Biomarkers associated with melanoma and their application in diagnosis and treatment

Abstract

The present invention discloses biomarkers associated with melanoma and applications thereof in diagnosis and treatment. The biomarkers include miR-155, miR-27b-5p and miR-450a. The present invention provides a chip and a kit for diagnosing melanoma. The present invention proves through cell function verification experiments that the combination of the biomarkers miR-155, miR-27b-5p and miR-450a has a synergistic effect on the treatment of melanoma, and can be applied to the diagnosis and treatment of melanoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology. Specifically, the present invention relates to biomarkers associated with melanoma and their application in diagnosis and treatment. More specifically, the present invention relates to biomarkers associated with melanoma including miR-155, miR-27b-5p, and miR-450a. Background Art

[0002] Melanoma is a highly malignant tumor originating from melanocytes in the basal layer of the epidermis. The tumor is prone to occur in the skin or mucosal tissue adjacent to the skin. Melanoma is the most invasive and lethal skin cancer. In the past few decades, the incidence and mortality of melanoma have shown a sharp upward trend worldwide. However, the main cause of death in melanoma patients is the rapid metastasis of the tumor. Melanoma has the characteristics of high malignancy, rapid progression, and early metastasis. In recent years, the rapid progress of immunotherapy and targeted therapy has revolutionized the clinical history of melanoma. Its treatment has a certain effect and can significantly prolong the survival of patients, but this is limited by clinical application, and for patients with advanced melanoma who have already experienced tumor metastasis, there is still no satisfactory treatment.

[0003] At present, the research on the pathogenesis of melanoma is in urgent need of further in-depth exploration. More and more evidence shows that the pathological formation of melanoma involves complex changes in multiple genes, multiple signaling pathways and gene regulation. Therefore, identifying some potential target molecules in the progression of melanoma, including oncogenes and tumor suppressor genes, is expected to become a new target for the treatment of melanoma in the future. MicroRNA (miRNA) is a class of endogenous non-coding RNA molecules with a length of about 19-24 nucleotides. MiRNA can regulate gene expression at the post-transcriptional level by directly binding to the complementary sequence of the 3'-untranslated region of its target regulatory gene, thereby ultimately leading to target gene degradation or translation inhibition. Studies have shown that a single miRNA can regulate the expression of more than 100 genes, and at the same time, a gene may also be targeted and regulated by several miRNAs.

[0004] At present, a large number of miRNAs have been annotated, and it is predicted that about 30%-40% of human genes are regulated by miRNAs. In recent years, a large number of studies have shown that there is a dysregulation of miRNA expression profiles between tumor tissues of patients with various solid cancers and their corresponding normal tissues adjacent to tumor tissues, which may be the result of epigenetic changes induced by changes in miRNAs, changes in the activity of transcription factors, or changes in enzymes related to miRNA biogenesis. In addition, there is evidence that abnormal miRNA expression can contribute to the occurrence, development and progression of many cancers by downregulating tumor suppressor genes or upregulating tumor-promoting oncogenes. Therefore, miRNA is considered to be a key regulatory factor in the development of melanoma.

[0005] In view of this, the present invention screens miRNA associated with melanoma, and then studies the application of the screened miRNA as a biomarker for melanoma in the diagnosis and treatment of melanoma, thereby providing a new biomarker for melanoma and a new approach for treating melanoma. Summary of the invention

[0006] In order to solve the above problems, the purpose of the present invention is to provide biomarkers related to melanoma and their applications in diagnosis and treatment. The melanoma-related biomarkers include miR-155, miR-27b-5p, and miR-450a. The present invention provides a miRNA melanoma diagnostic and therapeutic marker combination, a chip, and a kit, which can diagnose melanoma simply, effectively, and non-invasively. In addition, the combination of miR-155, miR-27b-5p, and miR-450a has a synergistic effect on the treatment of melanoma.

[0007] The sequences of the biomarkers miR-155, miR-27b-5p, and miR-450a disclosed in the present invention can be queried in the miRBase database (http: / / microrna.sanger.ac.uk / ), wherein the sequence of miR-155 is shown in SEQ ID NO: 16, the sequence of miR-27b-5p is shown in SEQ ID NO: 17, and the sequence of miR-450a is shown in SEQ ID NO: 18;

[0008] Sequence of miR-155:

[0009] CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG(SEQID NO:16)

[0010] Sequence of miR-27b-5p:

[0011] AGAGCUUAGCUGAUUGGUGAAC(SEQ ID NO:17)

[0012] Sequence of miR-450a:

[0013] AAACGAUACUAAACUGUUUUUGCGAUGUGUUCCUAAUAUGCACUAUAAAUAUAUUGGGAACAUUUUGCAUGUAUAGUUUUGUAUCAAUAUA(SEQ ID NO:18)

[0014] Furthermore, the miR-155 and miR-450a described in the present invention include miR-155 and miR-450a initial miRNA, miR-155 and miR-450a precursor miRNA, and mature miR-155 and miR-450a, wherein the miR-155 and miR-450a initial miRNA are cleaved and expressed as mature miR-155 and miR-450a in human cells, and the miR-155 and miR-450a precursor miRNA are cleaved and expressed as mature miR-155 and miR-450a in human cells. As a further preferred embodiment, the miR-155 and miR-450a also include: a sequence obtained by base modification of miR-155 and miR-450a or adding bases at both ends.

[0015] In order to achieve the above object, the present invention adopts the following technical solutions:

[0016] The present invention provides the use of a reagent for detecting the expression level of a biomarker in the preparation of a product for diagnosing melanoma.

[0017] Furthermore, the biomarkers are miR-155, miR-27b-5p, and miR-450a.

[0018] Further, the reagent is selected from:

[0019] Oligonucleotide probes that specifically recognize the biomarkers miR-155, miR-27b-5p, miR-450a; or

[0020] Primers that specifically amplify the biomarkers miR-155, miR-27b-5p, and miR-450a.

[0021] Furthermore, the sequences of the primers for specifically amplifying the biomarkers miR-155, miR-27b-5p, and miR-450a are shown in SEQ ID NO:8-SEQ ID NO:9, SEQ ID NO:10-SEQ ID NO:11, and SEQ ID NO:12-SEQ ID NO:13, respectively.

[0022] Furthermore, the product includes: reagents for detecting the expression levels of the biomarkers miR-155, miR-27b-5p, and miR-450a by real-time quantitative PCR, RT-PCR, in situ hybridization, chips, or high-throughput sequencing platforms.

[0023] Furthermore, the real-time quantitative PCR refers to a method in which a fluorescent group is added to the PCR reaction system, and the entire PCR process is monitored in real time by accumulating fluorescent signals, and the starting template is quantitatively analyzed. Real-time quantitative PCR can be SYBR Green fluorescent dye method and Taqman probe method, respectively. In the quantitative PCR reaction system of Taqman probe method, a pair of PCR primers and a probe are included. The 5' end of the probe is labeled with a reporter group (Reporter, R), such as FAM, VIC, etc., and the 3' end is labeled with a fluorescent quencher group (Quencher, Q), such as TAMRA, etc. When the probe is complete, the fluorescence emitted by the reporter group is absorbed by the quencher group, and the instrument cannot detect the signal. As the PCR reaction proceeds, the Taq enzyme encounters the probe bound to the template during chain extension, and its 3'→5' exonuclease activity is cut off by the probe, the reporter group is away from the quencher group, and the energy cannot be absorbed, so a fluorescent signal is generated. Therefore, after each cycle, the fluorescent signal has a synchronous exponential growth process like the target fragment.

[0024] Further, the RT-PCR refers to converting mature miRNA into cDNA sequence first, and then amplifying it using qPCR. This technology can be carried out automatically on standard equipment, so it is now widely used. The sensitivity, specificity and repeatability of the RT-PCR method are good. In addition, the RT-PCR includes not only traditional real-time quantitative RT-PCR, but also Stem-loop real-time quantitative RT PCR technology. Stem loop real-time quantitative RT PCR is a highly specific and sensitive experimental technology for detecting miRNA expression, including designing reverse transcription primers with stem loop (Stem loop) structure and using miRNA fluorescently labeled specific molecular probes for real-time PCR. Two key steps. This technology has the following advantages: high specificity, can accurately distinguish miRNA with highly homologous sequences; ultra-wide quantitative linear range and high detection sensitivity; low sample consumption, only 1-10ng of total RNA is required; wide range of application, total RNA, cell lysate and purified RNA can be used for quantitative detection of miRNA.

[0025] Furthermore, the in situ hybridization is divided into in situ hybridization in cells and tissues. This technology detects miRNA expression and can more intuitively display the spatiotemporal expression pattern of miRNA. It can not only detect miRNA expression in individual cells of different cell lines, but also compare the expression levels of miRNA in different cell lines without classification and separation. It is a powerful tool for analyzing the tissue and timing specificity of miRNA expression.

[0026] The present invention provides a product for diagnosing melanoma.

[0027] Furthermore, the product comprises reagents for detecting the expression levels of the biomarkers miR-155, miR-27b-5p, and miR-450a.

[0028] Furthermore, the product includes a chip and a test kit;

[0029] Preferably, the chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier that specifically recognize the biomarkers miR-155, miR-27b-5p, and miR-450a;

[0030] Preferably, the kit comprises primers, probes or chips that specifically bind to the biomarkers miR-155, miR-27b-5p, miR-450a.

[0031] Furthermore, the kit also includes at least one of a positive quality control product, a negative quality control product, a poly-A tailing enzyme, a reverse transcriptase, dNTPs, a reverse transcription buffer, RNase-free water, a qPCR buffer, magnesium chloride, a DNA polymerase, and a SYBRGreen fluorescent dye.

[0032] Furthermore, the Poly-A tailing method is to reverse transcribe miRNA, so the reverse transcription primer and the reverse primer of pPCR are universal primers, and only the forward primer of qPCR is used to identify the three miRNA markers and the internal reference U6.

[0033] The present invention provides the use of a biomarker in preparing a pharmaceutical composition for treating melanoma.

[0034] Furthermore, the biomarkers are miR-155, miR-27b-5p, and miR-450a.

[0035] Further, the pharmaceutical composition includes an inhibitor that reduces the expression level of miR-155, a promoter that increases the expression level of miR-27b-5p, and an inhibitor that reduces the expression level of miR-450a;

[0036] Preferably, the sequence of the inhibitor that reduces the expression level of miR-155 is shown in SEQ ID NO: 1;

[0037] Preferably, the sequence of the promoter for increasing the expression level of miR-27b-5p is shown in SEQ ID NO: 2-SEQ ID NO: 3;

[0038] Preferably, the sequence of the inhibitor that reduces the expression level of miR-450a is shown in SEQ ID NO:4.

[0039] Furthermore, the pharmaceutical composition of the present invention also includes a pharmaceutically acceptable carrier, and the active ingredient - a substance that inhibits or promotes the expression of the biomarker - and a pharmaceutically acceptable carrier are prepared into the pharmaceutical composition of the present invention through conventional pharmaceutical processes.

[0040] The present invention provides a method for screening candidate drugs for preventing and / or treating melanoma.

[0041] Further, the method comprises the following steps:

[0042] (1) contacting the test substance with a system containing or expressing miR-155, miR-27b-5p, or miR-450a;

[0043] (2) detecting the expression levels of miR-155, miR-27b-5p, and miR-450a in the system;

[0044] (3) Selecting substances that can simultaneously reduce the expression levels of miR-155 and miR-450a and increase the expression level of miR-27b-5p as candidate drugs for preventing and / or treating melanoma.

[0045] Furthermore, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0046] The present invention provides the use of biomarkers in screening candidate drugs for preventing and / or treating melanoma.

[0047] Furthermore, the biomarkers are miR-155, miR-27b-5p, and miR-450a.

[0048] Unless otherwise defined, all technical terms in the context of the present invention have the same meanings as understood by those of ordinary skill in the art. In addition, some terms are explained as follows.

[0049] The term "treatment" as used herein generally refers to treatment of humans or animals (e.g., used by veterinarians) where some desired therapeutic effect can be achieved, such as inhibiting the development of a disease (including reducing the rate of development, stopping the development of a disease), improving a disease, and curing a disease. Treatment as a preventive measure (e.g., prevention) is also included. Use in patients who have not yet developed a disease but are at risk of developing the disease is also included in the term "treatment."

[0050] The term "biomarker" as used herein refers to a molecular indicator having specific biological properties, biochemical characteristics or other aspects, which can be used to determine the presence or absence of a specific disease or condition and / or the severity of a specific disease or condition. It can be used interchangeably with "marker", "miRNA marker" or "molecular marker". In a specific embodiment of the present invention, the biomarker is a miRNA marker, more specifically, the miRNA marker includes miR-155, miR-27b-5p, miR-450a.

[0051] The term "differential expression" as used herein refers to the presence of a difference between the expression levels of one or more biomarkers of the present invention in one sample, as compared with the expression levels of the same one or more biomarkers of the present invention in a second sample, by measuring the expression level or expression amount of the biomarkers in the sample. In a specific embodiment of the present invention, the biomarker is a miRNA marker, more specifically, the miRNA marker includes miR-155, miR-27b-5p, and miR-450a.

[0052] The term "upregulated" as used herein refers to an increase in the expression level or amount of a biomarker relative to a control by at least 10% or more, for example, 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or more or 1.1 times, 1.2 times, 1.4 times, 1.6 times, 1.8 times or more.

[0053] The term "downregulated" as used herein refers to a decrease in the expression level or amount of a biomarker relative to a control by at least 10% or more, such as 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or less than 1.0 times, 0.8 times, 0.6 times, 0.4 times, 0.2 times, 0.1 times or less.

[0054] The term "inhibitor" or "inhibitor that reduces the expression level of a biomarker" used in this article refers to a miRNA inhibitor, which is a chemically modified inhibitor specifically targeting a specific target miRNA in a cell. It specifically targets and knocks out a single miRNA molecule, which can weaken the gene silencing effect of endogenous miRNA, increase protein expression, and conduct loss-of-function studies. It can be used to screen miRNA target sites, screen miRNAs that regulate the expression of a certain gene, and screen miRNAs that affect cell development processes. A miRNA inhibitor is a chemically modified single-stranded RNA that can competitively bind to a mature miRNA sequence. It is easy to obtain, easy to operate, and has a short experimental cycle. It can be well applied to miRNA functional analysis studies, such as functional studies on cell proliferation, cell apoptosis, cell differentiation, cell migration, and stem cell growth. The miRNA inhibitor can be transfected into cells by simply wrapping it with a transfection reagent, without the tedious operation of constructing a vector, and without the worry of virus protection. Its transfection efficiency can be observed using a transfection control.

[0055] The term "promoter" or "promoter that increases the expression level of biomarkers" used in this article refers to miRNA mimincs. MiRNA mimics is a kind of miRNA that simulates endogenous miRNA in organisms. It is synthesized by chemical synthesis and can enhance the function of endogenous miRNA. MiRNA mimics simulate the high level expression of endogenous mature miRNA in cells to enhance the regulatory effect of endogenous miRNA, which is a powerful tool for miRNA function research. MiRNA mimics is a simple and efficient miRNA research tool. It can be transfected into cells by simply wrapping with a transfection reagent. There is no need for the cumbersome operation of constructing a vector, and there is no need to worry about virus protection. The transfection efficiency can be observed using a transfection control. The transfection effect of miRNA mimics can be detected from the aspects of RNA expression level, protein expression level, cell function, etc. of the target gene. These experiments can obtain the biological function data of miRNA and apply it to the verification of target genes of miRNA. Usually these experiments involve the transfection of miRNA mimics. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0057] Figure 1 The result graphs showing the differential expression of miR-155, miR-27b-5p, and miR-450a in the training set and validation set, wherein, Figure A: miR-155, training set, Figure B: miR-27b-5p, training set, Figure C: miR-450a, training set, Figure D: miR-155, validation set, Figure E: miR-27b-5p, validation set, Figure F: miR-450a, validation set;

[0058] Figure 2 The ROC curve results of miR-155, miR-27b-5p, and miR-450a in the training set and validation set are shown, wherein, Figure A: miR-155, training set, Figure B: miR-27b-5p, training set, Figure C: miR-450a, training set, Figure D: miR-155, validation set, Figure E: miR-27b-5p, validation set, Figure F: miR-450a, validation set;

[0059] Figure 3 The ROC curve results of miR-155+miR-27b-5p+miR-450a combined in the training set and validation set are shown, where A: training set, B: validation set;

[0060] Figure 4The result graphs showing the relative expression of miR-155, miR-27b-5p, and miR-450a, wherein, graph A: miR-155, graph B: miR-27b-5p, and graph C: miR-450a;

[0061] Figure 5 Statistical graphs showing the effects of miR-155inhibitor, miR-27b-5p mimics, miR-450a inhibitor, and the combination of miR-155inhibitor + miR-27b-5p mimics + miR-450a inhibitor on the apoptosis rate of melanoma cells, wherein, Figure A: blank control group, Figure B: negative control group, Figure C: miR-155inhibitor group, Figure D: miR-27b-5p mimics group, Figure E: miR-450a inhibitor group, and Figure F: miR-155inhibitor + miR-27b-5pmimics + miR-450a inhibitor group. DETAILED DESCRIPTION

[0062] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and are not to be construed as limiting the present invention. It will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and purposes of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. The experimental methods for which specific conditions are not specified in the following examples are usually tested under conventional conditions or under conditions recommended by the manufacturer.

[0063] Example 1 Screening for differentially expressed genes in melanoma

[0064] 1. Data Source

[0065] The data used in this embodiment are all from the GEO database (Gene Expression Omnibus). Melanoma data sets GSE35579 and GSE20994 are downloaded from the GEO database. The data sets include gene expression data and complete clinical annotations. The downloaded data set GSE35579 is used as a validation set with a sample size of Case:Control=41:11, and the downloaded data set GSE20994 is used as a training set with a sample size of Case:Control=35:22.

[0066] 2. Data preprocessing

[0067] The raw data of the training set and validation set downloaded from the GEO database were standardized, and the standardized gene expression matrix was annotated through an annotation file (Platform file). When multiple probes corresponded to the same gene, the average value was taken as the expression level of the gene.

[0068] 3. Differential Expression Analysis

[0069] The “limma” package in R language software was used to perform differential expression analysis on the data in the above datasets GSE35579 and GSE20994. The screening criteria for differentially expressed genes were: adj.P value<0.05, |log2FC|>0.5.

[0070] 4. Experimental results

[0071] The results are shown in Table 1 and Figure 1 A. Figure 1 B. Figure 1 C. Figure 1 D. Figure 1 E. Figure 1 F, The differentially expressed miRNAs miR-155, miR-27b-5p, and miR-450a obtained after screening showed significant differential expression in the training set and the validation set, among which, the expression of miR-155 was significantly upregulated in melanoma, the expression of miR-27b-5p was significantly downregulated in melanoma, and the expression of miR-450a was significantly upregulated in melanoma.

[0072] Table 1 Results of differential expression of miR-155, miR-27b-5p, and miR-450a in the training set and validation set

[0073]

[0074] Example 2 Diagnostic Efficacy Verification

[0075] 1. Experimental methods

[0076] The R package "pROC" (version 1.15.0) was used to draw the receiver operating characteristic curve (ROC curve) for the differentially expressed miRNAs miR-155, miR-27b-5p, and miR-450a screened in Example 1, and the sensitivity, specificity, and AUC values ​​thereof were analyzed to determine the diagnostic efficacy of the miRNAs alone and in combination in the training set and the validation set;

[0077] When judging the diagnostic efficacy of a single indicator in the training set and the validation set, the expression level of the miRNA is directly used for analysis, and the level corresponding to the point with the largest Youden index is selected as its cutoff value. Genes with 0.5 < AUC < 0.8 are used for combined analysis;

[0078] When judging the diagnostic efficacy of the combined indicators in the training set and the validation set, logistic regression is performed on the expression levels of each miRNA, and the probability of each individual being diseased or not is calculated through the fitted regression curve. Different probability division thresholds are determined, and based on the determined probability division thresholds, the sensitivity, specificity, accuracy, etc. of the combined diagnostic scheme are calculated.

[0079] 2. Experimental Results

[0080] The results are shown in Table 2 and Figure 2 A, Figure 2 B, Figure 2 C, Figure 2 D, Figure 2 E, Figure 2 F, Figure 3 A, Figure 3 B. The results show that the combined diagnosis of the miRNA combination miR-155 + miR-27b-5p + miR-450a for melanoma is significantly better than the diagnosis of a single miRNA. The AUC values in the training set and the validation set are 0.871 and 0.962 respectively, indicating that the above miRNA combination miR-155 + miR-27b-5p + miR-450a has good diagnostic efficacy and can be applied to the diagnosis of melanoma.

[0081] Table 2 Diagnostic efficacy results of miR-155, miR-27b-5p, miR-450a, and miR-155 + miR-27b-5p + miR-450a combination in the training set and the validation set

[0082]

[0083] Example 3 Research on the relationship between the expression of miR-155, miR-27b-5p, miR-450a and the apoptosis of melanoma cells

[0084] 1. Experimental Materials

[0085] The main experimental equipment, experimental reagents and consumables involved in the experiment are shown in Table 3 and Table 4.

[0086] Table 3 Main equipment involved in the experiment

[0087] name factory model Micropipette EP Pendorf 248692Z Clean bench ZJ Suzhou Purification 16052007 <![CDATA[CO2 Incubator]]> YILIANG YCP Series Inverted microscope canon 126281 Low speed centrifuge eppendorf 47103

[0088] Table 4 Main reagents involved in the experiment

[0089] name factory Part Number Lipofectamine 2000 Invitrogen #11668-019 DMEM GIBCO C11995500BT Cell culture dishes, cell culture flasks Corning Other chemical reagents Domestic analytical grade FBS GIBCO 10270 P / S solution SCLENCELL NO.0503

[0090] 2. Cell source

[0091] Melanoma cells A375 were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and were cultured in this laboratory for a long time. A375 culture medium was DMEM + 10% FBS + 1% P / S solution, 37°C, 5% CO2, 95% air, saturated humidity.

[0092] 3. Cell culture

[0093] (1) A375 melanoma cell recovery

[0094] The cell recovery method uses a rapid thawing method in a water bath. Before the experiment, take protective measures, wear gloves and protective masks, take out an A375 melanoma cell cryopreservation tube from liquid nitrogen, pay attention to the label name, cryopreservation date and other information, confirm that it is the required cell, and then quickly put it into the prepared 37℃ water bath. The whole process must be fast, and it is best to completely melt the cryopreservation solution within 1 minute. At this time, pay attention to aseptic operation to prevent infection, and pay special attention to the protection of the bottle cap. After the thawing is completed, use a pipette to transfer the frozen cells to a centrifuge tube, add PBS buffer solution and blow evenly to ensure that it is completely integrated into the PBS buffer solution, then put the centrifuge tube into the centrifuge, adjust the speed to 1000rpm / min, and maintain the time for about 5min. Take out the supernatant, keep the material at the bottom of the centrifuge tube, add an appropriate amount of DMEM complete medium to resuspend, and plant it in a T25 culture flask at a ratio of 1:2. Add 5mL of DMEMF complete medium to each culture flask. Suspended round cells can be seen under the microscope, indicating that the cells have been successfully transferred, and then put them into a cell incubator containing 5% CO2 and a constant temperature of 37℃ for culture;

[0095] (2) A375 melanoma cell culture medium replacement

[0096] The time it takes for A375 melanoma cells to begin to adhere to the wall is generally about 4-6 hours. Generally, they can be completely attached to the wall in one day. The cells after attachment are polygonal. The medium can be changed according to the color of the culture medium and the observation under the microscope. Note that the DMEM complete culture medium must be preheated in a 37°C constant temperature water bath in advance. The old culture medium on top can be sucked with a Pasteur tube. Try not to touch the bottom of the culture dish to prevent scratches on the bottom cells and uneven cell growth. Then slowly add PBS buffer solution preheated in a 37°C water bath along the side wall for washing to remove some necrotic cells. You can rinse it three times with PBS preheated in a 37°C water bath. Finally, add 5mL DMEM complete culture medium preheated in a 37°C water bath to the culture dish and place it in a 5% CO2, 37°C constant temperature incubator for culture. Pay attention to aseptic operation throughout the process. The Pasteur tube should be discarded in time after contacting the outside world. The process should be clean and not too long.

[0097] (3) A375 melanoma cell culture

[0098] In about 2-3 days, A375 melanoma cells can reach 80%-100% cell confluence, at which time the cells are passaged. Personal protection should be carried out before the experiment. In the clean bench that has been disinfected for 30 minutes in advance, use a Pasteur tube to aspirate and discard the old culture medium, rinse three times with PBS preheated in a 37°C water bath, add 1mL of 0.25% trypsin, put it in a 37°C constant temperature incubator, and time it for about 1 minute. To determine whether the cells are completely digested, you can observe under an inverted microscope. If most of the round cells are suspended, stop trypsin digestion, add 1-2mL of 5-10mL DMEM / F-12 complete culture medium preheated in a 37°C water bath, and blow the cells in time to make the cells completely suspended in the solution, then transfer them to a centrifuge tube, balance the centrifuge, adjust the speed to 1000rpm / min, centrifuge for about 5min, and pass them at a ratio of 1:3-1:5. Put 5-10mL DMEM / F-12 complete culture medium in the culture dish and culture it in a cell constant temperature incubator at 37°C and 5% CO2.

[0099] 4. Cell transfection

[0100] (1) Take A375 cells in the logarithmic growth phase and cells in good growth condition and adjust the cell density to 1×10 5 / mL, inoculated into 6-well plates, 2mL of cell suspension per well, two wells per group, cultured at 37°C overnight;

[0101] (2) 2 hours before transfection, change to serum-free medium;

[0102] (3) Transfection step: For each transfection sample, prepare as follows:

[0103] 1) Count the cells one day before transfection and add 1 mL to a 6-well plate so that the cell density of the well plate is not less than 2×10 5 indivual;

[0104] 2) For each well of cells, dilute 10 μL of 100 nM inhibitor or mimics with 250 μL of serum-free medium and incubate at room temperature for 5 min;

[0105] 3) For each well of cells, dilute 5 μL of Lipo2000 with 250 μL of serum-free medium and incubate at room temperature for 5 min;

[0106] 4) Mix the liquids in step 2) and step 3) and incubate at room temperature for 20 minutes;

[0107] 5) Change the pre-separated adherent cells into serum-free medium, add the above complex, and culture at 37°C, 5% CO2 for 6 hours, then change into growth medium with serum, and continue to culture at 37°C, 5% CO2 for 48 hours. Collect the cell samples, wash twice with PBS, discard the liquid, and perform subsequent RNA extraction;

[0108] The experiment was set up into three groups: blank control group (A375 melanoma cells), negative control group (inhibitor-NC or mimics-NC group) and experimental group (inhibitor or mimics group).

[0109] Among them, the sequence information of the inhibitor against miR-155 is as follows:

[0110] 5'-AACCCCUAUCACGAUUAGCAUUAA-3'(SEQ ID NO:1)

[0111] The sequence information of mimics targeting miR-27b-5p is as follows:

[0112] The positive strand is 5'-AGAGCUUAGCUGAUUGGUGAAC-3' (SEQ ID NO: 2)

[0113] The antisense strand is 5'-GUUCACCAAUCAGCUAAGCUCU-3' (SEQ ID NO: 3)

[0114] The sequence information of the inhibitor against miR-450a is as follows:

[0115] 5'-AUAUUAGGAACACAUCGCAAAA-3'(SEQ ID NO:4)

[0116] The sequence information of inhibitor-NC is as follows:

[0117] 5'-CAGUACUUUUGUGUAGUACAAA-3'(SEQ ID NO:5)

[0118] The sequence information of mimics-NC is as follows:

[0119] The positive strand is 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO: 6)

[0120] The antisense strand is 5'-CAGUACUUUUUGUGUAGUACAAA-3' (SEQ ID NO: 7)

[0121] 5. QPCR detection of the expression levels of miR-155, miR-27b-5p, and miR-450a in cells

[0122] (1) Extraction of total RNA from samples (Trizol method)

[0123] 1) Take an appropriate amount of the sample to be tested, add liquid nitrogen and grind it into powder;

[0124] 2) Transfer the ground sample to a 1.5 mL EP tube with 1 mL Trizol;

[0125] 3) Add 500 μL of phenol chloride to a 1.5 mL EP tube, shake and mix, and let stand for 5 minutes;

[0126] 4) Centrifuge at 12000 rpm at 4°C for 10 minutes and carefully transfer the supernatant to a new 1.5 mL EP tube;

[0127] 5) Add 700 μL of isopropanol to the separated supernatant and mix thoroughly;

[0128] 6) Centrifuge at 12000 rpm for 10 minutes at 4°C and carefully discard the supernatant;

[0129] 7) Wash the precipitate once with 75% ethanol and dry it at room temperature;

[0130] 8) Dissolve the RNA precipitate in 50 μL DEPC water;

[0131] 9) Agarose gel electrophoresis detection.

[0132] (2) Total RNA quality detection

[0133] 1) Use a nucleic acid concentration meter to measure RNA concentration and purity. Before measurement, use DEPC water for dissolving RNA to adjust the zero. The operation method is as follows: lift the sample arm and add the sample to the detection base; lower the sample arm and use the software on the computer to start the absorbance value detection. A sample column will be automatically pulled out between the upper and lower optical fibers, and then the test will be carried out; when the test is completed, lift the sample arm and wipe the samples on the upper and lower bases with clean dust-free paper;

[0134] 2) Concentration determination: A reading of 1 at 260 nm represents 40 ng RNA / μL. The formula for calculating the sample RNA concentration is: A260 X40 ng / μL;

[0135] 3) Purity detection: The A260 / A280 ratio of RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

[0136] (3) Reverse transcription to synthesize cDNA

[0137] Reverse transcription was performed using Invitrogen's reverse transcription kit Superscript III;

[0138] The reaction system 1 was set up as shown in Table 5, mixed, centrifuged, 65°C, 5 minutes, and placed on ice after completion;

[0139] Table 5 Composition of reaction system 1

[0140] Reaction system 1 composition Content of each component RNA 200ng(10μL) Oligo-dT 1μL

[0141] The establishment of reaction system 2 is shown in Table 6;

[0142] Table 6 Composition of reaction system 2

[0143] Reaction system 2 composition Content of each component Reaction system 1 12μL dNTPs (10 μM) 1μL 0.1M DTT 2μL 5X Buffer 4μL RT enzyme 1μL

[0144] Mix well, centrifuge, and place in a 42°C water bath for 60 minutes; take out and place at 85°C for 10 minutes to inactivate the reverse transcriptase. After the reaction is completed, place the product at -20°C for later use.

[0145] (4) Real-time fluorescence quantitative detection

[0146] First, design the amplification primers for QPCR. The specific primer sequences are as follows:

[0147] miR-155:

[0148] The forward primer was 5′-TTAATGCTAATCGTGATAGG-3′ (SEQ ID NO: 8);

[0149] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 9);

[0150] miR-27b-5p:

[0151] The forward primer was 5′-AGAGCTTAGCTGATTGGTG-3′ (SEQ ID NO: 10);

[0152] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 11);

[0153] miR-450a:

[0154] The forward primer was 5′-TTTTGCGATGTGTTCCTAAT-3′ (SEQ ID NO: 12);

[0155] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 13);

[0156] U6 internal reference primer:

[0157] The forward primer was 5′-GCTTCGGCAGCACATATACTAAAAT-3′ (SEQ ID NO: 14);

[0158] The reverse primer was 5′-CGCTTCACGAATTTGCGTGTCAT-3′ (SEQ ID NO: 15);

[0159] The establishment of the Real time PCR reaction system is shown in Table 7;

[0160] Table 7 Real time PCR reaction system

[0161] Reaction system composition Content of each component cDNA 2μL PCR mix 10μL primer F 1μL primer R 1μL <![CDATA[ddH2O]]> 6μL

[0162] After the system is mixed, centrifuge briefly, place on a fluorescent quantitative PCR instrument, and react according to the conditions described in Table 8;

[0163] Table 8 Realtime PCR reaction conditions

[0164]

[0165] The relative quantitative results of each group of samples were analyzed, and the calculation formula for the relative expression of miR-155, miR-27b-5p, and miR-450a was as follows:

[0166]

[0167] ΔCt q = Average Ct value of target gene in the test group - Average Ct value of reference gene in the test group

[0168] ΔCt cb = Average Ct value of target gene in control group - Average Ct value of reference gene in control group

[0169] 6. Cell apoptosis experiment

[0170] In this example, flow cytometry was used to detect the effects of the expression of miR-155, miR-27b-5p, miR-450a, and miR-155+miR-27b-5p+miR-450a on apoptosis of A375 melanoma cells. First, A375 melanoma cells that were not transfected, transfected with miR-155 inhibitor, transfected with miR-27b-5p mimics, transfected with miR-450a inhibitor, and transfected with miR-155 inhibitor, miR-27b-5p mimics, and miR-450a inhibitor were collected, and the cells were washed and fixed with ethanol, and the cells were resuspended and filtered, and stained with PI dye solution, and then detected by flow cytometry;

[0171] Among them, in the cell apoptosis detection, different quadrants in the flow cytometry detection result diagram represent different meanings. Q1-1 (AnnexinV-FITC)- / PI+ represents necrotic cells, Q1-2 (AnnexinV+FITC)+ / PI+ represents mid-to-late apoptotic cells, Q1-4 (AnnexinV-FITC)+ / PI- represents early apoptotic cells, and Q1-3 (AnnexinV-FITC)- / PI- represents normal living cells. The percentage of each quadrant represents the proportion of the corresponding cells, and the total cell apoptosis rate = mid-to-late apoptosis rate + early apoptosis rate.

[0172] 7. Experimental results

[0173] The results of transfection showed that the expression level of miR-155 in the blank control group was set as 1 as the reference. Compared with the expression level of miR-155 in the blank control group (relative expression level was 1) and the expression level of miR-155 in the negative control group (NC group) transfected with inhibitor-NC, the expression level of miR-155 in the experimental group transfected with miR-155inhibitor was significantly downregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 A);

[0174] The results of transfection showed that the expression level of miR-27b-5p in the blank control group was set as a reference of 1. Compared with the expression level of miR-27b-5p in the blank control group (relative expression level was 1) and the expression level of miR-27b-5p in the negative control group (NC group) transfected with mimics-NC, the expression level of miR-27b-5p in the experimental group transfected with miR-27b-5p mimics was significantly upregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 B);

[0175] The results of transfection showed that the expression level of miR-450a in the blank control group was set as a reference of 1. Compared with the expression level of miR-450a in the blank control group (relative expression level was 1) and the expression level of miR-450a in the negative control group (NC group) transfected with inhibitor-NC, the expression level of miR-450a in the experimental group transfected with miR-450a inhibitor was significantly downregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 C);

[0176] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-155inhibitor (10.16%) was significantly higher than that in the blank control group (3.00%) and the negative control group (3.17%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 C), indicating that miR-155 can affect the apoptosis ability of melanoma cells, and inhibiting the expression level of miR-155 can promote the apoptosis of melanoma cells;

[0177] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-27b-5p mimics (10.01%) was significantly higher than that in the blank control group (3.00%) and the negative control group (3.17%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 D), indicating that miR-27b-5p can affect the apoptosis ability of melanoma cells, and increasing the expression level of miR-27b-5p can promote the apoptosis of melanoma cells;

[0178] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-450a inhibitor (10.26%) was significantly higher than that in the blank control group (3.00%) and the negative control group (3.17%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 E), indicating that miR-450a can affect the apoptosis ability of melanoma cells, and inhibiting the expression level of miR-450a can promote the apoptosis of melanoma cells;

[0179] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group co-transfected with miR-155inhibitor, miR-27b-5p mimics and miR-450a inhibitor (45.39%) was significantly higher than that in the experimental group transfected with miR-155inhibitor alone (10.16%), the experimental group transfected with miR-27b-5p mimics alone (10.01%), and the experimental group transfected with miR-450a inhibitor alone (10.26%) (see Tables 9 and Figure 5 C. Figure 5 D. Figure 5 E. Figure 5 F);

[0180] In addition, the cell inhibition rate of each group was calculated. The results are shown in Table 10. Using the Jin's formula expression q = E A+B+C / (E A +E B +E C -E A ×E B ×E C ) to determine whether the combined effect of the three is synergistic, where E A+B+C is the inhibition rate of miR-155inhibitor+miR-27b-5p mimics+miR-450a inhibitor on melanoma cells, E A is the inhibition rate of miR-155inhibitor on melanoma cells, E B is the inhibition rate of miR-27b-5p mimics on melanoma cells, E C is the inhibition rate of miR-450a inhibitor on melanoma cells; if q=0.85-1.15, it is simple superposition, 1.15<q<20 is synergy, q>20 is significant synergy, q<0.85 is antagonism, that is, when q>1.15, it can be determined that the promotion of apoptosis of melanoma cells by miR-155inhibitor, miR-27b-5p mimics and miR-450a inhibitor is a synergistic effect rather than a simple superposition;

[0181] According to the results of cell inhibition rate calculated in Table 10, the synergistic q value was calculated using King's formula to evaluate whether the combined effect of miR-155inhibitor, miR-27b-5p mimics, and miR-450a inhibitor was a synergistic effect. Substituting the results of cell inhibition rate calculated, it can be seen that q = E A+B+C / (E A +E B +E C -E A ×E B ×E C )=0.4239 / (0.0716+0.0701+0.0726-0.0716×0.0701×0.0726)=1.982, that is, q=1.982, q>1.15, indicating that the combination of miR-155inhibitor, miR-27b-5p mimics and miR-450a inhibitor has a synergistic effect in promoting the apoptosis of melanoma cells, further proving that the combination of miR-155inhibitor, miR-27b-5p mimics and miR-450a inhibitor is a synergistic treatment rather than a simple additive effect.

[0182] Table 9 Statistics of cell apoptosis experiments

[0183]

[0184] Table 10 Calculation results of cell inhibition rate of each group

[0185]

[0186] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention. Sequence Listing <110> Kangtai Medical Testing Services Hebei Co., Ltd. Beijing Bioscience Biomedical Technology Co., Ltd. <120> Biomarkers associated with melanoma and their application in diagnosis and treatment <141> 2021-10-13 <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty four <212> RNA <213> Artificial Sequence <400> 1 aaccccuauc acgauuagca uuaa 24 <210> 2 <211> twenty two <212> RNA <213> Artificial Sequence <400> 2 agagcuuagc ugauugguga ac 22 <210> 3 <211> twenty two <212> RNA <213> Artificial Sequence <400> 3 cuucaccaau cagcuaagcu cu 22 <210> 4 <211> twenty two <212> RNA <213> Artificial Sequence <400> 4 auauuaggaa cacaucgcaa aa 22 <210> 5 <211> twenty two <212> RNA <213> Artificial Sequence <400> 5 caguacuuuu guguaguaca aa 22 <210> 6 <211> twenty two <212> RNA <213> Artificial Sequence <400> 6 uuuguacuac acaaaaguac ug 22 <210> 7 <211> twenty two <212> RNA <213> Artificial Sequence <400> 7 caguacuuuu guguaguaca aa 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ttaatgctaa tcgtgatagg 20 <210> 9 <211> 16 <212> DNA <213> Artificial Sequence <400> 9 ctcaactggt gtcgtg 16 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <400> 10 agagcttagc tgattggtg 19 <210> 11 <211> 16 <212> DNA <213> Artificial Sequence <400> 11 ctcaactggt gtcgtg 16 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 ttttgcgatg tgttcctaat 20 <210> 13 <211> 16 <212> DNA <213> Artificial Sequence <400> 13 ctcaactggt gtcgtg 16 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 gcttcggcag cacatatact aaaat 25 <210> 15 <211> twenty three <212> DNA <213> Artificial Sequence <400> 15 cgcttcacga atttgcgtgt cat 23 <210> 16 <211> 65 <212> RNA <213> Artificial Sequence <400> 16 cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca uauuagcauu 60 aacag 65 <210> 17 <211> twenty two <212> RNA <213> Artificial Sequence <400> 17 agagcuuagc ugauugguga ac 22 <210> 18 <211> 91 <212> RNA <213> Artificial Sequence <400> 18 aaacgauacu aaacuguuuu ugcgaugugu uccuaauaug cacuauaaau auauugggaa 60 cauuuugcau guauaguuuu guaucaauau a 91

Claims

1. Use of an inhibitor for reducing the expression level of miR-155, an enhancer for increasing the expression level of miR-27b-5p, and an inhibitor for reducing the expression level of miR-450a in the preparation of a pharmaceutical composition for treating melanoma.

2. The use according to claim 1, characterized in that: The sequence of the inhibitor that reduces the expression level of miR-155 is shown in SEQ ID NO:

1.

3. The use according to claim 1, characterized in that: The sequences of the promoters for increasing the expression level of miR-27b-5p are shown in SEQ ID NO:2-SEQ ID NO:

3.

4. The use according to claim 1, characterized in that: The sequence of the inhibitor that reduces the expression level of miR-450a is shown in SEQ ID NO:

4.

5. A method for screening candidate drugs for preventing and / or treating melanoma, characterized in that: The method comprises the following steps: (1) contacting the test substance with a system containing or expressing miR-155, miR-27b-5p, or miR-450a; (2) detecting the expression levels of miR-155, miR-27b-5p, and miR-450a in the system; (3) Select substances that can simultaneously reduce the expression levels of miR-155 and miR-450a and increase the expression level of miR-27b-5p as candidate drugs for preventing and / or treating melanoma.

6. Use of a biomarker in screening candidate drugs for preventing and / or treating melanoma, characterized in that: The biomarkers are a combination of miR-155, miR-27b-5p and miR-450a.

Images