered to mammals such as mice, livestock, and humans by various routes. Any route of administration can be envisioned, for example, oral, rectal, or intravenous, intramuscular, subcutaneous, cutaneous, intrauterine epidural, or intracerebral injection. Preferably, the skin is administered.

[0080] The present invention also relates to a health functional food composition for improving diseases related to overactive acetylcholine receptors, which comprises the above-mentioned acetylcholine receptor binding peptide.

[0081] The above-mentioned health functional food composition comprises the above-mentioned acetylcholine receptor binding peptide and a food auxiliary additive acceptable in food science.

[0082] The health functional food composition of the present invention can be in the form of tablets, capsules, pills or liquids, and the foods to which the nanocapsules of the present invention can be added include: for example, various foods, beverages, chewing gum, tea, vitamin complexes and health functional foods.

[0083] Another embodiment of the present invention provides a medical device composition comprising the above-mentioned acetylcholine receptor binding peptide.

[0084] The composition for medical devices may be a filler, but is not limited thereto.

[0085] In the present invention, "filler" refers to a substance that can supplement skin tissue, and its purpose is to be injected and filled to restore facial firmness, improve contours, and reduce wrinkles.

[0086] The above-mentioned medical device composition can relieve wrinkles by inhibiting muscle contraction through acetylcholine receptor binding peptide, and can also show the effect of improving contours, and biocompatible microparticles and nanoparticles, hydrogels, etc. fixed with acetylcholine receptor binding peptide can be injected to fill tissues.

[0087] Effects of the Invention

[0088] The present invention relates to an acetylcholine receptor inhibitory peptide and its use. The phage with high binding force to the acetylcholine receptor is screened by random peptide recombinant phage, and the acetylcholine receptor binding peptide is selected by the phage DNA. By using the selected peptide, the binding force to the acetylcholine receptor and the inhibitory effect of the acetylcholine receptor are confirmed, and by modifying the peptide, the peptide site and sequence important for the binding of the acetylcholine receptor are confirmed.

[0089] In addition, the amino acid sequence of the peptide confirmed above was expressed in a certain manner based on important peptide sites and sequences, and a library of the above peptides was prepared, and it was confirmed that the prepared library as a whole binds to the acetylcholine receptor and inhibits its action.

[0090] Therefore, it is expected that by using the acetylcholine receptor inhibitory peptide of the present invention, a cosmetic composition for improving wrinkles, a drug for preventing or treating acetylcholine receptor-related diseases, and a health functional food for improving acetylcholine receptor-related diseases can be developed. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1The results of acetylcholine receptor binding analysis of the screened and selected peptides (S peptides-1 to 11) are shown.

[0092] Figure 2 The results of confirming the inhibitory effect of the screened peptides on acetylcholine receptors in TE671 cells are as follows. (A to C) show the confirmation results of the inhibitory effect of Synake and S-peptide-1, S-peptide-2, S-peptide-4, and S-peptide-10 peptides based on acetylcholine on acetylcholine receptors at different concentrations, and (D) shows the confirmation results of the inhibitory effect of acetylcholine receptors when nicotine is used.

[0093] Figure 3 The results of cytotoxicity of Synake, S-peptide-1, and S-peptide-2 peptides to TE671 cells are shown. It was confirmed that there was no cytotoxicity even at a high concentration of 100 μM.

[0094] Figure 4 The results of confirming the binding ability of S-peptide-2 to the acetylcholine receptor according to the concentration of S-peptide-2 are shown.

[0095] Figure 5 The results are as follows: sequence sites important for acetylcholine receptor binding were identified based on different peptide sizes (using peptides with both ends cleaved based on the amino acid sequence of S-peptide-2). (A) shows the results of the identification using peptides with N-terminal cleavage (S-peptide-2-ND1 to ND5), and (B) shows the results of the identification using peptides with C-terminal cleavage (S-peptide-2-CD1 to CD5).

[0096] Figure 6 The results of comparing the acetylcholine receptor binding ability of S-peptide-2-ND3 (part (A)) and S-peptide-2-ND5 (part (B)) are shown. It was confirmed that there was no significant difference in binding ability up to S-peptide-2-ND3 (8mer), but S-peptide-2-ND5 (6mer) was 48 times lower than that of S-peptide-2 (11mer).

[0097] Figure 7 The results are as follows: based on the amino acid sequences of S-peptide-1-ND3 (part (A)) and S-peptide-2-ND3 (part (B)), important sites for binding to acetylcholine receptors were identified using the alanine scanning method.

[0098] Figure 8 The results of comparing the binding ability of S-peptide-2 to which palmitoyl is bound and S-peptide-2 to the acetylcholine receptor are shown. It was confirmed that the binding ability was improved by the binding of palmitoyl.

[0099] Fig. 9It was confirmed that palmitoyl-S peptide-2 forms micelles. Pal-S peptide-2 forms micelles and increases binding strength due to the avidity effect.

[0100] Fig.10 The results show the inhibitory effect of AchR when treated with different concentrations of palmitoyl-S peptide-2 compared with S peptide-2, Synake, and Bungarotoxin. Due to the increased binding force of Pal-S peptide-2, the inhibitory ability is also increased by about 10 times compared with S peptide-2.

[0101] Fig.11 The results of the toxicity of palmitoyl-bound S-peptide-2 to TE671 cells are shown. It was confirmed that no cytotoxicity was exhibited even at a high concentration of 10 μM.

[0102] Fig.12 The results of confirming the binding ability of multiple peptides to AchR by the same method as the surface plasmon resonance analysis method are as follows. The multiple peptides are peptides in which S peptide-2-ND3 is used as the wild type and K in the amino acid sequence is replaced by R, and R is replaced by K or N. It was confirmed that the activity was maintained when substituted with K or R, but the activity was significantly reduced when substituted with N.

[0103] Fig.13 The diagram shows the results of preparing an optimized peptide library for the acetylcholine receptor (8mer L1 [(K or R)-X-(K or R)(K or R)-XXX-(K or R), X may be a sequence consisting of one arbitrary amino acid], 11mer L2 [XXX(K or R)-X-(K or R)(K or R)-XXX-(K or R), X may be a sequence consisting of one arbitrary amino acid], 14mer L3 [XXX(K or R)-X-(K or R)(K or R)-XXX-(K or R)XXX, X may be a sequence consisting of one arbitrary amino acid], 18mer L4 [XXXXX(K or R)-X-(K or R)(K or R)-XXX-(K or R)XXXXX, X may be a sequence consisting of one arbitrary amino acid]), and then confirming the binding ability and specificity of phages screened in the bio-panning step to the acetylcholine receptor. The framed part is the first library, which confirmed that the L1 (8mer), L2 (11mer), and L3 (14mer) libraries all have high binding affinity and specificity to the acetylcholine receptor in the first library itself, but the L4 (18mer) library with the largest peptide size itself has no binding affinity and specificity to the acetylcholine receptor.

[0104] Fig.14The results of analyzing the ratio of the absorbance of the acetylcholine receptor to the absorbance of streptavidin by screening the peptide phage specific to the acetylcholine receptor in steps 4 and 5 of the biopanning of the optimized peptide L1 (8mer) library are shown. At the same time, as a control group (con), S peptide-2 was also tested, and it was confirmed that all peptides had better binding ability and specificity than S peptide-2.

[0105] Fig.15 The results of analyzing the ratio of the absorbance of the acetylcholine receptor to the absorbance of streptavidin by screening the peptide phage specific to the acetylcholine receptor in steps 4 and 5 of the biopanning of the optimized peptide L2 (11mer) library are shown. At the same time, as a control group (con), S peptide-2 was also tested, and it was confirmed that all peptides had better binding ability and specificity than S peptide-2.

[0106] Fig.16 The results of analyzing the ratio of the absorbance of the acetylcholine receptor to the absorbance of streptavidin by screening the peptide phage specific to the acetylcholine receptor in steps 4 and 5 of the biopanning of the optimized peptide L3 (14mer) library are shown. At the same time, as a control group (con), S peptide-2 was also tested, and it was confirmed that all peptides had better binding ability and specificity than S peptide-2.

[0107] Fig.17 The results are shown in which 40 peptides with excellent specificity were screened from the optimized peptide L1 (8mer) library and the binding ability to the acetylcholine receptor was compared. It was confirmed that all the optimized peptides had higher binding ability than S peptide-2.

[0108] Fig.18 The results are shown in which 40 peptides with excellent specificity were screened from the optimized peptide L2 (11mer) library and the binding ability to the acetylcholine receptor was compared. It was confirmed that all the optimized peptides had higher binding ability than S peptide-2.

[0109] Fig.19 The results are shown in which 40 peptides with excellent specificity were screened from the optimized peptide L3 (14mer) library and the binding ability to the acetylcholine receptor was compared. It was confirmed that all the optimized peptides had higher binding ability than S peptide-2.

[0110] Fig. 20 The results of comparison of the acetylcholine receptor inhibitory effects of the top 20 peptides among the 40 screened optimized peptides L1 (8mer) are shown. It was confirmed that all optimized peptides had better inhibitory ability than S peptide-2.

[0111] Fig.21The results of comparison of the acetylcholine receptor inhibitory effects of the top 20 peptides among the 40 screened optimized peptides L2 (11mer) are shown. It was confirmed that all optimized peptides had better inhibitory ability than S peptide-2.

[0112] Fig. 22 The results of comparison of the acetylcholine receptor inhibitory effects of the top 20 peptides among the 40 screened optimized peptides L3 (14mer) are shown. It was confirmed that all optimized peptides had better inhibitory ability than S peptide-2.

[0113] Fig.23 The results of comparison of the binding ability of the representative peptide with the highest affinity to the acetylcholine receptor among the optimized peptides L1 (8mer), L2 (11mer), and L3 (14mer) are shown.

[0114] Fig.24 The results of comparing the acetylcholine receptor inhibitory effects of S-peptide-2 and selected representative peptides at different concentrations are shown.

[0115] Fig.25 The results of comparing the acetylcholine receptor inhibitory effect folds of S-peptide-2 and selected representative peptides are shown. It was confirmed that the inhibitory ability of L3-37 peptide was 32 times higher than that of S-peptide-2.

[0116] Fig.26 The results of comparison of the binding ability to the acetylcholine receptor when various modifications were made to the end of the L3-37 peptide are shown, wherein the L3-37 peptide is a representative peptide.

[0117] Fig. 27 The results of comparison of the binding ability to the acetylcholine receptor when various modifications were made to the end of the L3-38 peptide are shown, wherein the L3-38 peptide is a representative peptide.

[0118] Fig.28 The results of comparison of the binding ability to the acetylcholine receptor when various modifications were made to the end of the L3-27 peptide are shown, wherein the L3-27 peptide is a representative peptide.

[0119] Fig.29 The results of comparison of the binding ability to the acetylcholine receptor when various modifications were made to the end of the L2-110 peptide are shown, wherein the L2-110 peptide is a representative peptide.

[0120] Fig.30 The micelle formation results of Myristic acid-L3-37 and Stearic acid-L3-37 are shown.

[0121] Fig.31The figures show the results of comparison of the AchR inhibitory effects of palmitoyl-L3-37, palmitoyl-L3-28, palmitoyl-L3-27, and palmitoyl-L2-110 at different concentrations and bungarotoxin.

[0122] Fig.32 The toxicity results of palmitoyl-L3-37 on TE671 cells are shown.

[0123] Fig.33 The toxicity results of palmitoyl-L3-28 on TE671 cells are shown.

[0124] Fig.34 The toxicity results of palmitoyl-L3-27 on TE671 cells are shown.

[0125] Fig.35 The toxicity results of palmitoyl-L2-110 on TE671 cells are shown.

[0126] Fig.36 Shown are the results of evaluating the animal efficacy of palmitoyl-L3-37 peptide using a gait analysis (CatWalk) device.

[0127] Fig.37 Shown are the results of using the DAS assay to evaluate the efficacy of palmitoyl-L3-37 peptide in animals at different concentrations.

[0128] Fig.38 Shown are the recovery results after evaluating the efficacy of palmitoyl-L3-37 peptide in animals by DAS analysis.

[0129] Fig.39 The results of the acute toxicity evaluation of palmitoyl-L3-37 peptide in animals are shown. DETAILED DESCRIPTION

[0130] Hereinafter, the preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein, and may also be embodied in other forms. Instead, this is provided to make the contents described herein more thorough and complete, and to fully convey the ideas of the present invention to those skilled in the art.

[0131] <Example 1. Screening of acetylcholine receptor binding peptides by biopanning>

[0132] The inventors of the present invention produced random recombinant phages by random peptide library DNA preparation and transformation according to the method described in the prior patent (Korean Patent No. 10-1971092), and screened acetylcholine receptor (AchR) binding peptides by biopanning. At this time, AchR specific peptides were selected from the 4th and 5th biopanning input phages with high binding force and specificity to AchR, and the sequence analysis results thereof were applied to Table 1.

[0133] [Table 1]

[0134]

[0135]

[0136] <Example 2. Confirmation of the Acetylcholine Receptor Binding Ability of Peptides>

[0137] The S-peptides 1 to 11 selected in Example 1 were synthesized, and their binding abilities to AchR were compared using a surface plasmon resonance (SPR) analyzer (Biacore 3000, Biacore A, Sweden).

[0138] In the CM5 chip, which is a biosensor chip for surface plasmon resonance analysis, acetylcholine receptor protein was immobilized with EDC / NHS, and the analysis was performed under the conditions of 20mM Tris (pH 7.0) running buffer, 30μl / min, and 10μM peptide (S peptide-1 to 11) concentration for up to 500 seconds to observe association and dissociation. Figure 3 At this time, Synake, a peptide known to reduce wrinkles by binding to AchR, was used as a positive control group.

[0139] like Figure 1 As shown, it was confirmed that S-peptides 1, 2, 4, and 10 have higher binding affinity to AchR than synakes known to bind to AchR.

[0140] <Example 3. Confirmation of the inhibitory effect of peptide on acetylcholine receptor>

[0141] In order to confirm the AchR action inhibitory effect of the peptide with high binding affinity to the acetylcholine receptor in Example 2, TE671 cells overexpressing AchR were used.

[0142] TE671 cells were cultured for 4 days in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. The cultured cells were treated with trypsin to remove them and then planted in a 12-well cell culture plate with an 18 mm cover glass. Each well was inoculated with 2×1 4 cells and cultured for 4 days. The coverslip with cells was transferred to a new 12-well plate, and 997μl of Hanks' balanced salt solution (HBSS) and 3μl of Fura-2-AM (intracellular calcium ion marker) were added, and cultured in a cell culture incubator at 37°C and 5% CO2 for 15 minutes. After that, it was washed 3 to 4 times with HBSS buffer to remove the residual Fura-2-AM, and then 1ml of HBSS buffer was added. After the coverslip with cells was inserted into the sample chamber for microscope observation and 500μl of HBSS buffer was added, the peptide selected in the above Example 2-3 was added to a concentration of 0.5μM, 5μM or 50μM, and then left for about 3 minutes to allow it to bind to AchR. After that, 125 μM nicotine or 1 μM acetylcholine was added, and the fluorescence intensity of Fura-2 in the cells was detected to confirm the effect of AchR. Synake and bungarotoxin were used as positive control groups. Figure 2 Shown in.

[0143] like Figure 2 As shown, in the case of treating acetylcholine (A to C), it was confirmed that S-peptide-1 showed a 5% inhibitory effect on the AchR action at a concentration of 0.5 μM, 90% at a concentration of 5 μM, and 100% at a concentration of 50 μM, S-peptide-2 showed a 90% inhibitory effect on the AchR action at a concentration of 0.5 μM, and 100% inhibitory effect at a concentration of more than 5 μM, and S-peptide-4 and S-peptide-10 showed 17% and 47% inhibitory effects on the AchR action at a concentration of 50 μM, respectively. In addition, in the case of treating nicotine (D), it was confirmed that S-peptide-1 and S-peptide-2 had a superior inhibitory effect on the action of nicotine on the acetylcholine receptor compared to Synake.

[0144] This shows that S-peptide-1 and S-peptide-2 have excellent AchR action inhibitory effects, and in particular, S-peptide-2 has the highest binding affinity to AchR and thus has the most excellent AchR action inhibitory effect.

[0145] <Example 4. Synake, S-peptide-1, S-peptide-2 cytotoxicity detection>

[0146] To evaluate the toxicity of S-peptide-1 and S-peptide-2, WST assay was performed in TE671 cells. Figure 3 Shown in.

[0147] like Figure 3 As shown, it was confirmed that S-peptide-1, S-peptide-2 and Synake showed no toxicity at a treatment concentration of 100 M.

[0148] <Example 5. Confirmation of the binding ability of S-peptide-2 peptide with the highest binding ability to acetylcholine receptor>

[0149] In order to confirm the binding ability of S-peptide-2 with the highest binding ability to AchR in Example 2, the dissociation constant (Kd) was analyzed by the same method using the surface plasmon resonance analyzer of Example 2. The result was Figure 4 At this time, the concentration of S peptide-2 was treated at 0.12 to 1 μM, Synake was treated as a positive control, and the dissociation constants were compared.

[0150] like Figure 4 As shown, it was confirmed that the association curve rose sharply when S-peptide-2 was allowed to flow, and the association curve rose depending on the treatment concentration of S-peptide-2. After all the S-peptide-2 was allowed to flow, the rising association curve did not fall in the process of adding only the running buffer for dissociation, which shows that S-peptide-2 and AchR are continuously bound.

[0151] In addition, the Kd value of S-peptide-2 for AchR was analyzed and found to be 1.2 μM. By comparing it with 2300 μM of Synake, it was confirmed that the binding force of S-peptide-2 to AchR was about 2000 times higher than that of Synake.

[0152] <Example 6. Confirmation of important sequence sites in peptides for binding to acetylcholine receptors>

[0153] Example 6-1. Confirmation of binding ability to acetylcholine receptor by stepwise removal of terminal amino acids

[0154] In order to identify the peptide site that plays an important role in binding to AchR, the peptide was modified based on the amino acid sequence of S peptide-2 determined in the above Example 6, and the modified peptide was placed on the surface plasmon resonance analyzer in the above Example 2 to confirm their binding ability to AchR.

[0155] Based on the amino acid sequence of the above-mentioned S peptide-2, the amino acid sequence of the N-terminal or C-terminal of the peptide was gradually removed and the peptides shown in Table 2 below were synthesized. The binding ability of the synthesized peptides to AchR was compared. The results were as follows: Figure 5 Shown in.

[0156] [Table 2]

[0157] Peptide name Amino acid sequence S-peptide-2 WTWKGRKSLLR S-peptide-2-ND1 TWKGRKSLLR S-peptide-2-ND2 WKGRKSLLR S-peptide-2-ND3 KGRKSLLR S-peptide-2-ND4 GRKSLLR S-peptide-2-ND5 RKSLLR S-peptide-2-CD1 WTWKGRKSLL S-peptide-2-CD2 WTWKGRKSL S-peptide-2-CD3 WTWKGRKS S-peptide-2-CD4 WTWKGRK S-peptide-2-CD5 WTWKGR

[0158] like Figure 5 As shown, it was confirmed that when the N-terminal amino acid sequence of S-peptide-2 was deleted step by step (A), the binding ability of S-peptide-2-ND1 to S-peptide-2-ND3 to AchR was reduced by 50% compared with S-peptide-2, but the binding to AchR was still maintained, while the binding ability of S-peptide-2-ND4 to S-peptide-2-ND5 was significantly reduced. In addition, it was confirmed that when the C-terminal amino acid sequence of S-peptide-2 was removed step by step (B), the binding of S-peptide-2-CD1 to S-peptide-2-CD5 with the C-terminal R (arg) removed to AchR was sharply reduced.

[0159] Thus, it was found that the 4th K (Lys) and the 11th R (arg) of the amino acid sequence of S-peptide-2 that binds to AchR are important sites for binding to AchR.

[0160] Example 6-2. Confirmation of binding ability of modified peptides to acetylcholine receptors

[0161] Among the modified peptides of S-peptide-2 confirmed in Example 6-1 above, S-peptide-2-ND3, which was confirmed to be the minimum sequence required for binding to AchR, and S-peptide-2-ND5, which is smaller than S-peptide-2-ND3, were used and applied to the surface plasmon resonance analyzer of Example 2 above to confirm their binding ability to AchR. The results are as follows: Figure 6 shown.

[0162] like Figure 6 As shown, in the case of (A) S-peptide-2-ND3, it was confirmed that the binding force to AchR was high even at low concentrations compared to (B) peptide-2-ND5. The dissociation constant was confirmed to be 3.1 μM for S-peptide-2-ND3 and 57 μM for S-peptide-2-ND5, indicating that the binding force of S-peptide-2-ND3 to AchR was significantly better than that of S-peptide-2-ND5 to AchR.

[0163] It was found that there was no significant difference in the binding ability of 11-mer S-peptide-2 and 8-mer S-peptide-2-ND3 to Ach, while the binding of hexamer (6-mer) S-peptide-2-ND5 to Ach was significantly reduced. In addition, from the above results, it can be confirmed that the three amino acids at the N-terminus of S-peptide-2 do not have much effect on the binding ability to AchR.

[0164] <Example 7. Confirmation of important positions in peptides for binding to acetylcholine receptors using alanine scanning>

[0165] Among the peptides confirmed in the above Example 6, S-peptide-2-ND3 and S-peptide-1-ND3 (KGKGTLNR) in which the three N-terminal amino acids of S-peptide-1 having a high amino acid sequence similarity to S-peptide-2 were removed were used to confirm important sites in the sequence of each peptide and alanine scanning was performed.

[0166] S-peptide-1-ND3 and S-peptide-2-ND3 were used as wild-type peptides, and the amino acid sequences of the peptides in Table 3 were substituted with alanine (alanine, Ala, A) in sequence, and their binding ability to AchR was compared in the same manner as the surface plasmon resonance analysis in Example 2. At this time, the concentration of each peptide was 20 μM. Figure 7 Shown in.

[0167] [Table 3]

[0168] Peptide name Amino acid sequence Peptide name Amino acid sequence S-peptide-1-ND3 (WT) KGKGTLNR S-peptide-2-ND3 (WT) KGRKSLLR S-peptide-1-ND3(K1A) AGKGTLNR S-peptide-2-ND3(K1A) AGRKSLLR S-peptide-1-ND3(G2A) KAKGTLNR S-peptide-2-ND3(G2A) KARKSLLR S-peptide-1-ND3(K3A) KGAGTLNR S-peptide-2-ND3(R3A) KGAKSLLR S-peptide-1-ND3(G4A) KGKATLNR S-peptide-2-ND3(K4A) KGRASLLR S-peptide-1-ND3(T5A) KGKGALNR S-peptide-2-ND3(S5A) KGRKALLR S-peptide-1-ND3(L6A) KGKGTANR S-peptide-2-ND3(L6A) KGRKSALR S-peptide-1-ND3(N7A) KGKGTLAR S-peptide-2-ND3(L7A) KGRKSLAR S-peptide-1-ND3(R8A) KGKGTLNA S-peptide-2-ND3(R8A) KGRKSLLA

[0169] like Figure 7 As shown, it was confirmed that when the 1st K, 3rd K and 8th R of S-peptide-1-ND3 were substituted with A, the binding ability to AchR decreased (A), and when the 1st K, 3rd R, 4th K and 8th R of S-peptide-2-ND3 were substituted with A, the binding ability to AchR decreased. From this, it can be seen that the K and R parts of S-peptide-1-ND3 and S-peptide-2-ND3 are important sites for binding to AchR.

[0170] <Example 8. Binding ability of peptide-modified S-peptide-2 bound to fatty acid derivatives to acetylcholine receptors Confirm >

[0171] Based on the modification of peptides capable of binding to AchR, changes in their binding ability to AchR were confirmed. Specifically, the peptide (palmitoyl-S peptide-2) with the highest binding ability to AchR among the peptides determined in Example 2 was used, and its binding ability to AchR was confirmed by the same method as the surface plasmon resonance analysis method in Example 2. The results are as follows: Figure 8 At this time, the binding ability of S peptide-2 to AchR was used as a control group.

[0172] like Figure 8 As shown in Figure 2, it was confirmed that palmitoyl-S peptide-2 has a stronger binding affinity to AchR than S peptide-2. The reason is that Fig. 9 As shown, a micelle structure is formed in which the fat-soluble palmitoyl is aggregated inward and the water-soluble S-peptide-2 is exposed outward, thereby having an affinity effect for binding to various sites of AchR.

[0173] <Example 9. Confirmation of the inhibitory effect of palmitoyl-S peptide-2 on acetylcholine receptors>

[0174] The AchR inhibitory effect of palmitoyl-S peptide-2, which was confirmed to have excellent binding ability to AchR in Example 8, was confirmed. At this time, the AchR inhibitory effect was confirmed in the same manner as in Example 3, and palmitoyl-S peptide-2 was treated at different concentrations. In order to compare the AchR inhibitory effect, S peptide-2, Synake, and Bungarotoxin were treated at different concentrations as a control group. The results are shown in FIG. Fig.10 shown.

[0175] like Fig.10 As shown, it can be seen that the inhibitory effect of palmitoyl-S peptide-2 on AchR is better than that of S peptide-2. More specifically, the IC50 values ​​of each peptide for AchR were observed, and Synake was 75μM, S peptide-2 was 750nM, palmitoyl-S peptide-2 was 75nM, and Bungarus toxin was 7.5nM, confirming that the inhibitory effect of Pal-Espep-2 on AchR was 10 times stronger than that of S peptide-2.

[0176] <Example 10. Palmitoyl-S peptide-2 cytotoxicity assay>

[0177] To evaluate the toxicity of palmitoyl-S peptide-2, WST analysis was performed in TE671 cells. Fig.11 Shown in.

[0178] like Fig.11 As shown, it was confirmed that palmitoyl-S peptide-2 did not show cytotoxicity even when treated at a concentration of 10 μM.

[0179] <Example 11. Binding ability to AchR by substitution of K and R amino acids in the amino acid sequence of S-peptide-2-ND3 Change Confirmation>

[0180] In Example 7, it was examined whether the binding ability to AchR was changed when K was substituted by R and R was substituted by K or N in the amino acids K and R of S-peptide-2-ND3 confirmed to be important sites for binding to AchR.

[0181] S-peptide-2-ND3 was used as the wild type, and the peptides shown in Table 4 below were synthesized, wherein K in the amino acid sequence of S-peptide-2-ND3 was replaced by R, and R was replaced by K or N, and the binding to AchR was confirmed by the same method as the surface plasmon resonance analysis method in Example 2. At this time, the concentration of each peptide was treated at 20 μM. The results are as follows: Fig.12 shown.

[0182] [Table 4]

[0183]

[0184]

[0185] like Fig.12 As shown in the figure, the binding force to AchR increased in the case of the peptide in which K of S-peptide-2-ND3 was replaced by R, and the binding force to AchR slightly decreased in the case of the peptide in which R was replaced by K, but no significant difference was confirmed. On the contrary, it was confirmed that the binding force to AchR was significantly reduced in the case of the peptide in which R was replaced by N. From this, it can be seen that even if the K and R parts in the amino acid of S-peptide-2-ND3 are replaced with each other, the binding to AchR does not change, but when R is replaced by N, the binding force to AchR is lost.

[0186] <Example 12. Preparation of a peptide library for screening optimized peptides with improved binding ability to acetylcholine receptors>

[0187] Example 12-1. Preparation and transformation of random peptide library DNA

[0188] Based on the results confirmed in Examples 6, 7, and 11 above, the S-peptide-2-ND3 peptide sequence was modified to prepare the following random peptide libraries: octamer (8mer), (K / R)X(K / R)(K / R)XXX(K / R); nonamer (9mer), X(K / R)X(K / R)(K / R)XXX(K / R), (K / R)X(K / R)(K / R)XXX(K / R)X; decamer (10mer), XX(K / R)X(K / R)(K / R)XXX(K / R), (K / R)X(K / R)(K / R)XXX(K / R)XX, XX(K / R)X(K / R)(K / R)XXX(K / R), (K / R)X(K / R)(K / R)XXX(K / R)XXX, XX(K / R)X(K / R)(K / R)XXX(K / R)X; 12mer, X(K / R)X(K / R)(K / R)XXX(K / R)XXX, XX(K / R)X(K / R)(K / R)XXX(K / R)XX, XXX(K / R)X(K / R)(K / R)XXX(K / R)X; 13mer, XX(K / R)X(K / R)(K / R)XXX(K / R)X XX, XXX(K / R)X(K / R)(K / R)XXX(K / R)XX; 14mer, XXX(K / R)X(K / R)(K / R)XXX(K / R)XXX; and 18mer, XXXXX(K / R)X(K / R)(K / R)XXX(K / R)XXXXX [(K / R) is either K or R, X is a random amino acid], and their acetylcholine receptor inhibitory effects were confirmed. It was confirmed that the binding ability of the peptides in the above random library to the acetylcholine receptor is similar to or better than that of S peptide-2 as a whole.

[0189] Hereinafter, an example of preparing a random peptide library as a representative peptide sequence with particularly excellent binding ability to the acetylcholine receptor and confirming the acetylcholine receptor inhibitory effect is described. The above-mentioned representative peptide sequences with particularly excellent binding ability to the acetylcholine receptor are octamer (8mer), (K / R)X(K / R)(K / R)XXX(K / R); 11mer (11mer), XXX(K / R)X(K / R)(K / R)XXX(K / R); 14mer (14mer), XXX(K / R)X(K / R)(K / R)XXX(K / R)XXX; and 18mer (18mer), XXXXX(K / R)X(K / R)(K / R)XXX(K / R)XXXXX [(K / R) is one of K or R, and X is a random amino acid].

[0190] To prepare peptide libraries of octamer (8mer), (K / R)X(K / R)(K / R)XXX(K / R); 11mer (11mer), XXX(K / R)X(K / R)(K / R)XXX(K / R); 14mer (14mer), XXX(K / R)X(K / R)(K / R)XXX(K / R)XXX; and 18mer (18mer), XXXXX(K / R)X(K / R)(K / R)XXX(K / R)XXXXX [(K / R) is either K or R, and X is a random amino acid], the DNA library shown in Table 5 below was synthesized (BIONEER, Korea). Thereafter, the DNA library synthesized in Table 5 was used as a template and PCR was performed using two single-stranded primers (TTCTATGCGGCCCAG, AACAGTTCTGCGGC) to amplify double-stranded insert DNA (insertDNA). The amplified insert DNA and pIGT (a phagemid vector) were treated with restriction enzymes Sfi I and Not I, and each DNA was purified. After the purified insert DNA and pIGT were ligated using T4 DNA ligase, the precipitate obtained by ethanol precipitation was dissolved in TE (Tris-EDTA) buffer to prepare a random peptide library DNA.

[0191] The prepared random peptide library DNA is placed in competent cells for mixing, and then transformed by electroporation. The transformed cells are placed in LB (luria bertani) liquid culture medium containing 20mM glucose, and transferred to a test tube, and cultured at 200rpm for 1 hour at 37°C. The cultured cells are placed in LB liquid culture medium containing 20mM glucose and 50μg / ml ampicillin, and cultured at 30°C for 1 day. After one day of culture, the supernatant is removed by centrifugation at 4000×g for 20min at 4°C to obtain precipitated cells. After the obtained cells are resuspended in LB liquid culture medium, glycerol is added to make the final concentration above 20%, and stored at -80°C to obtain a random peptide library.

[0192] [Table 5]

[0193]

[0194] Example 12-2. Production of optimized peptide recombinant phage

[0195] The random peptide library obtained in Example 12-1 was added to SB liquid culture medium (3% tryptone, 2% yeast extract, 1% MOPS free acid, 2% glucose), cultured at 37°C and 200 rpm for 20 minutes, and then 1×10 10 pfu helper phage and ampicillin to a final concentration of 50 μg / ml, and cultured again under the same conditions for 1 hour. The culture was transferred to SB liquid medium containing 50 μg / ml ampicillin and 10 μg / ml kanamycin and cultured under the same conditions for 16 hours to produce random peptide recombinant phage.

[0196] The produced random peptide recombinant phage was centrifuged at 5000 rpm for 10 minutes at 4°C to obtain a supernatant, and polyethylene glycol (PEG) / NaCl (20% PEG, 15% NaCl) was mixed in the supernatant at a ratio of 5:1 [v:v]. After being placed on ice for 1 hour, the supernatant was centrifuged at 13000 rpm for 20 minutes at 4°C, the supernatant was removed, and the precipitate was suspended with 1 ml of phosphate buffered saline (PBS), thereby obtaining random peptide recombinant phage.

[0197] <Example 13. Screening of optimized peptides with improved binding ability to acetylcholine receptors>

[0198] Example 13-1. Biopanning method

[0199] The process of treating the fixed antigen with a phage library expressing antibodies on the surface to select candidate antibodies that bind to the antigen is called biopanning, which includes three steps: bind / wash / elution. During the washing process, phages with antibodies with weak binding are removed, resulting in only phages expressing antibodies with high binding. By repeating this process 3 to 4 times, candidate antibodies with excellent antigen binding and specificity can be discovered. Therefore, biopanning is used to screen acetylcholine receptor binding peptides with excellent binding and specificity to the acetylcholine receptor of the present invention.

[0200] 10 μg / ml AchRα1 was added to 8 wells of a 96-well plate, 50 μl per well, and incubated overnight at 4°C. The next day, after washing once with 200 μl of Tris (20 mM pH7), 200 μl of 2% bovine serum albumin (BSA) was added, and blocking was performed at room temperature for 2 hours. The solution was discarded, and the plate was washed 3 times with 200 μl of Tris (20 mM pH7). 400 μl of random peptide recombinant phage (input phage) resuspended in PBS of Example 13-2 above was mixed with 400 μl of 2% BSA, and 100 μl was added to each well, and placed at 30°C for 1 hour. After removing all the solution in the wells and washing three times with Tris (20 mM pH 7), 100 μl of 0.2 M glycine (pH 2.2) was added to each well to elute the phages for 20 minutes, and then all were collected in an EP tube and neutralized by adding 200 μl of 1 M Tris (pH 9.0) (output phage).

[0201] To repeat the biopanning, 500 μl of the eluted phage was mixed with 5 ml of E. coli and incubated at 37°C, 200 rpm for 30 min, and then 1 × 10 10 pfu of helper phage and ampicillin to a final concentration of 50 μg / ml, and further cultured for 30 minutes. The culture medium was transferred to SB liquid medium containing 50 μg / ml ampicillin and 10 μg / ml kanamycin, and cultured overnight under the same conditions to regenerate the random peptide recombinant phage. The regenerated random peptide recombinant phage was centrifuged at 5000 rpm for 10 minutes at 4°C to obtain a supernatant, PEG / NaCl was mixed in the supernatant at 5:1 [v:v], and placed on ice for 1 hour, then centrifuged at 13000 rpm for 20 minutes at 4°C to remove the supernatant, and the precipitate was resuspended with 1 ml of phosphate buffered saline (PBS) for secondary bio-selection.

[0202] For each round of bio-panning, random recombinant phages were regenerated and bio-panned in the same manner as described above. At this time, the number of washes with Tris (20 mM pH 7) was set to 3 or 6 times in the bio-panning step, and AchR was bio-panned 5 times.

[0203] To measure the number of input phage and output phage in each round of bio-panning, they were mixed with E. coli with an absorbance of 0.7 at 600 nm (OD600=0.7) and plated on agar plates containing ampicillin. The results are shown in Tables 6 to 9 below.

[0204] [Table 6]

[0205]

[0206] [Table 7]

[0207]

[0208] [Table 8]

[0209]

[0210]

[0211] [Table 9]

[0212]

[0213] Example 13-2. ELISA using random peptide library input recombinant phage (enyzme-linked immunosorbent assay, ELISA) method

[0214] ELISA was performed for streptavidin and AchR using the input phage from each biopanning in Example 13-1 above.

[0215] In a 96-well ELISA plate, 50 μl of 10 μg / ml AchR or streptavidin was added to each well, incubated overnight at 4°C, washed 3 times with Tris (20 mM pH 7) the next day, 2% BSA diluted with PBS was added and blocked for 2 hours at room temperature, all the solution was discarded and washed 3 times with Tris (20 mM pH 7). 800 μl of the first, second, third, fourth and fifth input phages in Tables 6 to 9 of Example 13-1 were mixed with 200 μl of 10% BSA, 100 μl was added to each well, and placed at 30°C for 1 hour. After removing all the solution in the wells, wash with Tris (20mM pH7) 3 times, then add 100μl of HRP (horseradish peroxidase)-conjugated anti-M13 antibody (HRP-conjugated anti-M13 Ab, GE Healthcare) diluted 1:1000 to each well and react at 30°C for 1 hour. After that, wash with Tris (20mM pH7) 3 times, add 100μl of tetramethylbenzidine (TMB) (HRP substrate) solution to each well to induce color reaction, then add 100μl of 1M HCl to stop the reaction, and measure the absorbance at 450nm (OD450). The results are as follows: Fig.13 shown.

[0216] like Fig.13 As shown, the 8mer, 11mer and 14mer random peptide libraries obtained from the bio-panning input phage showed very high binding specificity to AchR as a whole compared to streptavidin. The 1st, 3rd, 4th and 8th amino acids of the 8mer were fixed to lysine (K) or arginine (R), while the 2nd, 5th, 6th and 7th amino acids were formed to any amino acid, that is, the polypeptide library expressed by the general formula: (K or R)-X-(K or R)-(K or R)-XXX-(K or R) was able to bind to AchR in a highly specific manner as a whole, which was independent of the types of the 2nd, 5th, 6th and 7th amino acids (X).

[0217] Similarly, in 11mer, the polypeptide library expressed by the general formula: XXX-(K or R)-X-(K or R)-(K or R)-XXX-(K or R), regardless of the type of any amino acid (amino acids at positions 1, 2, 3, 5, 8, 9 and 10) represented by X, is generally able to bind with high specificity to AchR when the amino acids at positions 4, 6, 7 and 11 are lysine (K) or arginine (R).

[0218] Similarly, in 14mer, the polypeptide library expressed by the general formula: XXX-(K or R)-X-(K or R)-(K or R)-XXX-(K or R)-XXX, regardless of the type of any amino acid represented by X (amino acids at positions 1, 2, 3, 5, 8, 9, 10, 12, 13 and 14), when the amino acids at positions 4, 6, 7 and 11 are lysine (K) or arginine (R), can bind to AchR in a manner with high specificity as a whole.

[0219] From the above results, it was confirmed that the acetylcholine receptor binding peptide of the present invention comprising the amino acid sequence represented by [Chemical Formula 1], [Chemical Formula 2], [Chemical Formula 3] or [Chemical Formula 4] can bind to AchR with high specificity.

[0220] [Chemical formula 1]

[0221] X L -(K or R)-X-(K or R)-X M -(K or R)-X N

[0222] (The above X L , X M , X N Each independently represents 1 to 8, and X represents a sequence consisting of one arbitrary amino acid).

[0223] [Chemical formula 2]

[0224] (K or R)-X-(K or R)-(K or R)-X M-1 -(K or R)

[0225] (The above X M-1 is 1 to 3, and X represents a sequence consisting of one arbitrary amino acid).

[0226] [Chemical formula 3]

[0227] X L -(K or R)-X-(K or R)-(K or R)-X M-1 -(K or R)

[0228] (The above X L , X M-1 Each independently represents 1 to 3, and X represents a sequence consisting of one arbitrary amino acid).

[0229] [Chemical formula 4]

[0230] X L -(K or R)-X-(K or R)-(K or R)-X M-1 -(K or R)-X N

[0231] (The above X L , X M-1 , X N Each independently represents 1 to 3, and X represents a sequence consisting of one arbitrary amino acid).

[0232] The amino acid sequence was expressed in a certain format based on important peptide sites and sequences, and a library of the peptides was prepared. It was confirmed that the prepared library as a whole binds to the acetylcholine receptor and inhibits its action.

[0233] And, if Fig.13 As shown, it was confirmed that the 8mer, 11mer and 14mer random peptide libraries obtained from the input phage of the first bio-panning showed higher AchR binding specificity than streptavidin, while the 18mer random peptide library obtained from the input phage of the first bio-panning had low binding specificity to AchR.

[0234] Thus, it was confirmed that the 8- to 14-mer random peptides maintained binding to AchR, but the 18-mer random peptide had reduced binding to AchR. This difference in binding strength to AchR is expected to occur due to the number of random amino acids (X).

[0235] Example 13-3. Screening for optimized peptides with improved binding ability to acetylcholine receptors

[0236] Further screening was performed to screen out optimized peptides with improved binding affinity to AchR from the 4th and 5th biopanning input phages with high binding affinity and specificity to AchR (which can be confirmed from Examples 13-1 and 13-2).

[0237] After the 4th and 5th bio-panning output phages of Example 13-1 were inoculated into E. coli, they were plated onto agar medium in such a manner that about 100 to 200 plaques were produced per plate. Each plaque was inoculated into 1 ml of SB liquid medium containing 50 μg / ml ampicillin using a sterile pipette tip, and cultured at 37°C for 5 hours with shaking, and 30 μl of helper phage was added respectively, and cultured at 37°C for one day at 200 rpm. The culture medium was centrifuged at 12,000 rpm for 2 minutes to recover the supernatant, and then 2% BSA was added for phage screening.

[0238] In a 96-well ELISA plate, 50 μl of 5 μg / ml AchR or streptavidin was added to each well and placed at 4°C for 1 day. The next day, the solution in each well was discarded, 2% BSA was added, and the plate was blocked at room temperature for 2 hours. After that, all the solution was discarded and the plate was washed 3 times with Tris (20 mM pH 7). 100 μl of each phage obtained from the plaque prepared in the above manner was inoculated into the wells, 100 μl was inoculated into each well, and placed at 30°C for 1 hour. After removing all the solution in the wells and washing 3 times with Tris (20 mM pH 7), 100 μl of HRP-coupled anti-M13 antibody diluted 1:2000 was added to each well and reacted at 30°C for 1 hour. After washing three times with Tris (20mM pH7), 100μl of tetramethylbenzidine solution was added to each well to induce color reaction, and then 100μl of 1M H2SO4 was added to terminate the reaction, and the absorbance was measured at 450nm (OD450). The measured absorbance was converted into the ratio of AchR absorbance to streptavidin absorbance (AchR signal / streptavidinsignal), and the results were as follows: Figures 14 to 16 shown.

[0239] like Figures 14 to 16 As shown, it was observed that different phages had different binding abilities to AchR, and the phage with the highest ratio of AchR absorbance to streptavidin absorbance was selected. The results are shown in Tables 10 to 12, and the results confirmed that the optimized peptides 8mer (L1), 11mer (L2), and 14mer (L3) all showed higher AchR binding ability and specificity than S peptide-2 (positive control).

[0240] Plasmid DNA was purified from the phage screened in the above manner, and peptide sequence analysis was performed using the purified plasmid DNA and a primer for base sequence analysis consisting of GATTACGCCAAGCTTTGGAGC, thereby screening for an optimized peptide whose sequence was confirmed and had excellent binding specificity to AchR.

[0241] In addition, in order to compare with the peptide of the amino acid sequence described in Korean Patent Publication No. 10-2014-0139010, the peptide of the amino acid sequence was synthesized in the manner shown in Table 13 below, and the binding specificity to AchR was confirmed in the same manner as the above method, and the binding specificity similar to that of S peptide-2 was confirmed. However, compared with the entire 11mer or 14mer library, the sequence of R repeats or the sequence of G repeats at both ends of 8mer showed a low level of binding specificity. This is considered to be due to the electric charge or steric conformation characteristics of the peptide.

[0242] [Table 10]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252] [Table 11]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261] [Table 12]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271] [Table 13]

[0272] SEQ ID NO Peptides OD Sequence(Seq.) 601 L2-201 0.307 RRRRRRRRRRR 602 L2-202 0.314 GGGRKKRRQRR 603 L2-203 0.302 GGRKKRRQRRR 604 L3-201 0.315 GGGRKKRRQRRRGG 605 L3-202 0.301 GGRKKRRQRRRGGG 605 L2-204 0.311 GGGRRRRRRRR S peptide-2 (con) 0.303 WTWKGRKSLLR

[0273] <Example 14. Confirmation of the binding ability of the optimized peptide to the acetylcholine receptor>

[0274] In the above Example 13-3, 40 optimized peptides with excellent binding specificity to AchR were screened from each library and synthesized, and their binding forces to AchR (Ru; Resonance Units) were compared using the surface plasmon resonance (SPR) analysis method of Example 2. At this time, the optimized peptides were operated under the concentration conditions of 3μM and 10μM, and the results were as follows: Figures 17 to 19 As shown, S peptide-2 was used as a positive control. The 40 optimized peptides of 8mer (L1), 11mer (L2), and 14mer (L3) all showed higher AchR binding than S peptide-2 (positive control), and 20 peptides with high binding to AchR were derived from each library.

[0275] <Example 15. Confirmation of the inhibitory effect of each optimized peptide (L1, L2, L3) on acetylcholine receptor>

[0276] In order to confirm the AchR inhibitory effect of the 8mer, 11mer and 14mer peptides with excellent binding ability to AchR confirmed in Example 14 above, the AchR inhibitory effect was confirmed in the same manner as in Example 3 above. At this time, the concentration of each peptide was treated at 20 μM, and S peptide-2 was also treated as a control group. In addition, high concentrations of 400 μM or 600 μM of nicotine were added to confirm the superiority of the AchR inhibitory ability of the optimized peptides. The results are as follows: Figures 20-22 shown.

[0277] like Figures 20-22As shown, when a high concentration of 400 μM nicotine was added and the peptide concentration was 20 μM, the AchR inhibition rate of S peptide-2 as the control group was about 10%, that is, almost none, while the 8mer, 11mer, and 14mer peptides all had an inhibition rate of more than 50% on the AchR, confirming that the inhibitory effect was superior to that of S peptide-2. Among them, the 8mer L1-13, the 11mer L2-110, and the 14mer L3-27, 28, and 37 peptides showed an inhibitory effect close to 100%. Further, it was confirmed that the inhibition rate of the peptides on the AchR action in the cell was almost consistent with the binding force of each peptide and AchR in Example 14 above.

[0278] <Example 16. Confirmation of Acetylcholine Receptor Binding Ability of Representative Peptides>

[0279] The binding capacity (Ru; Resonance Units) of the representative peptides L1-13, L2-110, L3-27, L3-28, and L3-37 determined in Example 15 was compared with that of AchR using the surface plasmon resonance (SPR) analysis method of Example 2. At this time, the analysis was performed under the same conditions of 3 μM peptide concentration. The results are shown in FIG. Fig.23 shown.

[0280] like Fig.23 As shown, the binding ability of 11mer L2-110 and 14mer L3-27, 28, 37 to AchR is higher than that of 8mer L1-13, and the 14mer L3-27, 28, 37 peptide has the highest binding ability. Thus, it was confirmed that the peptide of the present invention also showed high binding ability to AchR when formed in the form of 8mer or 11mer, and it was confirmed that it had the best binding ability when it was 14mer.

[0281] <Example 17. Confirmation of the inhibitory effect of representative peptides L2-110, L3-27, 28, 37 on acetylcholine receptors>

[0282] In order to confirm the AchR inhibitory effect of the L2-110, L3-27, L3-28, and L3-37 peptides that have excellent binding ability to AchR in Example 16, the AchR inhibitory effect was confirmed in the same manner as in Example 3. At this time, each peptide was treated at different concentrations, and S peptide-2 was also treated as a control group. The results are shown in FIG. Fig.24 shown.

[0283] like Fig.24As shown, at a high concentration of 400 μM nicotine, S peptide-2 inhibited AchR action by 100% at 80 μM, but could not inhibit at a concentration of 70 μM. 11mer L2-110 and 14mer L3-27 inhibited AchR action by 100% at 10 μM, but could not inhibit at a concentration of 5 μM. 14mer L3-28 inhibited AchR action by 100% at 5 μM, but could not inhibit at a concentration of 2.5 μM. In addition, L3-37, also a 14mer, inhibited by 100% at 2.5 μM and also inhibited by 50% at 1 μM.

[0284] Based on this result, Fig.25 The inhibitory ability to nicotinic acetylcholine receptors is shown in multiples. Compared with S peptide-2, L2-110 and L3-27 have an inhibitory effect 8 times stronger, L3-28 is 16 times, and L3-37 is 32 times stronger. Finally, it was confirmed that the excellent inhibitory effect can be shown in a manner proportional to the acetylcholine receptor binding ability of Example 15.

[0285] <Example 18. Confirmation of binding ability to acetylcholine receptor based on different modifications at each end of representative peptides>

[0286] Each end of the L2-110, L3-27, L3-28, and L3-37 peptides confirmed in Example 17 was not modified to confirm changes in binding ability to AchR. Specifically, in the same manner as in Example 8, the peptides were modified with palmitoyl, myristic acid, or stearic acid as fatty acid derivatives, or acetylated or PEGylated, and compared with the unmodified basic peptide. The results are shown in Figures 26 to 29 middle.

[0287] like Figures 26 to 29 As shown, when the fatty acid derivatives were bound to the ends of the peptides of the present invention, the binding force of all peptides increased by about 10 times (palmitoyl-, myristyl-, stearic-). At this time, it was confirmed that the peptides modified with palmitoyl showed higher binding force than the peptides modified with other fatty acid derivatives.

[0288] When the termini of the peptides of the present invention were acetylated, the binding affinity to AchR was similar to that when the termini of the peptides were not modified, and when the termini of the peptides were PEGylated, the binding affinity to AchR was reduced by about 50% compared to that when the termini of the peptides were not modified.

[0289] In addition, if Fig.30As shown, when the termini of the peptides of the present invention were modified with myristic acid or stearic acid, a micellar structure was confirmed to be formed, as in the case of palmitoyl binding in the above Example 8.

[0290] <Example 19. Confirmation of palmitoyl-L2-110, palmitoyl-L3-27, palmitoyl-L3-28, palmitoyl-L3-37 Acetylcholine receptor inhibition>

[0291] The AchR inhibitory effect was confirmed for the palmitoyl-L2-110, palmitoyl-L3-27, palmitoyl-L3-28, and palmitoyl-L3-37 peptides that had excellent binding ability to AchR in Example 18 by the same method as in Example 3. At this time, bungarotoxin was also treated as a control group. Fig.31 Shown in.

[0292] like Fig.31 As shown, palmitoyl-L3-37 had the highest binding affinity to AchR, followed by palmitoyl-L3-28, palmitoyl-L3-27, and palmitoyl-L2-110 showing similar levels.

[0293] Example 20. Confirmation of palmitoyl-L2-110, palmitoyl-L3-27, palmitoyl-L3-28, and palmitoyl-L3-37 peptides Cytotoxicity>

[0294] To evaluate the toxicity of palmitoyl-L2-110, palmitoyl-L3-27, palmitoyl-L3-28, and palmitoyl-L3-37 peptides, WST assay was performed using TE671 cells. Figures 32-35 Shown in.

[0295] like Figures 32-35 As shown, it was confirmed that all peptides showed no cytotoxicity even at a concentration of 10 μM.

[0296] Example 21. In vivo expression of palmitoyl-L3-37 vivo) Efficacy Analysis>

[0297] Animal efficacy evaluation was performed using palmitoyl-L3-37, which has the best binding ability to acetylcholine receptors in Example 1 above. Palmitoyl-L3-37 was injected into the right hind thigh muscle (IM) of 6-week-old female BALB / c mice at a concentration of 10 mg / kg. The gait analysis (CatWalk) data of the mice before injection was compared with the gait analysis (CatWalk) data of the mice 30 minutes after injection. The results are as follows: Fig.36 shown.

[0298] like Fig.36As shown, it was confirmed that the area of ​​the sole of the right hind leg of the mouse after injection was reduced compared with that before injection of palmitoyl-L3-37 (A). It was also confirmed that after injection of palmitoyl-L3-37, the area of ​​the sole of the mouse foot contacting the floor (B) and the average value of the maximum area (C) were also reduced.

[0299] Thus, it was found that palmitoyl-L3-37 binds to acetylcholine receptors, thereby affecting muscle relaxation in animals by inhibiting acetylcholine.

[0300] <Example 22. Animal efficacy (ED50) and animal toxicity (LD50) evaluation of palmitoyl-L3-37>

[0301] Animal efficacy (ED50) was assessed by digit abduction score (DAS) analysis. The DAS assay was developed to measure the local muscle weakening efficacy of drugs injected intramuscularly (IM) into the skeletal muscle of the mouse hind limb, and botulinum toxin was also evaluated in the same manner (Aoki, 1999).

[0302] Specifically, the DAS value of palmitoyl-L3-37 of Example 18 above was evaluated. 45 6-week-old female BALB / c mice were randomly divided into groups of 5, and were divided into treatment groups to be injected with palmitoyl-L3-37 at 0.1 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, and 25 mg / kg, and treatment groups to be injected with saline solution (saline) (sterilized 0.9% NaCl) or Bungarus toxin at 70 μg / kg. Then, palmitoyl-L3-37, saline solution, and Bungarus toxin were injected into the hind thigh muscles of mice at the above concentrations and in an amount of 50 μl. Thereafter, the body weight of the mice and the soles of the feet at the injection site were observed and recorded every day. The results are as follows: Figure 37 to Figure 39 shown.

[0303] Fig.37 The results of the observations were obtained 7 days after the injection. Ten minutes after the administration of the sample (day 0), the efficacy of the palmitoyl-L3-37 1 mg / kg administration group was DAS 2, the efficacy of the palmitoyl-L3-37 3 mg / kg, 10 mg / kg and 25 mg / kg administration groups was evaluated as DAS 4, and the efficacy of the palmitoyl-L3-37 1 mg / kg administration group and the saline solution or Bungarus toxin administration group (control group) was evaluated as DAS 0. Thus, it was found that the efficacy (ED50) of palmitoyl-L3-37 in animal experiments is 1 mg / kg. In addition, during the 7-day observation period, it was confirmed that the DAS values ​​of the other groups except the palmitoyl-L3-37 25 mg / kg administration group decreased and recovered, but the palmitoyl-L3-37 25 mg / kg administration group maintained DAS 4.

[0304] Fig.38The results of observing the palmitoyl-L3-37 25 mg / kg administration group at intervals of one week until 21 days after administration confirmed that the DAS value of the palmitoyl-L3-37 25 mg / kg administration group gradually decreased after the 7th day of administration, and after the 19th day of palmitoyl-L3-37 administration, the DAS value decreased to below 1 and recovered. Thus, it was found that the efficacy of palmitoyl-L3-37 is reversible.

[0305] Finally, the acute toxicity of palmitoyl-L3-37 was evaluated by measuring body weight every day for 7 days after administration (refer to Fig.39 ), it was confirmed that the body weight of mice in all groups gradually increased within 7 days, and no toxicity was produced in the groups treated with palmitoyl-L3-37 even in the group treated with the highest concentration of 25 mg / kg. Sequence Listing <110> Aimicogen Co., Ltd. amicogen <120> Acetylcholine receptor inhibitory peptide and use thereof Peptide for inhibition of acetylcholine receptor and use thereof <130> OPC-19-0027 <150> KR 10-2018-0169425 <151> 2018-12-26 <160> 606 <170> KoPatentIn 3.0 <210> 1 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 1 Lys Ala Lys Lys Ile Arg Gln Arg 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 2 Lys Lys Arg Lys Gly Ser Ala Lys 1 5 <210> 3 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 3 Arg Gly Lys Arg Gln Leu Gly Arg 1 5 <210> 4 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 4 Lys Leu Lys Lys Phe Pro Val Arg 1 5 <210> 5 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 5 Arg His Lys Lys Ser Pro Trp Lys 1 5 <210> 6 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 6 Arg Pro Arg Arg Thr His Ile Lys 1 5 <210> 7 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 7 Lys His Lys Lys Leu Asn Gln Arg 1 5 <210> 8 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 8 Arg Ala Lys Arg Met Cys Cys Lys 1 5 <210> 9 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 9 Arg Gln Arg Arg Asn Asp Met Lys 1 5 <210> 10 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 10 Lys Arg Lys Lys Asp Trp Trp Arg 1 5 <210> 11 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 11 Arg Ala Arg Lys Asp Ala Phe Lys 1 5 <210> 12 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 12 Lys Trp Arg Arg Glu Gly Phe Lys 1 5 <210> 13 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 13 Arg Phe Arg Arg Gly Val Arg Arg 1 5 <210> 14 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 14 Lys Ala Arg Arg Gln Glu Asp Lys 1 5 <210> 15 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 15 Arg Phe Lys Arg Leu Cys Met Lys 1 5 <210> 16 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 16 Lys Leu Lys Arg Arg Ser Arg Arg 1 5 <210> 17 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 17 Arg Pro Arg Arg Ser Leu Asp Arg 1 5 <210> 18 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 18 Lys His Lys Lys Gln Asn Val Arg 1 5 <210> 19 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 19 Lys Phe Lys Arg Thr Glu Gly Arg 1 5 <210> 20 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 20 Arg Gly Lys Lys Ala Val Arg Lys 1 5 <210> twenty one <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> twenty one Lys Phe Lys Lys His Gly Val Lys 1 5 <210> twenty two <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> twenty two Lys Thr Lys Lys Ile His Ser Lys 1 5 <210> twenty three <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> twenty three Arg Asp Arg Lys Ile His Asp Lys 1 5 <210> twenty four <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> twenty four Arg Pro Arg Arg Gly His Gln Lys 1 5 <210> 25 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 25 Lys Thr Lys Lys Leu Tyr Glu Lys 1 5 <210> 26 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 26 Arg Gln Lys Lys Asp Asn Gln Lys 1 5 <210> 27 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 27 Arg Gln Arg Lys Ser Met Gln Arg 1 5 <210> 28 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 28 Arg Gly Arg Arg Trp Phe Val Lys 1 5 <210> 29 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 29 Arg Asn Lys Arg Asp Glu Asn Lys 1 5 <210> 30 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 30 Arg Leu Arg Arg Trp Cys Val Lys 1 5 <210> 31 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 31 Arg Gln Lys Lys Pro Trp Val Lys 1 5 <210> 32 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 32 Arg Trp Lys Arg Ser Glu Gln Arg 1 5 <210> 33 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 33 Arg Leu Lys Arg Ala Pro Gly Arg 1 5 <210> 34 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 34 Lys Met Arg Arg Ala Gln Gly Arg 1 5 <210> 35 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 35 Lys Ile Lys Lys Ala Ala Arg Arg 1 5 <210> 36 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 36 Lys Asn Arg Lys Asn Leu Tyr Arg 1 5 <210> 37 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 37 Lys Cys Lys Lys Met Thr Glu Arg 1 5 <210> 38 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 38 Lys Thr Arg Arg Val Asp Leu Arg 1 5 <210> 39 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 39 Lys Ser Arg Lys Trp Gly Trp Arg 1 5 <210> 40 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 40 Lys Arg Arg Arg Phe Arg Trp Lys 1 5 <210> 41 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 41 Lys Tyr Lys Lys Gln His Thr Lys 1 5 <210> 42 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 42 Arg Gly Arg Lys Lys Cys Gly Lys 1 5 <210> 43 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 43 Lys Leu Arg Lys Gln Lys Leu Arg 1 5 <210> 44 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 44 Arg Asn Arg Lys Ile Pro Leu Lys 1 5 <210> 45 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 45 Arg Leu Arg Arg Arg Tyr Arg Arg 1 5 <210> 46 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 46 Lys Trp Arg Lys Arg Arg Ile Lys 1 5 <210> 47 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 47 Lys Thr Lys Arg Met Leu Ala Lys 1 5 <210> 48 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 48 Lys Glu Lys Arg Ala Val His Lys 1 5 <210> 49 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 49 Arg Val Arg Arg Asp Gly His Arg 1 5 <210> 50 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 50 Arg Ala Lys Lys Cys Tyr His Lys 1 5 <210> 51 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 51 Lys Gly Lys Arg Asp Ser Asn Lys 1 5 <210> 52 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 52 Lys Val Arg Lys Ser Leu Trp Lys 1 5 <210> 53 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 53 Arg Ser Lys Lys Ser Leu Tyr Arg 1 5 <210> 54 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 54 Arg Gly Lys Arg Gly Cys Glu Arg 1 5 <210> 55 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 55 Lys Gln Lys Lys Thr Gly Phe Arg 1 5 <210> 56 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 56 Lys Tyr Arg Arg Asn Leu Val Arg 1 5 <210> 57 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 57 Arg Ile Arg Arg Gly Ser Val Arg 1 5 <210> 58 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 58 Arg Ser Lys Arg Met Asn Gly Lys 1 5 <210> 59 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 59 Arg His Lys Lys Phe Ile Glu Lys 1 5 <210> 60 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 60 Arg Ile Arg Arg Val Ser Gln Arg 1 5 <210> 61 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 61 Arg Pro Lys Lys Trp Met Gln Lys 1 5 <210> 62 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 62 Lys Glu Arg Lys His Glu Ala Lys 1 5 <210> 63 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 63 Lys Glu Arg Lys Ala Ser Ala Lys 1 5 <210> 64 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 64 Lys Met Arg Arg Ile Met Tyr Lys 1 5 <210> 65 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 65 Lys Trp Lys Arg Asn Cys Thr Lys 1 5 <210> 66 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 66 Arg Cys Lys Lys Asn Pro Glu Lys 1 5 <210> 67 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 67 Lys Gln Arg Lys Pro His Gly Arg 1 5 <210> 68 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 68 Lys Ala Lys Arg Gly His Phe Lys 1 5 <210> 69 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 69 Lys Ser Lys Arg His His Glu Lys 1 5 <210> 70 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 70 Lys Ser Arg Lys His Cys Asn Arg 1 5 <210> 71 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 71 Arg Ser Lys Lys Ile Asn Asn Lys 1 5 <210> 72 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 72 Arg Val Arg Arg Ser Trp Ile Arg 1 5 <210> 73 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 73 Lys Ser Arg Arg Ser Ala Gly Lys 1 5 <210> 74 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 74 Lys Met Arg Lys His Asp Val Arg 1 5 <210> 75 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 75 Lys Gly Lys Lys Leu Ser Gln Arg 1 5 <210> 76 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 76 Lys Trp Arg Arg Glu Gln Phe Arg 1 5 <210> 77 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 77 Lys Asp Lys Arg Trp Ala Asn Arg 1 5 <210> 78 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 78 Lys His Lys Arg Thr Ala Gln Arg 1 5 <210> 79 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 79 Lys Pro Lys Arg Glu Met His Lys 1 5 <210> 80 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 80 Arg Trp Lys Lys Asn Ile Asn Lys 1 5 <210> 81 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 81 Lys Trp Lys Lys Met Met Glu Arg 1 5 <210> 82 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 82 Arg Ile Arg Arg Trp Trp Val Arg 1 5 <210> 83 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 83 Arg Ile Arg Arg His Met Tyr Arg 1 5 <210> 84 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 84 Lys Pro Lys Lys Pro Pro Ala Arg 1 5 <210> 85 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 85 Arg Leu Lys Arg Gly Gln Phe Lys 1 5 <210> 86 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 86 Lys Asn Lys Arg Thr Pro Val Lys 1 5 <210> 87 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 87 Lys Trp Arg Arg Ala Phe Gly Arg 1 5 <210> 88 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 88 Lys Asn Lys Lys Cys Val Gly Arg 1 5 <210> 89 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 89 Arg Thr Arg Lys Cys Val Leu Lys 1 5 <210> 90 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 90 Lys Ile Lys Arg Asp Leu Tyr Lys 1 5 <210> 91 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 91 Arg Glu Lys Arg Tyr Met Ala Arg 1 5 <210> 92 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 92 Arg Val Lys Lys Ala Glu Thr Arg 1 5 <210> 93 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 93 Arg Gly Arg Arg Gly Thr Met Arg 1 5 <210> 94 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 94 Arg Thr Lys Arg Trp Gln Leu Lys 1 5 <210> 95 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 95 Arg Leu Arg Lys Ser Leu Gly Lys 1 5 <210> 96 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 96 Arg Pro Lys Arg Asn Trp Ala Lys 1 5 <210> 97 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 97 Lys Asp Arg Lys Val Asn Ser Arg 1 5 <210> 98 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 98 Lys Trp Arg Arg Asn Gly Gln Arg 1 5 <210> 99 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 99 Arg Phe Lys Arg Met Val Trp Arg 1 5 <210> 100 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 100 Lys Glu Arg Lys Gly Ala Val Arg 1 5 <210> 101 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 101 Lys Thr Lys Arg Gly Ser Leu Lys 1 5 <210> 102 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 102 Lys Thr Lys Arg Val Asp Pro Lys 1 5 <210> 103 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 103 Arg Ala Arg Lys Leu His Asn Arg 1 5 <210> 104 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 104 Arg Gly Lys Lys Pro Trp Trp Arg 1 5 <210> 105 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 105 Lys Gly Lys Lys Tyr Tyr Gln Lys 1 5 <210> 106 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 106 Arg Trp Arg Arg Ser Val Ile Lys 1 5 <210> 107 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 107 Arg Gln Lys Lys Asp Phe Leu Lys 1 5 <210> 108 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 108 Arg Gly Arg Lys Pro Ile Trp Lys 1 5 <210> 109 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 109 Lys Pro Arg Arg Pro Asp Thr Arg 1 5 <210> 110 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 110 Lys Val Lys Arg Leu Trp Asn Arg 1 5 <210> 111 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 111 Lys Asp Arg Lys Gly Val Tyr Lys 1 5 <210> 112 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 112 Arg Val Lys Arg Phe Val Pro Lys 1 5 <210> 113 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 113 Lys Pro Lys Arg Asp Gln Ser Arg 1 5 <210> 114 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 114 Lys Asp Lys Lys Gln Trp Gly Arg 1 5 <210> 115 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 115 Arg Phe Arg Lys Met Ile Pro Lys 1 5 <210> 116 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 116 Lys Phe Arg Lys His Val Cys Lys 1 5 <210> 117 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 117 Arg Pro Lys Arg Ser Pro Ser Lys 1 5 <210> 118 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 118 Arg Tyr Lys Lys Val Pro Ala Lys 1 5 <210> 119 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 119 Arg Ser Arg Arg Cys Pro Val Lys 1 5 <210> 120 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 120 Arg Cys Lys Arg Cys Asp Asn Lys 1 5 <210> 121 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 121 Arg Gly Lys Lys Gln Leu Ser Lys 1 5 <210> 122 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 122 Lys Ser Lys Arg Pro Glu Gly Arg 1 5 <210> 123 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 123 Lys Cys Arg Lys Thr Met Gly Arg 1 5 <210> 124 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 124 Arg Asp Arg Lys Asn Pro Val Arg 1 5 <210> 125 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 125 Lys Pro Lys Arg Ser Ala Pro Arg 1 5 <210> 126 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 126 Lys Gly Lys Arg Thr Gly Cys Lys 1 5 <210> 127 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 127 Arg Phe Arg Lys Pro Thr Asp Arg 1 5 <210> 128 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 128 Arg Met Lys Lys Phe His Thr Arg 1 5 <210> 129 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 129 Lys Ile Lys Lys Tyr Tyr Trp Lys 1 5 <210> 130 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 130 Arg Ile Lys Arg Asn Asn Cys Lys 1 5 <210> 131 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 131 Arg His Lys Arg Met Leu Trp Arg 1 5 <210> 132 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 132 Lys Val Arg Arg Val Phe Leu Lys 1 5 <210> 133 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 133 Lys Asp Lys Arg Pro Glu Cys Lys 1 5 <210> 134 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 134 Lys Thr Arg Arg Ser Ala Cys Arg 1 5 <210> 135 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 135 Lys Phe Arg Lys Gly Pro Tyr Arg 1 5 <210> 136 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 136 Lys Phe Lys Lys Ser Ala Pro Arg 1 5 <210> 137 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 137 Lys Pro Arg Lys Ile Gln Gly Arg 1 5 <210> 138 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 138 Lys Met Arg Lys Gly Trp Asp Lys 1 5 <210> 139 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 139 Lys Phe Arg Arg Gln Ser Thr Arg 1 5 <210> 140 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 140 Lys Asn Arg Arg Ala Asp Cys Arg 1 5 <210> 141 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 141 Lys Asn Lys Arg Trp Val Phe Lys 1 5 <210> 142 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 142 Arg Cys Arg Lys Asp Thr Ala Arg 1 5 <210> 143 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 143 Lys Ala Arg Arg Val Gly Thr Lys 1 5 <210> 144 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 144 Lys Val Lys Lys Ile Tyr Tyr Arg 1 5 <210> 145 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 145 Lys Ala Lys Arg Asp Tyr Leu Arg 1 5 <210> 146 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 146 Lys Val Lys Arg Leu Pro Tyr Arg 1 5 <210> 147 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 147 Arg His Arg Arg Ala Asn Phe Arg 1 5 <210> 148 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 148 Lys Pro Lys Lys Gly Gly Trp Lys 1 5 <210> 149 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 149 Lys Glu Lys Arg Leu Tyr Ala Arg 1 5 <210> 150 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 150 Arg Glu Lys Lys Gln Glu Val Lys 1 5 <210> 151 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 151 Lys Ser Arg Arg Ala Val Phe Arg 1 5 <210> 152 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 152 Arg His Arg Lys Tyr Val Asp Lys 1 5 <210> 153 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 153 Arg His Lys Arg Trp Ser Gly Arg 1 5 <210> 154 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 154 Arg Asp Arg Lys Phe Val Gln Lys 1 5 <210> 155 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 155 Arg Tyr Arg Arg Trp Phe Tyr Arg 1 5 <210> 156 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 156 Arg Gln Arg Arg Met Thr Pro Arg 1 5 <210> 157 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 157 Arg Asn Lys Arg Met Asp Gly Lys 1 5 <210> 158 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 158 Arg Pro Lys Lys His Gln Glu Arg 1 5 <210> 159 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 159 Lys Lys Arg Lys Ser Leu Leu Arg 1 5 <210> 160 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 160 Lys Ile Lys Arg Asn Val Phe Lys 1 5 <210> 161 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 161 Lys Tyr Lys Arg Glu Glu Tyr Arg 1 5 <210> 162 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 162 Lys Ile Arg Arg Val Thr Asn Lys 1 5 <210> 163 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 163 Lys Val Lys Arg Val Trp Gly Arg 1 5 <210> 164 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 164 Arg Ile Lys Arg Asp Tyr Cys Lys 1 5 <210> 165 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 165 Arg Ile Arg Arg Ala His Asp Arg 1 5 <210> 166 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 166 Arg Ala Arg Lys Glu Ser His Lys 1 5 <210> 167 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 167 Arg Tyr Lys Lys Gln Gln Tyr Lys 1 5 <210> 168 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 168 Lys Ile Lys Lys Leu Ser Gln Lys 1 5 <210> 169 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 169 Lys Leu Lys Arg Ala Met Leu Lys 1 5 <210> 170 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 170 Lys Ala Arg Lys Asn Ser Ile Arg 1 5 <210> 171 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 171 Lys Glu Arg Lys Leu Trp Trp Lys 1 5 <210> 172 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 172 Lys Thr Arg Lys Gln Asp His Arg 1 5 <210> 173 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 173 Arg Cys Lys Arg Phe Val Gly Lys 1 5 <210> 174 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 174 Lys Glu Lys Lys Leu Val Trp Lys 1 5 <210> 175 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 175 Lys Ala Arg Arg Asn Ser Leu Lys 1 5 <210> 176 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 176 Lys Met Arg Arg Val Ala Pro Arg 1 5 <210> 177 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 177 Arg Ala Lys Lys Ile Met Phe Arg 1 5 <210> 178 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 178 Lys Thr Lys Lys Ala Ala Glu Arg 1 5 <210> 179 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 179 Arg Gly Lys Arg His Trp His Arg 1 5 <210> 180 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 180 Arg Thr Lys Lys Glu Asn Val Lys 1 5 <210> 181 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 181 Arg Glu Lys Lys Tyr Ala Tyr Lys 1 5 <210> 182 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 182 Lys Trp Arg Arg Glu Leu Pro Arg 1 5 <210> 183 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 183 Lys Ser Arg Arg Met Trp Gly Arg 1 5 <210> 184 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 184 Lys Cys Lys Lys Asp Asn Asp Lys 1 5 <210> 185 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 185 Lys Asp Lys Lys Met Pro Gln Arg 1 5 <210> 186 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 186 Arg His Lys Arg Gln Gln Asp Lys 1 5 <210> 187 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 187 Arg Leu Lys Lys His Cys Gly Lys 1 5 <210> 188 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 188 Lys Ala Arg Lys Gln Glu Val Arg 1 5 <210> 189 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 189 Lys Met Arg Lys Phe Tyr Ser Lys 1 5 <210> 190 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 190 Lys Met Arg Arg Trp Trp Leu Lys 1 5 <210> 191 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 191 Lys Gln Lys Arg Gln Trp Ala Arg 1 5 <210> 192 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 192 Arg Ser Arg Arg Gly Ile Gly Lys 1 5 <210> 193 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 193 Lys Asp Lys Lys Thr Pro Cys Lys 1 5 <210> 194 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 194 Arg Ile Arg Lys Ile Thr Trp Arg 1 5 <210> 195 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 195 Arg His Lys Arg Trp Glu Val Arg 1 5 <210> 196 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 196 Arg Phe Arg Arg Asn Phe His Lys 1 5 <210> 197 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 197 Lys Trp Lys Arg Phe Ser Gln Arg 1 5 <210> 198 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 198 Lys Tyr Lys Lys Ser Phe Thr Lys 1 5 <210> 199 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 199 Lys Thr Arg Lys Ile Val Met Lys 1 5 <210> 200 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 200 Arg Thr Lys Lys Ala Tyr Val Lys 1 5 <210> 201 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 201 Glu Asp Tyr Lys Tyr Arg Arg Gln Asn Tyr Lys 1 5 10 <210> 202 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 202 Gly Ile Trp Lys Phe Arg Arg Asn Gln Cys Lys 1 5 10 <210> 203 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 203 Ser Pro Val Arg Trp Lys Arg Leu Cys Leu Arg 1 5 10 <210> 204 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 204 Glu Cys Tyr Arg Asn Arg Lys Ala Tyr Cys Arg 1 5 10 <210> 205 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 205 Thr Gln Gln Arg Leu Lys Arg Val Met Glu Lys 1 5 10 <210> 206 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 206 Pro Glu Leu Lys Cys Lys Arg Met Ile Gly Arg 1 5 10 <210> 207 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 207 Trp Gln Met Lys Thr Lys Lys Glu Ile Trp Lys 1 5 10 <210> 208 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 208 Phe Gly His Arg Gly Lys Lys Glu Trp Ala Arg 1 5 10 <210> 209 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 209 Ala Thr Cys Lys Pro Lys Arg Pro Trp Tyr Lys 1 5 10 <210> 210 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 210 Thr Ser Gln Lys Val Arg Lys Met Glu Ala Lys 1 5 10 <210> 211 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 211 Gly Ile Pro Lys Tyr Arg Arg Gly Cys Ser Arg 1 5 10 <210> 212 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 212 Ala Tyr Ala Lys Ala Arg Arg Trp Gly Gln Lys 1 5 10 <210> 213 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 213 Gly Gly Leu Lys Ser Lys Arg Leu Thr Thr Arg 1 5 10 <210> 214 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 214 Gly Met Trp Lys Val Arg Lys Thr Val Phe Arg 1 5 10 <210> 215 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 215 His Thr Thr Arg Gly Lys Arg Cys Asp Pro Arg 1 5 10 <210> 216 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 216 Val Asp Val Arg Asn Lys Lys Ser Asn Asn Arg 1 5 10 <210> 217 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 217 Gly Leu Asn Arg Trp Arg Arg Cys His His Lys 1 5 10 <210> 218 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 218 Leu Gln Ser Arg Ser Lys Lys Tyr Ser Val Lys 1 5 10 <210> 219 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 219 Gly Trp Asn Arg Ala Lys Arg Glu Glu Ser Lys 1 5 10 <210> 220 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 220 Ser Trp Gln Lys Cys Lys Lys Ala Glu Val Arg 1 5 10 <210> 221 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 221 Met Val Met Lys Trp Lys Arg Trp Asn Gln Arg 1 5 10 <210> 222 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 222 Met Met Met Arg His Lys Arg Cys Gln Tyr Arg 1 5 10 <210> 223 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 223 Gln Thr Tyr Arg Leu Lys Lys Pro Leu Gln Lys 1 5 10 <210> 224 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 224 Ser Phe Trp Arg Glu Arg Lys Asn Gly Phe Arg 1 5 10 <210> 225 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 225 Arg Leu Glu Arg Pro Arg Arg Glu Leu Thr Lys 1 5 10 <210> 226 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 226 Ala Pro Trp Arg Leu Lys Arg Ala Pro Gln Arg 1 5 10 <210> 227 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 227 Gln Gly Glu Lys Tyr Arg Arg Thr Glu Ser Lys 1 5 10 <210> 228 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 228 Cys Ile Trp Lys Ser Lys Arg Ser Pro Ala Lys 1 5 10 <210> 229 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 229 Ala Ile Leu Lys Gly Lys Arg Ile Pro Asn Lys 1 5 10 <210> 230 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 230 Pro Thr Leu Lys Trp Arg Lys Pro Val Leu Arg 1 5 10 <210> 231 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 231 Asn Asn Ser Arg Ser Lys Arg Phe Met Asn Arg 1 5 10 <210> 232 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 232 Leu Tyr Met Arg Cys Lys Lys Gln Ala Pro Arg 1 5 10 <210> 233 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 233 Ile Asn Tyr Arg Cys Arg Lys Trp Val Asp Lys 1 5 10 <210> 234 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 234 Val Met Asp Arg Asp Arg Lys Trp Trp Trp Arg 1 5 10 <210> 235 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 235 Asn Phe Thr Lys Leu Arg Lys Pro Gly Pro Arg 1 5 10 <210> 236 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 236 Phe Ile Pro Lys Met Arg Lys Cys Ser Pro Arg 1 5 10 <210> 237 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 237 Thr Leu Trp Lys Val Arg Lys Ala Tyr Ser Arg 1 5 10 <210> 238 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 238 Glu Ser Glu Lys Ile Lys Arg Leu Ser Thr Arg 1 5 10 <210> 239 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 239 Leu Met Thr Lys Asn Arg Arg Asn Ser Phe Arg 1 5 10 <210> 240 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 240 Pro Glu Val Lys Val Arg Arg His Ser Met Arg 1 5 10 <210> 241 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 241 Ala Glu Val Lys Asp Lys Lys Ala Tyr Tyr Lys 1 5 10 <210> 242 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 242 Tyr Tyr Ala Lys Ser Lys Lys Tyr Met Val Arg 1 5 10 <210> 243 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 243 Leu Met Asp Arg Thr Arg Arg Asp Met Tyr Lys 1 5 10 <210> 244 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 244 Asn Met Gly Arg His Lys Arg Pro Phe Leu Lys 1 5 10 <210> 245 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 245 Trp Ile Tyr Arg Gly Arg Lys Asp Val Ala Lys 1 5 10 <210> 246 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 246 Cys Tyr Trp Lys Ala Lys Arg Tyr Pro Met Arg 1 5 10 <210> 247 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 247 Ile Glu Asp Lys Gly Arg Arg Ile Asn Pro Arg 1 5 10 <210> 248 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 248 Val Ser Thr Lys Ile Lys Lys Glu Pro Gln Arg 1 5 10 <210> 249 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 249 Tyr Pro Phe Lys Ala Lys Arg Pro Ala Glu Lys 1 5 10 <210> 250 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 250 Ser Ala Asp Arg Asn Lys Arg His Met Thr Arg 1 5 10 <210> 251 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 251 Ser Leu Tyr Arg Gln Lys Arg His Asp Tyr Lys 1 5 10 <210> 252 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 252 Leu Pro Ser Arg Pro Lys Lys Pro Val Pro Lys 1 5 10 <210> 253 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 253 Pro Ala Trp Arg Cys Lys Arg Cys Gln Pro Lys 1 5 10 <210> 254 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 254 His His Trp Arg Phe Lys Arg Glu Met Pro Arg 1 5 10 <210> 255 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 255 Pro Ala Cys Arg Ser Lys Arg Asp Trp Gln Lys 1 5 10 <210> 256 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 256 Phe Ile Cys Lys Ser Arg Lys Phe Tyr Gly Lys 1 5 10 <210> 257 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 257 Leu Glu His Lys Glu Arg Lys Asp Asp Phe Arg 1 5 10 <210> 258 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 258 Ala Asn Pro Lys Asn Arg Lys Asp Asn Leu Arg 1 5 10 <210> 259 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 259 Phe Gly Val Lys Tyr Arg Arg Val Ile Cys Arg 1 5 10 <210> 260 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 260 His Ala Asp Lys Phe Arg Arg Phe Asn Met Arg 1 5 10 <210> 261 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 261 Pro Thr Ile Arg Val Arg Lys Ser Asp Asp Arg 1 5 10 <210> 262 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 262 Asn Leu His Lys Pro Lys Arg Asp Leu Pro Lys 1 5 10 <210> 263 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 263 Ile Asp Gly Lys Trp Arg Lys Ile Cys Thr Arg 1 5 10 <210> 264 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 264 Ser Pro Phe Arg Ala Lys Arg Gln Asp Val Arg 1 5 10 <210> 265 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 265 Pro Leu Trp Lys Thr Arg Lys Ile Glu Pro Arg 1 5 10 <210> 266 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 266 Pro Asn Tyr Lys Trp Arg Lys Ser Arg Arg Arg 1 5 10 <210> 267 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 267 Lys Thr Gly Arg Ser Lys Arg His Arg Trp Arg 1 5 10 <210> 268 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 268 Gly Pro Asp Lys Ser Arg Arg Asn Leu His Arg 1 5 10 <210> 269 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 269 Trp Cys Cys Lys Thr Lys Arg Ala Val Met Lys 1 5 10 <210> 270 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 270 Gln Leu Leu Lys Met Arg Lys Ala Leu Ser Arg 1 5 10 <210> 271 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 271 Pro Tyr Leu Arg Ser Lys Arg Phe Pro Pro Arg 1 5 10 <210> 272 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 272 Ala Pro His Lys Trp Arg Lys Gln Glu Gln Arg 1 5 10 <210> 273 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 273 Pro Pro Phe Lys Phe Arg Lys Pro Leu Gly Arg 1 5 10 <210> 274 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 274 Cys Ile Met Arg Val Lys Arg Met Trp Trp Lys 1 5 10 <210> 275 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 275 Tyr Ile Leu Arg Asp Lys Lys Val Pro Leu Lys 1 5 10 <210> 276 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 276 Pro Trp Val Arg Ile Arg Lys Met Ala Ser Arg 1 5 10 <210> 277 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 277 Val Ala Asp Arg Gln Lys Lys Thr Ala Pro Lys 1 5 10 <210> 278 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 278 His His Asn Arg Met Lys Lys Gln Tyr His Arg 1 5 10 <210> 279 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 279 Glu Gly Ala Lys Tyr Arg Arg Asp Gly Trp Arg 1 5 10 <210> 280 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 280 Phe Trp Asp Arg Val Lys Arg Asn Pro Ser Lys 1 5 10 <210> 281 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 281 Thr Met Trp Arg Gln Arg Lys Met Ser Cys Lys 1 5 10 <210> 282 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 282 Pro Asp Thr Arg Trp Lys Arg Val Leu Phe Lys 1 5 10 <210> 283 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 283 His Gln Gln Lys Cys Lys Lys Thr Thr Thr Lys 1 5 10 <210> 284 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 284 Pro Trp His Lys Gly Lys Arg Asp Phe Asp Arg 1 5 10 <210> 285 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 285 Val Phe Val Lys Trp Arg Arg Gln Met Met Arg 1 5 10 <210> 286 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 286 Ser Gln Trp Lys Ile Arg Lys Arg Leu Ile Arg 1 5 10 <210> 287 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 287 Glu Trp His Lys Val Arg Arg Val Tyr Ala Lys 1 5 10 <210> 288 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 288 Asn Ala Met Arg Thr Lys Arg Met Ser Phe Lys 1 5 10 <210> 289 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 289 Pro Pro Phe Lys Phe Arg Lys Pro Leu Gly Arg 1 5 10 <210> 290 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 290 Thr Ser Val Lys Lys Arg Lys Gln Arg Leu Arg 1 5 10 <210> 291 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 291 Pro Ile Asp Lys Phe Lys Arg Gly Met Val Arg 1 5 10 <210> 292 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 292 Phe Val Gly Arg Trp Lys Arg Glu Tyr Ala Lys 1 5 10 <210> 293 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 293 Phe Asn Pro Lys Met Arg Lys Val Cys Leu Arg 1 5 10 <210> 294 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 294 Asn Pro Gly Lys Thr Lys Arg Trp Leu Gln Arg 1 5 10 <210> 295 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 295 Ile Met Asp Lys Arg Arg Lys Pro Gly Cys Arg 1 5 10 <210> 296 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 296 Ile Ser Asp Lys Ala Lys Arg Gln His Phe Lys 1 5 10 <210> 297 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 297 Asp Val Asn Lys Tyr Arg Lys His Ser His Lys 1 5 10 <210> 298 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 298 Leu Met Leu Arg Gly Lys Arg Leu Thr Thr Lys 1 5 10 <210> 299 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 299 Cys Ser Leu Arg Ala Arg Lys Glu Glu Trp Arg 1 5 10 <210> 300 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 300 Met Asn Tyr Arg Cys Lys Arg Val Gln Glu Arg 1 5 10 <210> 301 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 301 Asn Gly Val Arg Glu Arg Lys Trp Gln Ser Lys 1 5 10 <210> 302 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 302 Tyr Thr Ser Arg Cys Lys Lys Gln Pro Arg Lys 1 5 10 <210> 303 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 303 Gln Tyr Asn Lys Gly Arg Lys Ile His Val Arg 1 5 10 <210> 304 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 304 Pro Glu Asp Arg Gln Arg Lys Thr Trp Phe Lys 1 5 10 <210> 305 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 305 Ile Glu Met Lys Pro Arg Lys Phe Gly Val Lys 1 5 10 <210> 306 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 306 Gln Arg Trp Lys Trp Arg Lys Ser Leu Ala Arg 1 5 10 <210> 307 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 307 Val Lys His Lys Glu Arg Lys Cys Gln Arg Arg 1 5 10 <210> 308 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 308 Gln Gln Asp Arg Pro Lys Arg Asp Ile Pro Lys 1 5 10 <210> 309 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 309 Tyr Pro Thr Lys Gly Lys Arg Cys Met Ile Arg 1 5 10 <210> 310 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 310 Arg Tyr Ala Lys His Arg Lys Arg Gln Thr Arg 1 5 10 <210> 311 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 311 Gly Tyr Phe Arg Pro Arg Lys Glu Thr Cys Lys 1 5 10 <210> 312 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 312 Cys Phe Phe Lys Met Arg Arg Cys Asn Thr Lys 1 5 10 <210> 313 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 313 Gln Asn Asp Lys Asp Arg Lys Leu Ser His Arg 1 5 10 <210> 314 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 314 Gln Val Thr Lys Ser Lys Arg Val Ala Phe Lys 1 5 10 <210> 315 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 315 Val Arg Ala Lys His Arg Lys Ser Ser Leu Arg 1 5 10 <210> 316 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 316 Ser His Ser Arg Gln Arg Lys Thr Pro Leu Arg 1 5 10 <210> 317 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 317 Asp Asn Gly Lys Ile Arg Arg Cys Leu Gly Lys 1 5 10 <210> 318 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 318 Phe Leu Arg Arg Leu Lys Lys Val His Trp Lys 1 5 10 <210> 319 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 319 Phe Cys Arg Arg Ser Lys Lys Ile Gly Arg Arg 1 5 10 <210> 320 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 320 Pro Ala Ala Arg Thr Lys Arg Met Tyr Gly Arg 1 5 10 <210> 321 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 321 His Glu Thr Lys Pro Lys Lys Asp Gly Leu Arg 1 5 10 <210> 322 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 322 Met Gly Asp Arg Pro Arg Lys Trp Asp Ser Arg 1 5 10 <210> 323 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 323 His Asp Thr Lys Cys Lys Lys Met Tyr Ala Lys 1 5 10 <210> 324 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 324 Asn Val Val Arg Gly Arg Arg Leu Glu Cys Arg 1 5 10 <210> 325 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 325 Pro Ala Asp Lys Gly Arg Arg Glu Val Met Lys 1 5 10 <210> 326 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 326 Ala Met Met Lys Tyr Lys Lys Glu Phe Pro Lys 1 5 10 <210> 327 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 327 Tyr Ile Ile Arg Trp Lys Arg Gln Met Thr Arg 1 5 10 <210> 328 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 328 Ser Pro Trp Arg Ile Arg Arg Gln Asn Ile Arg 1 5 10 <210> 329 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 329 Thr Cys Ile Lys Tyr Arg Arg Ala His Thr Lys 1 5 10 <210> 330 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 330 Gly Tyr Asp Arg Ala Arg Lys Gly Thr Leu Arg 1 5 10 <210> 331 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 331 Met Thr Leu Lys His Arg Arg Val Tyr Ile Lys 1 5 10 <210> 332 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 332 Leu Phe Thr Arg Ile Lys Arg Leu Val Cys Lys 1 5 10 <210> 333 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 333 Asp Phe Ser Arg Asp Arg Arg Cys Leu Ser Lys 1 5 10 <210> 334 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 334 Val Trp Asn Lys Val Lys Arg Trp Leu Glu Arg 1 5 10 <210> 335 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 335 Phe Pro Gly Lys Asn Arg Lys Tyr Cys Ser Arg 1 5 10 <210> 336 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 336 Tyr Thr Ser Lys Asn Lys Arg Gly Cys Pro Arg 1 5 10 <210> 337 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 337 Cys Ala Cys Lys Gln Arg Arg Ala Thr Ser Arg 1 5 10 <210> 338 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 338 Ile Met Glu Arg Gln Arg Lys Ser Gln His Arg 1 5 10 <210> 339 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 339 Ser Val Leu Arg Cys Arg Lys Cys Ser Met Lys 1 5 10 <210> 340 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 340 Tyr Pro Gln Lys Leu Arg Arg Thr Ala Leu Lys 1 5 10 <210> 341 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 341 Ser Ser His Lys Gly Lys Arg Ala Gln Ser Lys 1 5 10 <210> 342 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 342 Asp Asn Pro Arg Phe Arg Lys Thr Ile Leu Lys 1 5 10 <210> 343 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 343 Ala Ile Ile Lys Phe Arg Lys Val Gln Trp Lys 1 5 10 <210> 344 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 344 Pro Tyr Thr Arg Cys Arg Lys Glu Ile Cys Lys 1 5 10 <210> 345 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 345 Met Asn Glu Lys Pro Lys Lys Asn Asp Gln Lys 1 5 10 <210> 346 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 346 Leu Ile Gly Lys Phe Lys Lys Pro Phe Tyr Arg 1 5 10 <210> 347 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 347 Thr Trp Cys Lys His Lys Lys Leu Asp Met Lys 1 5 10 <210> 348 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 348 Asp Ser Asn Lys Val Arg Lys Cys Ser Ser Lys 1 5 10 <210> 349 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 349 Leu Pro Met Lys Gln Arg Lys Cys Glu Phe Arg 1 5 10 <210> 350 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 350 Glu Asp Val Arg Val Lys Arg Gln Thr Cys Arg 1 5 10 <210> 351 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 351 Thr Gln Cys Lys Asp Arg Arg Val Ser Asp Arg 1 5 10 <210> 352 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 352 Ile Ala Leu Lys Pro Lys Arg Val Trp Leu Lys 1 5 10 <210> 353 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 353 Gly His Gln Arg Gly Lys Arg Glu Gly Ser Arg 1 5 10 <210> 354 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 354 Asn Pro Phe Lys Tyr Lys Lys Ile Cys Pro Lys 1 5 10 <210> 355 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 355 Asn Glu Ala Arg Ile Lys Lys Cys Asp Val Lys 1 5 10 <210> 356 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 356 Tyr Gly Leu Arg Met Arg Lys Trp Tyr Met Lys 1 5 10 <210> 357 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 357 Asn Phe Tyr Lys Cys Arg Lys Leu Gln Cys Lys 1 5 10 <210> 358 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 358 Met Met Thr Lys Tyr Lys Lys Thr Cys Cys Lys 1 5 10 <210> 359 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 359 Cys Asn Gln Lys Thr Lys Lys Ile Ala Glu Lys 1 5 10 <210> 360 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 360 Ala Asp Ile Arg Met Lys Lys Trp Tyr Pro Lys 1 5 10 <210> 361 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 361 Ala Trp Phe Arg Val Lys Arg Ser Asn Cys Arg 1 5 10 <210> 362 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 362 Asn Cys Asp Arg Thr Arg Lys His Trp Ala Arg 1 5 10 <210> 363 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 363 Pro His Ala Arg Thr Arg Lys Asn Ile Thr Lys 1 5 10 <210> 364 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 364 Val Pro Thr Lys Met Lys Lys Tyr Glu Thr Lys 1 5 10 <210> 365 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 365 Ala Tyr Pro Lys Phe Arg Lys Thr Phe Asn Arg 1 5 10 <210> 366 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 366 Gln Gln Leu Arg Leu Arg Lys Leu Cys Gly Lys 1 5 10 <210> 367 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 367 Met Phe Met Arg Asn Lys Lys Leu Ala Trp Arg 1 5 10 <210> 368 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 368 Gly Gly Ala Lys Asn Lys Lys Val Val Ser Arg 1 5 10 <210> 369 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 369 His Asp Pro Arg His Lys Lys Thr Pro Thr Lys 1 5 10 <210> 370 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 370 Gln Val His Arg Asn Lys Arg Tyr Thr Asp Arg 1 5 10 <210> 371 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 371 Tyr Gly Thr Arg Pro Lys Lys Tyr Val Ser Lys 1 5 10 <210> 372 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 372 Cys Thr Trp Arg Gly Arg Arg Pro His Asp Lys 1 5 10 <210> 373 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 373 Ser Trp Ala Lys Ala Arg Lys Leu Val His Arg 1 5 10 <210> 374 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 374 Pro Leu Phe Lys Ser Arg Arg Ala Tyr Val Arg 1 5 10 <210> 375 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 375 Cys Val Met Arg Cys Arg Arg Ser Glu Asp Lys 1 5 10 <210> 376 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 376 Trp Trp His Lys His Arg Arg Ala Gln Ser Lys 1 5 10 <210> 377 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 377 Leu Asn Ser Lys Pro Arg Arg Val Glu Phe Lys 1 5 10 <210> 378 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 378 Val Pro Tyr Arg His Arg Arg Met Gln Phe Lys 1 5 10 <210> 379 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 379 Gly Ile Ala Lys Ser Lys Arg Asn Ala Gly Arg 1 5 10 <210> 380 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 380 Asp Pro Glu Lys Trp Arg Lys Phe Tyr Asp Arg 1 5 10 <210> 381 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 381 Pro Gly Ala Arg Cys Arg Lys Gln Asp Val Lys 1 5 10 <210> 382 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 382 His Glu Gln Arg Pro Lys Lys Gly Gln Gln Lys 1 5 10 <210> 383 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 383 Thr Cys Asp Arg Ala Arg Lys Glu Ser Phe Arg 1 5 10 <210> 384 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 384 Met His Gln Arg Glu Arg Arg Asn Phe Val Lys 1 5 10 <210> 385 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 385 Phe Ile Thr Arg Phe Arg Lys Met Gly Glu Lys 1 5 10 <210> 386 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 386 Pro Asn Trp Lys Val Arg Arg Phe Gly Asp Lys 1 5 10 <210> 387 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 387 Thr Ala Ala Lys Trp Lys Lys Ile Ile Met Lys 1 5 10 <210> 388 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 388 Cys Leu Trp Arg Leu Arg Lys Asp Asn Gly Arg 1 5 10 <210> 389 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 389 Ala His Ile Lys Ser Arg Lys Val Trp Ser Arg 1 5 10 <210> 390 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 390 Asn Leu Val Lys Ser Lys Lys Val Glu Glu Lys 1 5 10 <210> 391 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 391 Pro Asp Ser Arg Leu Lys Lys His Glu Ala Lys 1 5 10 <210> 392 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 392 Glu His Val Lys Leu Lys Arg Leu Asp Phe Arg 1 5 10 <210> 393 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 393 Pro Ala Leu Arg Met Arg Arg Trp Cys Gln Lys 1 5 10 <210> 394 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 394 His Leu Glu Lys His Arg Arg Cys Glu Phe Lys 1 5 10 <210> 395 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 395 Cys Gln Ala Lys Thr Arg Lys Ala Glu Asp Arg 1 5 10 <210> 396 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 396 Gln Asn Met Arg Met Lys Arg Phe Ile Gln Arg 1 5 10 <210> 397 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 397 Cys Pro Tyr Arg Ile Arg Arg Gly Pro Gly Lys 1 5 10 <210> 398 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 398 Asp Ile Tyr Lys Gly Lys Arg Thr Leu Val Lys 1 5 10 <210> 399 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 399 Glu Ile Cys Lys Asn Arg Lys Pro Ala Asn Arg 1 5 10 <210> 400 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 400 Gln Gly Met Lys Leu Lys Arg Ile Trp Ser Lys 1 5 10 <210> 401 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 401 Ala Leu Gly Arg Thr Lys Arg Leu His Met Arg Val His Val 1 5 10 <210> 402 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 402 Ser Phe Tyr Lys Glu Arg Lys Cys Gln Phe Arg Ser Gly Leu 1 5 10 <210> 403 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 403 Ser Gly Val Arg Tyr Arg Lys Trp Trp Ile Arg Ser Val Val 1 5 10 <210> 404 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 404 Met Pro Gln Lys Leu Lys Lys Leu Asp Ile Arg Asn His Asn 1 5 10 <210> 405 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 405 Asn Glu Asp Arg Gly Lys Arg Pro His Ile Arg Val Leu Gly 1 5 10 <210> 406 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 406 Glu Phe Val Lys Leu Arg Lys Ala Arg Leu Arg Gly Pro Gln 1 5 10 <210> 407 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 407 Glu Gly Asp Lys Phe Arg Arg His Asp Ile Lys Tyr Asn Phe 1 5 10 <210> 408 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 408 Pro Ile Cys Arg Trp Lys Arg Ala Pro Phe Lys Trp Tyr Phe 1 5 10 <210> 409 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 409 Asn Cys Asn Arg Phe Arg Arg Thr Ile Val Arg His Cys His 1 5 10 <210> 410 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 410 Ala His Gly Lys Asp Arg Arg Tyr Val Glu Lys Leu Glu Val 1 5 10 <210> 411 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 411 Phe Met Gln Lys Cys Lys Lys Trp Trp Asp Arg Ala Val Phe 1 5 10 <210> 412 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 412 Asp Pro Pro Lys Lys Arg Lys Ser Leu Leu Arg Arg Val Ser 1 5 10 <210> 413 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 413 Tyr Cys Thr Arg Ile Arg Arg Glu Gly Met Lys Gly Ser Glu 1 5 10 <210> 414 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 414 Phe Pro Gly Lys Ser Lys Lys Gln Trp His Arg Leu Trp Pro 1 5 10 <210> 415 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 415 Tyr Glu Pro Arg Phe Lys Arg Pro Tyr Gly Lys Trp Cys His 1 5 10 <210> 416 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 416 Asp Tyr Leu Arg Ser Arg Lys Met Glu Glu Arg Phe Gln Glu 1 5 10 <210> 417 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 417 Val Gly Pro Lys Phe Arg Lys Asn His Arg Arg Gln Asn Arg 1 5 10 <210> 418 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 418 Glu Tyr Gln Lys Cys Lys Lys Pro Ser Phe Arg Leu Thr Met 1 5 10 <210> 419 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 419 Tyr Met Lys Lys Lys Arg Lys Ser Leu Leu Arg Thr Ser Leu 1 5 10 <210> 420 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 420 Cys Cys Phe Lys Leu Lys Lys Ala Tyr Asn Lys Gly Pro Phe 1 5 10 <210> 421 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 421 Asn Pro Met Lys Leu Arg Lys Ala Glu Thr Lys His Asn Val 1 5 10 <210> 422 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 422 His Ser Leu Lys Thr Arg Lys Ser Ala Phe Lys Ser Asn Thr 1 5 10 <210> 423 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 423 Gln Tyr His Lys Val Arg Lys Leu Trp Phe Arg Val Glu Pro 1 5 10 <210> 424 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 424 Phe Val Arg Lys Lys Arg Lys Ser Leu Leu Arg Asp Thr Arg 1 5 10 <210> 425 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 425 Cys Phe Gln Arg Lys Arg Lys Ser Leu Leu Arg Val Leu Arg 1 5 10 <210> 426 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 426 Val Pro Met Lys Tyr Arg Arg Cys Gly Asn Arg Gln Ser Asn 1 5 10 <210> 427 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 427 Arg Ala Arg Lys Lys Arg Lys Ser Leu Leu Arg Arg Gln Val 1 5 10 <210> 428 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 428 Pro Asn Gly Lys Val Arg Lys Arg Ile Arg Arg Arg Tyr Phe 1 5 10 <210> 429 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 429 Cys Ala Ser Lys Pro Arg Arg Thr Tyr Leu Arg Ala Ala Asn 1 5 10 <210> 430 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 430 Trp Ala His Lys Cys Lys Lys Pro Gly Gln Arg Ile Pro Pro 1 5 10 <210> 431 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 431 Leu Ser Asp Lys Lys Arg Lys Ser Leu Leu Arg Tyr Asp Tyr 1 5 10 <210> 432 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 432 Cys Ala Thr Arg Gly Lys Lys Val Phe Ser Lys Arg Thr Met 1 5 10 <210> 433 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 433 Leu Arg Gln Arg Ser Lys Arg Val Leu Glu Lys Leu Arg Pro 1 5 10 <210> 434 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 434 Leu Gly Trp Lys Lys Arg Lys Ser Leu Leu Arg Arg His Val 1 5 10 <210> 435 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 435 Leu Gln Cys Lys Tyr Arg Arg Gly Ser Asp Lys Gln Pro Gln 1 5 10 <210> 436 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 436 Ala Phe Ser Arg Ile Lys Arg Gly Val Leu Lys Leu Leu Ser 1 5 10 <210> 437 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 437 Ser Asn Val Lys Arg Lys Arg Gly Arg Cys Lys Pro Tyr Arg 1 5 10 <210> 438 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 438 Thr Val Val Lys Ser Arg Lys Cys Ser Val Arg Tyr Asn Trp 1 5 10 <210> 439 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 439 Asp Asp Val Lys Gln Arg Lys Lys His Pro Arg Val Gln Thr 1 5 10 <210> 440 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 440 Ala Ser Pro Lys Gly Arg Arg Pro Thr Phe Arg Pro Gln His 1 5 10 <210> 441 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 441 Gly Trp Leu Lys Ala Lys Arg Phe Pro Ser Arg Pro Pro Thr 1 5 10 <210> 442 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 442 Glu Thr Asn Arg Thr Arg Lys Gln Cys Tyr Lys Thr Thr Phe 1 5 10 <210> 443 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 443 Phe Thr His Lys Asn Arg Arg Asp Ser Leu Arg Val Trp Met 1 5 10 <210> 444 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 444 Pro Pro Phe Arg Leu Arg Lys Pro Leu Trp Arg Pro Gln Arg 1 5 10 <210> 445 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 445 Pro Gly Asn Arg Met Lys Lys Tyr Gln Asn Arg Val His Gly 1 5 10 <210> 446 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 446 Ser Ala His Lys Lys Arg Lys Gln Thr Leu Arg Cys Ser Glu 1 5 10 <210> 447 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 447 Leu Tyr Glu Lys Tyr Lys Lys His Asn Asn Arg Glu Asp Asp 1 5 10 <210> 448 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 448 Pro His Cys Arg Gln Lys Lys Phe Trp Ile Arg Cys Gly Thr 1 5 10 <210> 449 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 449 Val Ala Phe Lys Thr Arg Arg Arg Val Gln Arg Gln Ser Gly 1 5 10 <210> 450 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 450 Val Phe Asp Lys Phe Arg Lys Thr Glu Asn Arg Gly Val Ile 1 5 10 <210> 451 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 451 Asn His His Lys Thr Lys Arg Cys Ser Val Arg Phe Asn Ile 1 5 10 <210> 452 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 452 Gly Thr Phe Lys Trp Arg Lys Ser Gly Ala Arg Gln Tyr Leu 1 5 10 <210> 453 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 453 His Cys Leu Arg Thr Lys Lys Leu Ile Asn Lys Ile Cys Ser 1 5 10 <210> 454 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 454 Phe Phe Leu Arg Cys Arg Arg Leu Leu Gly Lys Val Gln Val 1 5 10 <210> 455 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 455 His Phe Pro Arg Ala Arg Arg Phe Glu His Arg Cys Met Leu 1 5 10 <210> 456 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 456 Gln Ile Ser Lys Leu Lys Arg Pro Ser Tyr Arg Gly Asp Asp 1 5 10 <210> 457 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 457 Glu Glu Ile Lys Gln Lys Lys Leu His Leu Arg Val Trp Phe 1 5 10 <210> 458 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 458 Ser Leu Pro Lys Trp Arg Lys Gly Gly Asp Arg Val Phe Thr 1 5 10 <210> 459 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 459 His Val Tyr Lys Asn Arg Arg Val Trp Gly Lys Gly Trp Pro 1 5 10 <210> 460 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 460 Glu Asp Leu Arg Cys Lys Lys Leu Glu Leu Arg Ser Val Ile 1 5 10 <210> 461 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 461 Thr His Asp Lys Cys Lys Lys His Asn Asp Lys Gln Ala His 1 5 10 <210> 462 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 462 Tyr Pro Glu Arg Pro Arg Lys Leu Gln Asp Lys Ser Tyr Ser 1 5 10 <210> 463 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 463 Cys Pro Trp Arg Asn Arg Lys Ala Met Ile Lys Gly Ile Ile 1 5 10 <210> 464 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 464 His Glu Ile Lys Gln Lys Lys Tyr Phe His Arg Gly His Asp 1 5 10 <210> 465 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 465 Cys Leu Glu Lys Leu Arg Lys Ala Val His Arg Gln Arg Arg 1 5 10 <210> 466 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 466 Tyr Ile Ser Lys Ser Lys Lys Thr Ala Gly Arg Trp Phe Trp 1 5 10 <210> 467 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 467 Val Thr Trp Lys Phe Arg Lys Ala Glu Lys Arg Trp Gly Tyr 1 5 10 <210> 468 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 468 Tyr Ser Ser Lys Ser Arg Lys Leu Ser Pro Arg Thr Pro Arg 1 5 10 <210> 469 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 469 Cys Val Asn Arg Val Lys Lys Ser Asp Ser Lys Gly Thr Trp 1 5 10 <210> 470 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 470 Asp His Glu Arg Glu Arg Arg Leu Trp Ser Arg Phe Pro Phe 1 5 10 <210> 471 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 471 Pro Leu Ile Lys Val Lys Arg Gly Val Gly Lys Leu Trp Asn 1 5 10 <210> 472 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 472 Thr Gly Cys Arg Cys Lys Arg Ser Met Tyr Lys Asn Leu His 1 5 10 <210> 473 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 473 Trp Thr Cys Arg Met Arg Lys Tyr Gln Leu Arg Thr Ser Glu 1 5 10 <210> 474 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 474 Ile Ala Ile Arg Pro Arg Lys Met Thr Leu Lys Ile His Pro 1 5 10 <210> 475 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 475 Gln Ile Pro Lys Gln Lys Lys Gln Glu Gln Arg Ala Ile Ser 1 5 10 <210> 476 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 476 Gln Met Gly Lys Phe Lys Lys Ile Ser Leu Lys Asn Thr Phe 1 5 10 <210> 477 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 477 Val Leu Ile Lys Gln Arg Lys Trp Gln Asp Arg Ser Cys Ser 1 5 10 <210> 478 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 478 Phe Ile Thr Lys Ser Arg Arg Gln Gln Phe Arg Asn Gln Gly 1 5 10 <210> 479 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 479 Gln Gln Phe Lys Tyr Arg Arg Glu Cys Val Lys Tyr Gly Ser 1 5 10 <210> 480 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 480 Met Glu Gly Arg Glu Lys Lys Ser Tyr Asn Lys Gly Glu Asn 1 5 10 <210> 481 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 481 Pro Thr Trp Arg His Arg Arg Tyr Cys Ala Lys Asp Ile Gly 1 5 10 <210> 482 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 482 His Met Cys Arg Ser Lys Arg Val Ala Trp Lys Asn Leu Ile 1 5 10 <210> 483 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 483 Ser Tyr Leu Lys Cys Lys Arg Ser Asp Tyr Lys Glu Val Pro 1 5 10 <210> 484 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 484 His Thr Phe Lys Leu Arg Lys Leu Cys Gln Lys Leu Phe Glu 1 5 10 <210> 485 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 485 Gln Leu Val Lys Leu Arg Lys Leu Ala Arg Arg Val Ser Tyr 1 5 10 <210> 486 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 486 Ser Glu Val Arg Pro Lys Lys Asp His Ser Arg Leu Phe Ile 1 5 10 <210> 487 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 487 Phe Leu Glu Lys Cys Arg Lys Phe Ile Ile Arg Val Ser Thr 1 5 10 <210> 488 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 488 Pro Glu Thr Arg His Arg Lys Met Phe Ile Arg Asp Phe Trp 1 5 10 <210> 489 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 489 Glu Trp Cys Lys Asn Lys Arg Trp His Ser Arg Glu Tyr Pro 1 5 10 <210> 490 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 490 Leu Trp Asn Arg Tyr Lys Lys Leu Leu Met Arg Ile Phe Trp 1 5 10 <210> 491 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 491 Cys Trp Cys Arg Gln Arg Lys Cys Phe His Lys Pro Trp Ile 1 5 10 <210> 492 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 492 Asn Leu Glu Arg Thr Lys Lys His Gly Leu Lys Gly Tyr Met 1 5 10 <210> 493 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 493 Glu Gly Gly Arg Ile Lys Arg Pro Asn Tyr Arg Gly Asp Gly 1 5 10 <210> 494 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 494 Pro Val Leu Lys Leu Arg Lys Gly Arg Val Arg Ala Gln Pro 1 5 10 <210> 495 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 495 Ser Ile Ser Arg Leu Arg Lys Ala His Gln Lys Phe Ile Pro 1 5 10 <210> 496 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 496 Glu Trp His Lys His Arg Arg Glu Met Val Arg Trp Gly Pro 1 5 10 <210> 497 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 497 Trp Ser Ala Lys Gly Arg Arg Met Gly Cys Lys Ser Thr Met 1 5 10 <210> 498 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 498 Pro Asn Gly Lys Val Arg Lys Arg Ile Arg Arg Arg Tyr Phe 1 5 10 <210> 499 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 499 Pro Cys Trp Lys Phe Arg Arg Ala Gln Met Lys Trp Gly Ile 1 5 10 <210> 500 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 500 Leu Glu Glu Arg Pro Lys Lys His Cys Ala Lys Asn His Cys 1 5 10 <210> 501 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 501 Gln Pro Trp Arg Gln Lys Lys Phe Trp Cys Arg Cys Trp Gly 1 5 10 <210> 502 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 502 Ile Met Val Lys Ile Arg Arg Cys Pro Ala Arg Pro Leu Cys 1 5 10 <210> 503 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 503 Asn Asp Trp Lys Leu Arg Lys Asp Phe Trp Arg Asn His Phe 1 5 10 <210> 504 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 504 Ala Ser Val Arg Asp Arg Lys Met Gly Tyr Lys Ser Asp Gly 1 5 10 <210> 505 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 505 Tyr Tyr Glu Lys Ile Arg Arg Gly Glu Ile Lys Ile Ala Glu 1 5 10 <210> 506 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 506 Asp Leu Val Arg Lys Arg Lys Thr Met Leu Arg Gln Leu Val 1 5 10 <210> 507 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 507 Asp Leu Ser Lys Val Arg Arg Gly His Gly Lys Asn Asp Ile 1 5 10 <210> 508 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 508 Glu Ser Tyr Arg Leu Arg Arg Gly Thr Asp Lys Glu Gln Trp 1 5 10 <210> 509 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 509 Tyr Ile Thr Lys Phe Arg Lys Phe Leu Met Lys Asp Gln Phe 1 5 10 <210> 510 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 510 Ala Trp Ala Lys Tyr Lys Lys Val Gln Pro Lys His His Thr 1 5 10 <210> 511 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 511 Thr Trp Leu Arg Gly Arg Arg Trp Pro Asp Lys Gln Pro Gln 1 5 10 <210> 512 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 512 Ala Leu Pro Arg Val Arg Lys Asp Ser His Arg Glu Glu Ile 1 5 10 <210> 513 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 513 Cys Leu Phe Lys Tyr Arg Lys Ser Cys Val Arg Leu Cys Gly 1 5 10 <210> 514 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 514 Leu Gln Asn Arg Met Arg Lys Ile Tyr Trp Lys Thr Phe Asp 1 5 10 <210> 515 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 515 Asn Asp Pro Arg Leu Arg Lys His Asn His Arg Cys Cys Thr 1 5 10 <210> 516 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 516 Tyr Gly Ser Lys Gln Arg Arg Phe Glu Glu Lys Ile Cys Gly 1 5 10 <210> 517 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 517 Cys Gly His Lys Asn Lys Lys Trp His Asn Arg Met Asp Pro 1 5 10 <210> 518 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 518 Tyr Gly Ile Arg Asp Arg Arg Pro Met Thr Lys His Thr Gln 1 5 10 <210> 519 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 519 Thr Pro Leu Lys Ser Arg Lys Tyr Trp Asn Lys His Ala Tyr 1 5 10 <210> 520 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 520 Phe Leu Tyr Lys Ala Lys Lys Ala Leu Met Arg Asp Ser Leu 1 5 10 <210> 521 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 521 Cys Asp Asp Lys Pro Lys Lys Thr Val Val Lys Leu Thr Trp 1 5 10 <210> 522 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 522 Met His Pro Arg Pro Arg Lys Met Ser His Lys Met Ser Cys 1 5 10 <210> 523 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 523 Pro Gly Glu Arg Leu Lys Lys Glu Asp His Arg Ala Ser Gly 1 5 10 <210> 524 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 524 Gly Ala Gln Arg Ala Arg Lys Pro Val Leu Arg Ala Val Gly 1 5 10 <210> 525 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 525 Met Gln Glu Lys Cys Arg Arg Cys Val Phe Lys Gly Asn Ile 1 5 10 <210> 526 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 526 Tyr Val Asp Arg Trp Arg Arg Met Gln Tyr Lys Leu Ser Ile 1 5 10 <210> 527 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 527 Trp Val Asp Arg Ser Arg Lys Phe Glu Asp Arg Asn Cys Leu 1 5 10 <210> 528 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 528 Ile Val Asn Arg Ala Lys Arg Ser Gln Ile Arg Phe Asp Val 1 5 10 <210> 529 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 529 Ile His Pro Arg Tyr Lys Arg His Gln Ala Arg Ser Cys Cys 1 5 10 <210> 530 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 530 Glu His Ser Lys His Arg Lys Asp Leu Phe Arg Met Val Gly 1 5 10 <210> 531 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 531 Tyr Thr Pro Lys Phe Arg Arg Ile Phe Trp Arg Ile Ile Asp 1 5 10 <210> 532 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 532 Thr Ile Thr Arg Val Lys Arg Ala Ser His Lys Thr Pro Ser 1 5 10 <210> 533 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 533 Val Asp Ser Arg Glu Lys Lys Trp Arg Gln Lys Cys Gln Cys 1 5 10 <210> 534 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 534 Tyr Trp Phe Arg Ile Lys Arg Ala His Ala Lys Gly Cys Pro 1 5 10 <210> 535 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 535 Asn Asp His Arg Met Arg Arg Ser Val Asp Arg Gly Glu Thr 1 5 10 <210> 536 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 536 Pro Phe Asp Arg Ala Arg Arg Asp Leu His Arg Ile Met Met 1 5 10 <210> 537 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 537 Gln Val Val Arg Leu Arg Arg Gly Lys Asn Arg Gly Thr Val 1 5 10 <210> 538 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 538 Thr Asn Gln Arg Pro Arg Arg Glu Thr Ala Lys Thr Ile Glu 1 5 10 <210> 539 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 539 Phe His His Arg His Lys Arg Ile Ala Thr Lys His Pro Ala 1 5 10 <210> 540 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 540 Glu His Cys Lys Trp Lys Lys Met Phe Asp Lys Glu Gly Glu 1 5 10 <210> 541 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 541 Phe Phe Tyr Arg Leu Arg Arg Cys Leu Thr Arg Trp Trp Val 1 5 10 <210> 542 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 542 Leu Gln Cys Lys Tyr Arg Arg Gly Ser Asp Lys Thr Val Val 1 5 10 <210> 543 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 543 Gln Thr Met Lys Phe Lys Arg Cys Cys Asn Lys Glu Met Val 1 5 10 <210> 544 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 544 Cys Ser Tyr Lys Leu Arg Arg Cys Asp Met Arg Leu Trp Gly 1 5 10 <210> 545 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 545 Met His Ile Lys Met Lys Arg Glu Gln Val Lys Asp Glu Glu 1 5 10 <210> 546 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 546 Ala Val Trp Arg Asn Arg Lys Asp Asn Val Lys Ala Ser Glu 1 5 10 <210> 547 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 547 Ala Asp His Arg Ala Lys Lys Thr Leu Ser Lys Phe Trp Thr 1 5 10 <210> 548 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 548 Met Met Ala Arg Cys Arg Arg Ile Met Cys Arg Ser Phe Asn 1 5 10 <210> 549 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 549 Pro Phe Gly Lys Phe Lys Arg Leu Glu Asn Lys Asp Glu Cys 1 5 10 <210> 550 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 550 Tyr Leu Ser Arg Thr Lys Arg Trp Leu Ala Arg Tyr Val Glu 1 5 10 <210> 551 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 551 His Thr Leu Lys Pro Lys Arg Leu Tyr Pro Arg Pro Ser Glu 1 5 10 <210> 552 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 552 Val Val Ile Lys Cys Arg Lys Trp Thr His Lys Met Asp His 1 5 10 <210> 553 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 553 Phe His Thr Lys Leu Arg Lys Pro Ile Pro Lys Ile Asp Met 1 5 10 <210> 554 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 554 Glu Asn Ile Lys Ser Arg Lys Tyr Phe Val Lys Leu Thr Trp 1 5 10 <210> 555 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 555 Ala Trp Thr Arg Phe Arg Arg Phe Gln Cys Lys Gly Met Ser 1 5 10 <210> 556 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 556 Ile Val Pro Arg Asp Arg Lys Gln Ala Leu Arg Trp Thr Asn 1 5 10 <210> 557 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 557 Cys Met Leu Arg Trp Lys Arg Trp His Met Arg Phe Asn Pro 1 5 10 <210> 558 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 558 Phe Asp Met Arg Asp Arg Arg Pro Asn Ala Arg Val Met Pro 1 5 10 <210> 559 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 559 Gln Ile Ala Lys Leu Lys Arg Asp Gln Met Lys Glu Ala Trp 1 5 10 <210> 560 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 560 Leu Thr Ser Arg Cys Lys Lys Thr Phe Gln Lys Asn Ser Glu 1 5 10 <210> 561 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 561 Met Ala Ala Lys Trp Lys Lys Asp Gly Met Lys Ser His Tyr 1 5 10 <210> 562 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 562 Ala Asn Trp Arg Thr Arg Arg Asp Leu Ala Lys Glu His Val 1 5 10 <210> 563 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 563 Pro Phe Thr Lys Met Arg Lys Gln Phe Gln Arg Met Ser Ala 1 5 10 <210> 564 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 564 Gln Ile Asn Arg Val Lys Lys Ser Asp Ala Lys Phe Cys Thr 1 5 10 <210> 565 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 565 Tyr Leu Val Lys Leu Arg Arg Phe Trp Ala Lys Ile Asp Met 1 5 10 <210> 566 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 566 Glu Tyr Val Lys Ala Lys Arg Thr Pro Trp Lys Tyr Val Val 1 5 10 <210> 567 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 567 Ala Met Cys Arg Glu Lys Arg Phe Pro Tyr Arg Ala Ile Tyr 1 5 10 <210> 568 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 568 Met Gly Leu Arg Ala Arg Lys Tyr Glu Asp Lys Thr Leu His 1 5 10 <210> 569 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 569 Phe His Met Lys Ser Lys Lys Asp Gly Asp Lys Phe Val Met 1 5 10 <210> 570 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 570 Cys Ile Phe Lys Phe Lys Lys Asn Met Phe Lys Gly Tyr Ser 1 5 10 <210> 571 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 571 Leu Asp Thr Lys Asn Arg Arg Gly Ala Ser Lys Trp Asp Tyr 1 5 10 <210> 572 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 572 Val Thr Gly Lys Gly Arg Arg Val Thr Phe Arg Cys Met Asn 1 5 10 <210> 573 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 573 Gln Leu Gly Lys Gln Lys Arg Glu Ala Thr Arg Glu Tyr Val 1 5 10 <210> 574 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 574 Ser Ser Gly Lys Trp Lys Arg Pro His Ala Lys Tyr Ile Val 1 5 10 <210> 575 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 575 Thr Cys His Lys Thr Lys Arg Ser Ile Met Arg Ala Thr Ser 1 5 10 <210> 576 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 576 Met Ile Gly Lys Cys Arg Lys Cys Gly Thr Lys Cys Tyr Ala 1 5 10 <210> 577 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 577 Phe Gln Pro Lys Ser Arg Arg Ala Glu Thr Lys His Ser Tyr 1 5 10 <210> 578 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 578 Pro Asp Leu Lys Phe Arg Lys His Gln Asp Arg Thr Ala Ile 1 5 10 <210> 579 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 579 Tyr Asn Ala Arg Val Lys Arg Glu Gly Ile Lys Asn Ile Thr 1 5 10 <210> 580 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 580 Gln Gly Ile Arg Pro Arg Lys His Leu Gln Arg Met Pro Asn 1 5 10 <210> 581 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 581 Gly Pro Cys Arg Pro Arg Arg His Ser Ile Arg Leu Leu Trp 1 5 10 <210> 582 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 582 Phe Tyr Leu Arg Glu Arg Arg His Gln Leu Lys Thr Glu Phe 1 5 10 <210> 583 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 583 Asn Met Ala Arg Ser Arg Lys Asn Glu Cys Lys Tyr Ile Ala 1 5 10 <210> 584 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 584 Asp Met Asp Lys Val Lys Lys Trp Val Trp Arg Ser Phe Pro 1 5 10 <210> 585 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 585 Val Leu Pro Lys Glu Arg Arg Trp Leu Thr Arg Phe Leu Ile 1 5 10 <210> 586 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 586 Tyr Glu His Arg His Lys Arg Phe Phe His Lys Asp Met Pro 1 5 10 <210> 587 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 587 His Gly His Lys Pro Arg Arg Trp Ile Tyr Arg Met Pro Met 1 5 10 <210> 588 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 588 Asp Gly Ile Arg Asp Lys Lys Cys Cys Trp Arg Asp Leu Ile 1 5 10 <210> 589 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 589 Glu Leu Val Lys His Arg Arg Leu Asp Phe Arg Asp Pro Met 1 5 10 <210> 590 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 590 Val His His Lys Leu Arg Arg Val His Leu Arg Leu Asp Val 1 5 10 <210> 591 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 591 Gly Ile Asn Arg Gly Arg Lys Val Ser Pro Lys Asp Glu Gln 1 5 10 <210> 592 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 592 Asn Gly Tyr Arg Ala Arg Lys Glu Asn Leu Lys Phe Pro Glu 1 5 10 <210> 593 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 593 Ala Ala Tyr Arg Ala Arg Lys Ile Val Glu Lys Ser Gly Trp 1 5 10 <210> 594 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 594 Trp Ala Pro Arg Asp Arg Arg Asn Met Gly Arg Asp Pro Ala 1 5 10 <210> 595 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 595 Ile Glu Asp Lys Ser Lys Arg Phe Asn Cys Lys Glu Cys Gly 1 5 10 <210> 596 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 596 Ile Glu Met Arg Tyr Arg Arg Asp Cys Ser Arg Phe Val Asn 1 5 10 <210> 597 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 597 Gln Gln Ile Lys Tyr Lys Arg Pro Thr Tyr Arg Met Val Cys 1 5 10 <210> 598 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 598 Leu Pro Trp Arg Glu Arg Arg Asn Gly Gly Arg Ser Ser Glu 1 5 10 <210> 599 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 599 Pro Gln Thr Arg Tyr Arg Lys Tyr Phe Tyr Arg Pro Gln Met 1 5 10 <210> 600 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 600 His Met Cys Arg Trp Arg Arg Gln Ile Asn Lys Gly Val Ser 1 5 10 <210> 601 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 601 Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg 1 5 10 <210> 602 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 602 Gly Gly Gly Arg Lys Lys Arg Arg Gln Arg Arg 1 5 10 <210> 603 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 603 Gly Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 604 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 604 Gly Gly Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Gly 1 5 10 <210> 605 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 605 Gly Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Gly Gly 1 5 10 <210> 606 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Acetylcholine receptor binding peptide <400> 606 Gly Gly Gly Arg Arg Arg Arg Arg Arg Arg Arg 1 5 10

Claims

1. An acetylcholine receptor binding peptide, characterized in that Containing an amino acid sequence represented by the following chemical formula 2, [Chemical formula 2] R-X-R-R-X M-1 -R, The X M-1 is composed of 3 random amino acids, X is composed of 1 random amino acid, The peptide is a peptide according to any one sequence selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 57, SEQ ID NO: 60, SEQ ID NO: 72, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 93, SEQ ID NO: 147, SEQ ID NO: 155, SEQ ID NO: 156 and SEQ ID NO:

165.

2. The acetylcholine receptor binding peptide according to claim 1, characterized in that The peptide is an N-terminal or C-terminal modified peptide.

3. The acetylcholine receptor binding peptide according to claim 2, characterized in that The N-terminal or C-terminal modification refers to palmitoylation, acetylation, amidation, formylation or pegylation, or modification achieved by combining one or more selected from the group consisting of 2-mercaptoacetic acid, 3-mercaptopropionic acid, 6-mercaptohexanoic acid, pyroglutamic acid, succinimidyl acid, cilastatin, cysteamine, methyl ester, ethyl ester, benzyl ester, myristic acid, stearic acid, palmitic acid, cholesterol, 6-aminocaproic acid and 8-aminooctanoic acid.

4. A polynucleotide, characterized in that Encodes the peptide according to claim 1.

5. A wrinkle-improving cosmetic composition, characterized in that ， Comprising the peptide according to claim 1.

6. A composition for preventing or treating diseases related to acetylcholine receptor overactivity, characterized in that ， Comprising the peptide according to claim 1.

7. The composition for preventing or treating diseases related to acetylcholine receptor overactivity according to claim 6, characterized in that: The acetylcholine receptor overactivity-related disease is selected from the group consisting of cervical dystonia, limb dystonia, truncal dystonia, blepharospasm, rigidity, hemifacial spasm, strabismus, nystagmus, convulsions, chronic pain, chronic migraine, neuropathic pain, skin wrinkles, square jaw, neurogenic bladder, detrusor-sphincter dyssynergia, esophageal achalasia, hyperhidrosis and drooling.

8. A medical device composition comprising an acetylcholine receptor binding peptide, characterized in that ， Comprising the peptide according to claim 1.

Images