A fluorescent biosensor for combined detection of miRNA155 and glutathione

Abstract

The present invention belongs to the field of biological detection technology and provides a fluorescent biosensor for the joint detection of miRNA and GSH, comprising: a ligation probe L, a padlock probe P, a reporter probe H, and a Mg 2+ , phi29 DNA polymerase, T4 DNA ligase, dNTP and GSH; the 5' end of the padlock probe P is phosphorylated; the 39th and 40th bases of the DNAzyme chain contain a disulfide bond; the 3' end is modified with reverse dT; the 5' end of the reporter probe H chain is modified with a fluorescent reporter group, and the 25th position is modified with a fluorescent quencher group. The sensor has a low detection limit, a simple construction method, stable performance, and a low process cost, and is suitable for industrial production and detection requirements.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a fluorescent biosensor for detecting miRNA and glutathione. Background Art

[0002] miRNA (small single-stranded, ss) is a non-protein-coding small RNA that plays an important role in gene regulation by pairing with the information of protein-coding genes and promoting the cleavage or translation inhibition of mRNA at the post-transcriptional level. miRNA regulates many biological behaviors in cells, including cell differentiation, proliferation, apoptosis, drug resistance, angiogenesis, invasion and metastasis. miRNA is an important biological molecule and one of the indispensable structural and functional elements in normal tissues and organs.

[0003] Glutathione (GSH) is a tripeptide containing a γ-amide bond and a sulfhydryl group, composed of glutamic acid, cysteine ​​and glycine. It is a sulfhydryl-containing tripeptide substance that is relatively abundant in mammals and has the ability to resist oxidation, scavenge free radicals and regulate important physiological processes in cells.

[0004] Currently, northern blotting is the most widely used miRNA detection method. However, northern blotting analysis based on hybridization and blotting is not suitable for large-scale screening purposes. In addition, this method is sample-consuming, labor-intensive, and has poor sensitivity, and probe labeling can easily cause sample degradation and environmental pollution. Methods for detecting glutathione include colorimetry and two-photon emission, but they all have disadvantages such as time-consuming, expensive instruments, and complex operations. Due to its unparalleled sensitivity and specificity, real-time quantitative PCR has become an efficient detection tool for the quantification of various nucleic acids and is also considered the gold standard method for miRNA profiling. However, this method cannot quantify active mature miRNAs and requires expensive instruments and well-trained professional operators. In addition, it is also difficult to design PCR primers for miRNA detection. Summary of the invention

[0005] In view of the problems in the prior art, the present invention provides a fluorescent biosensor for detecting miRNA and glutathione, which has fast detection speed and simple operation.

[0006] To achieve the above purpose, the present invention adopts the following technical solution.

[0007] A fluorescent biosensor for jointly detecting miRNA155 and glutathione, comprising:

[0008] The nucleotide sequences are shown in SEQ ID NO: 1-4 as the connecting probe L, padlock probe P, DNAzyme chain (H1) and reporter probe H, Mg 2+ , phi29 DNA polymerase, T4 DNA ligase, dNTP;

[0009] The 5' end of the padlock probe P is phosphorylated;

[0010] The DNAzyme chain comprises a disulfide bond between the 39th and 40th bases; and the 3' end is modified with a reverse dT.

[0011] The 5' end of the H chain of the reporter probe is modified with a fluorescent reporter group, and the 25th position is modified with a fluorescent quencher group.

[0012] Preferably, the ligation probe L, padlock probe P and T4 DNA ligase are replaced by a circular template.

[0013] The method for constructing the circular template comprises: hybridizing the padlock probe P and the connection probe L in T4 DNA ligase buffer, then adding T4 DNA ligase to react at low temperature, and then inactivating T4 DNA ligase; and purifying to obtain the circular template.

[0014] Preferably, the biosensor further comprises a buffer solution; more preferably, the buffer solution comprises Mg 2+ .

[0015] A kit for detecting miRNA155 comprising the above fluorescent biosensor.

[0016] Preferably, the kit further comprises a standard sample of miRNA155.

[0017] Preferably, the above fluorescent biosensor or kit can also be used to detect the concentration of GSH in the presence of miRNA155.

[0018] A method for detecting miRNA155 using the above biosensor or kit comprises the following steps:

[0019] (1) Connecting probe L and padlock probe P to obtain a circular template under the catalysis of T4 DNA ligase;

[0020] (2) Ring template, Mg 2+ , phi29 DNA polymerase, dNTP, DNAzyme chain (H1), and reporter probe H were incubated in buffer at 30°C; then phi29 DNA polymerase was inactivated;

[0021] (3) Add a series of concentration solutions of the sample to be tested or the standard sample of miRNA155 and GSH to the system of step (2), incubate at 37° C., and then perform fluorescence detection.

[0022] Preferably, the above method further comprises the steps of preparing a miRNA155 standard curve and calculating the miRNA155 in the sample to be tested.

[0023] The detection principle of the present invention is as follows:

[0024] The biosensor uses the following sequence:

[0025] Connect probe L:

[0026] 5'-CGTCAACTAG GAAACCTATG GGACC -3'

[0027] Padlock probe P:

[0028] 5'-P-CCAGGGTATCCAAAGGATCAACTGCAATTAATGCTAATCGTGATAGGGGTTGCTCTCCATAGCTAGTCGTTTGCTGCAACGGG-3'

[0029] DNAzyme chain (H1):

[0030] 5'-AGGGGTTCTCCATACCTACAACGACCTGCACCTAAAAAA / iHS-SH / TGCTCTCCAGGCTAGCTAGTCGTTG Inverted dT-3'

[0031] Reporter probe H:

[0032] 5'- FAM -CGATTAGGTGATTAGTGCTAATCG- BHQ -TAATT -3'

[0033] miRNA155:

[0034] 5'- UUAAU GCUAA UCGUG AUA GGGGU-3';

[0035] The ligation probe L and the padlock probe P can obtain a circular template under the catalysis of T4 DNA ligase, and the circular template contains a miRNA sequence and a partial sequence of the DNAzyme chain; the circular template is subjected to rolling circle amplification under the action of Phi29 DNA polymerase, and the product after rolling circle amplification contains a miRNA complementary sequence and a partial complementary sequence of the DNAzyme chain;

[0036] Based on the cleavage function of GSH on disulfide bonds (SS), in the presence of GSH, the DNAzyme chain (H1) is destroyed, the disulfide bonds are broken, and it becomes two single chains. The fallen single chain can hybridize with the complementary sequence contained in the product, and then displace the other part of the single chain bound to the product, thereby exposing the binding site of miRNA. In the presence of miRNA, it hybridizes with the miRNA site exposed by the product, and then replaces the reporter probe H, thereby quenching the fluorescence.

[0037] The present invention has the following advantages:

[0038] The present invention is based on rolling circle amplification signal amplification, GSH cuts disulfide bonds, releases single chains to bind to products, squeezes off DNAzyme chains to expose miRNA binding sites, miRNA binds to the exposed binding sites, squeezes off reporter probes, and thus quenches fluorescence to construct an optical biosensor. The sensor has the advantages of fast detection speed, low detection limit, high specificity, etc., and realizes rapid and accurate quantitative detection of targets.

[0039] The sensor of the present invention utilizes rolling circle amplification and GSH-specific cleavage of disulfide bonds to amplify signals and improve the sensitivity of detection; utilizes the specific cleavage of disulfide bonds by GSH and the specific recognition of miRNA and binding sites to achieve high-specificity joint detection of dual targets; the reaction conditions of the sensor are mild and the reaction speed is fast; the main process of the detection principle is implemented in a homogeneous phase, which improves the reaction speed, reduces the complexity of the operation, and achieves rapid, simple and sensitive detection of the target; the preparation method of the sensor is simple, the property is stable, the repeatability is good, and it is suitable for the detection of target objects in samples and the practical application of biosensor industrialization. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 It is the principle diagram of the present invention;

[0041] Figure 2 Optimization test result graph for circular template concentration;

[0042] Figure 3 Optimization test result graph for GSH concentration;

[0043] Figure 4 This is a graph showing the results of miRNA155 concentration detection. DETAILED DESCRIPTION

[0044] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0045] Example 1 Screening of Circular Template Concentration

[0046] (1) According to the sequences shown in SEQ ID NO:1-4, a ligation probe L, a padlock probe P, H1 and a reporter probe H were synthesized; and the following modifications were made: a disulfide bond was modified between the 39th and 40th bases of H1; a reverse dT was modified at the 3' end; a fluorescent reporter group Cy3 was modified at the 5' end of the reporter probe H chain, and a fluorescent quencher group BHQ was modified at the 25th base; and a miRNA155 standard product shown in SEQ ID NO:5 was synthesized;

[0047] (2) Follow the steps below to construct a circular template:

[0048] a) Prepare 10× T4 DNA ligase buffer containing 500 mM Tris-HCl, 100 mM MgCl2, 100 mM DTT and 10 mM ATP;

[0049] b) Mix 39 μL sterile water, 6 μL padlock probe P (10 μM), 6 μL ligation probe L (10 μM) and 6 μL 10× T4 DNA ligase buffer, denature at 95°C for 5 min, and then slowly cool to room temperature to complete hybridization. Then add 3 μL T4 DNA ligase (400 U / μL) to the reaction system and react it at 16°C for 20 h. After that, the reaction system is incubated in a water bath at 65°C for 15 minutes to inactivate T4 DNA ligase and obtain a circular template, which is stored at 4°C for later use.

[0050] (3) Prepare a buffer solution containing 50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5;

[0051] 3 μL circular template (concentrations were 0 nM, 200 nM, 500 nM, 800 nM, 1 μM, 1.2 μM), 2 μL dNTP (1 mM), 3 μL phi29 DNA polymerase (1 U / μL), 9 μL H1 (10 μM), 5 μL reporter probe H (10 μM) were added to 3 μL buffer solution and 5 μL sterile water in a centrifuge tube, mixed and reacted at 37°C for 90 min; then 5 μL miRNA155 (500 nM) and 5 μL GSH (1 μM) were added, mixed and reacted at 37°C for 60 min;

[0052] (4) Dilute the reaction solution (40 µL) to 100 µL, set the excitation wavelength to 485 nm, and detect the fluorescence signal change at 520 nm;

[0053] Results Figure 2As can be seen from the figure, with the increase of the concentration of the circular template, the fluorescence intensity obtained in the experiment continues to decrease. After the concentration reaches 1.0 µM, the fluorescence intensity remains basically unchanged, indicating that the optimal concentration of the circular template is 1.0 µM.

[0054] Example 2 Screening of GSH concentration

[0055] The detection was performed in the manner of Example 1, except that in step (3), the concentration of the circular template was 1.0 µM, and the concentration of GSH was 0 nM, 200 nM, 400 nM, 600 nM, 800 nM, 1 µM, and 1.2 µM; in step (4), the fluorescence detection scanned the fluorescence signal change at 500-600 nm, and the fluorescence signal at 520 nm was recorded;

[0056] Results Figure 3 As can be seen from the figure, the detected fluorescence signal decreases as the target concentration increases in the range of 200 nM-1.2µM. The logarithm of the GSH concentration is inversely proportional to the fluorescence intensity. The fitting curve is: I=621.536+203.832 lgC(nM) (where C represents the concentration of GSH, R 2 =0.982). At the same time, the concentration was further lowered based on 100 nM. It was found that when the concentration was lower than 80 nM, the logarithm of GSH concentration and fluorescence intensity no longer conformed to the fitting curve, and the lowest GSH concentration was 80 nM.

[0057] Example 3 Detection of miRNA155 by the optimized sensor

[0058] (1) According to the sequences shown in SEQ ID NO:1-4, a ligation probe L, a padlock probe P, H1 and a reporter probe H were synthesized; and the following modifications were made: a disulfide bond was modified between the 39th and 40th bases of H1; a reverse dT was modified at the 3' end; a fluorescent reporter group Cy3 was modified at the 5' end of the reporter probe H chain, and a fluorescent quencher group BHQ was modified at the 25th base; and a miRNA155 standard product shown in SEQ ID NO:5 was synthesized;

[0059] (2) Follow the steps below to construct a circular template:

[0060] a) Prepare 10× T4 DNA ligase buffer containing 500 mM Tris-HCl, 100 mM MgCl2, 100 mM DTT and 10 mM ATP;

[0061] Prepare a buffer solution containing 50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5;

[0062] b) Mix 39 μL sterile water, 6 μL padlock probe P (10 μM), 6 μL ligation probe L (10 μM) and 6 μL 10× T4 DNA ligase buffer, denature at 95°C for 5 min, and then slowly cool to room temperature to complete hybridization. Then add 3 μL T4 DNA ligase (400 U / μL) to the reaction system and react it at 16°C for 20 h. After that, the reaction system is incubated in a water bath at 65°C for 15 minutes to inactivate T4 DNA ligase and obtain a circular template, which is stored at 4°C for later use.

[0063] (3) Add 3 μL of circular template (1.0 μM), 2 μL of dNTP (1 mM), 3 μL of phi29 DNA polymerase (1 U / μL), 9 μL of H1 (10 μM), and 5 μL of reporter probe H (10 μM) to a centrifuge tube in 3 μL of buffer solution and 5 μL of sterile water, mix well, and incubate at 37°C for 90 min.

[0064] Then, 5 μL miRNA155 (0 nM, 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM) and 5 μL GSH (1 μM) were added, mixed and reacted at 37°C for 60 min;

[0065] (4) Dilute the reaction solution (40 µL) to 100 µL, set the excitation wavelength to 485 nm, scan the fluorescence signal changes at 500-600 nm, and record the fluorescence signal at 520 nm;

[0066] Results Figure 4 As can be seen from the figure, with the increase of miRNA155 concentration, the detected fluorescence signal decreases as the target concentration increases in the range of 100 nM-600 nM; the logarithm of miRNA concentration is inversely proportional to the fluorescence intensity, and the fitting curve is: I=625.569+ 213.586 lgC(nM) (where C represents the concentration of miRNA, R 2 =0.985). At the same time, we continued to test at lower concentrations based on the concentration of 100 nM. When the concentration was lower than 75 nM, the logarithm of the miRNA155 concentration and the fluorescence intensity no longer conformed to the fitting curve. Therefore, the lower limit of this method for detecting miRNA155 was 75 nM. Sequence Listing <110> University of Jinan <120> A fluorescent biosensor for combined detection of miRNA155 and glutathione <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 cgtcaactag gaaacctatg ggacc 25 <210> 2 <211> 82 <212> DNA <213> Artificial Sequence <400> 2 ccagggtatc caaaggatca actgcaatta atgctaatcg tgataggggt tgctctccat 60 agctagtcgt tgctgcaacg gg 82 <210> 3 <211> 64 <212> DNA <213> Artificial Sequence <400> 3 aggggttctc catacctaca acgacctgca cctaaaaaat gctctccagg ctagctagtc 60 gttg 64 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 cgattaggtg attagtgcta atcg 24 <210> 5 <211> twenty three <212> RNA <213> Artificial Sequence <400> 5 uuaaugcuaa ucgugauagg ggu 23

Claims

1. A fluorescent biosensor for the combined detection of miRNA155 and glutathione, characterized in that: include: The nucleotide sequences are as shown in SEQ ID NO: 1-4, the connection probe L, the padlock probe P, the DNAzyme chain and the reporter probe H, Mg 2 + , phi29 DNA polymerase, T4 DNA ligase, dNTP; The 5' end of the padlock probe P is phosphorylated; The DNAzyme chain contains a disulfide bond between the 39th and 40th bases; the 3' end is modified with reverse dT; The 5' end of the reporter probe H chain is modified with a fluorescent reporter group, and the 25th position is modified with a fluorescent quencher group; The ligation probe L and the padlock probe P obtain a circular template under the catalysis of T4 DNA ligase.

2. The fluorescent biosensor according to claim 1, characterized in that: The fluorescent biosensor also includes a buffer solution; the buffer solution contains Mg 2+ .

3. A kit for detecting miRNA155 comprising the fluorescent biosensor according to claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also includes a standard sample of miRNA155.

5. A method for detecting miRNA155 using the biosensor according to claim 1 or 2 or the kit according to claim 3 or 4, characterized in that: The following steps are involved: (1) Connecting probe L and padlock probe P to obtain a circular template under the catalysis of T4 DNA ligase; (2) Ring template, Mg 2+ , phi29 DNA polymerase, dNTP, DNAzyme chain, and reporter probe H were incubated in buffer at 30°C; then phi29 DNA polymerase was inactivated; (3) Add a series of concentration solutions of the sample to be tested or the standard sample of miRNA155 and GSH to the system of step (2), incubate at 37°C, and then perform fluorescence detection.

6. The method according to claim 5, characterized in that The method also includes the steps of preparing a miRNA155 standard curve and calculating the miRNA155 in the sample to be tested.

7. Use of the biosensor according to claim 1 or 2 or the kit according to claim 3 or 4 in detecting GSH.

Images