A nucleic acid detection reagent, kit and application based on SENSR and CRISPR technology

Abstract

The present invention belongs to the field of gene detection technology, and specifically relates to a nucleic acid detection reagent, a kit and an application based on SENSR and CRISPR technology. A reagent for detecting nucleic acid is disclosed; the reagent detects nucleic acid based on SENSR and CRISPR technology, and replaces the dye-bound RNA aptamer template sequence of the reporter probe in the existing SENSR with a universal sequence recognized by crRNA. Under the guidance of crRNA, the Cas protein recognizes the target sequence, stimulates the Cas protein with para-cleavage activity, and generates a detection signal by cutting a specific reporter probe; and, compared with the SENSR method and the improved SENSR method, after using the reagent, there is no significant amplification signal in the blank or negative control, but there is a significant signal after the target nucleic acid with a lower copy is loaded, which can realize a highly sensitive one-pot detection of target nucleic acid; at the same time, the reagent can detect two or more target nucleic acids at the same time.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and specifically relates to a nucleic acid detection reagent, a kit and an application based on SENSR and CRISPR technology. Background Art

[0002] Some dangerous infectious diseases often have signs and symptoms similar to those of colds or flu-like syndromes, so early diagnosis is crucial for disease treatment. In order to quickly diagnose infectious diseases, nucleic acid-based diagnosis has become an alternative to traditional culture or immunoassay methods due to its rapidity and specificity. In order to improve sensitivity, current nucleic acid detection methods usually perform target amplification before the detection step. Traditional amplification methods are based on PCR, which requires a thermal cycler for precise temperature regulation. As an alternative to PCR-based methods, isothermal amplification methods such as recombinant chain polymerase reaction (RPA) at a constant temperature have complex active components. In order to maintain the long-term stability of the active components in the complex detection system, the detection reagents need to be freeze-dried, which increases the production and detection costs.

[0003] The nucleic acid detection method based on SplintR enzyme ligation reaction is a sequence-specific method that mainly relies on connecting two independent probes and hybridizing to adjacent sites of the RNA target sequence. Because its specificity depends on the ligation reaction method, it is often used to detect markers of genetic diseases and pathogen detection. Based on this, Chang Ha Woo et al. developed a ligation method based on SplintR enzyme, which complementarily connects two DNAs through RNA scaffolds, combines signal amplification to achieve high-sensitivity detection of nucleic acids, and developed a one-pot isothermal RNA detection reaction (SENSR). SENSR consists of two enzymatic reactions: the ligation reaction of SplintR ligase and the subsequent transcription reaction of T7 RNA polymerase. In SENSR, after adding RNA samples from pathogens, the reaction steps of ligation, transcription and dye aptamer binding can respectively perform the processes of detection, amplification and signal generation. Chang Ha Woo et al. designed two single-stranded DNA probes, namely the promoter probe and the reporter probe. The promoter probe consists of an upstream hybridization sequence (UHS) and a T7 promoter with a stem-loop structure. The UHS hybridizes with the 5-terminal half sequence of the target RNA, and the T7 promoter part adopts a stem-loop structure to form an active double-stranded chain. The reporter probe consists of a downstream hybridization sequence (DHS) and a dye-bound RNA aptamer template sequence. The DHS contains the complementary sequence of the other half of the target RNA region. After the UHS and DHS probes hybridize with the target RNA, the SplintR ligase connects the promoter probe and the reporter probe. Subsequently, T7 RNA polymerase uses the full-length ligated probe as a DNA template to synthesize RNA aptamers, which bind to fluorescent dyes and emit fluorescence. The SENSR reaction has a two-fold amplification mechanism: (1) multiple transcription reactions of T7 RNA polymerase to the ligated full-length probe; (2) ligation reactions of the target RNA sequence (including the target RNA formed by multiple transcriptions) to the full-length probe. SENSR uses this mechanism to achieve highly sensitive detection of RNA.

[0004] However, the inventors found in the process of using the SENSR method to detect RNA that the pre-mixed SENSR components at room temperature had significant non-specific amplification before adding the RNA components, and necessary measures must be taken, such as pre-hybridization of RNA samples and probes before 37°C detection to eliminate or reduce non-specific reactions. Although the improved SENSR method can detect positive samples, there is still a problem of high background detection signal when blank samples are loaded, and the real-time detection signal will be improved to a certain extent. At the same time, the signal difference between blank samples and low-copy positive samples is not significant, which affects the sensitivity of the detection. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide a reagent for detecting nucleic acid.

[0006] The second aspect of the present invention aims to provide the use of the above reagent in the preparation of products for detecting nucleic acids.

[0007] The third aspect of the present invention aims to provide a kit comprising the reagent of the first aspect of the present invention.

[0008] The purpose of the fourth aspect of the present invention is to provide the use of the reagent of the first aspect of the present invention and / or the kit of the third aspect of the present invention in nucleic acid detection.

[0009] The purpose of the fifth aspect of the present invention is to provide a nucleic acid detection method for non-diagnostic purposes.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides a reagent for detecting nucleic acid, comprising: a probe pair for detecting a target nucleic acid and crRNA;

[0012] The probe pair comprises a promoter probe and a reporter probe;

[0013] The promoter probe comprises an upstream hybridization sequence (UHS) and a T7 promoter sequence;

[0014] The reporter probe comprises a downstream hybridization sequence (DHS) and a universal sequence;

[0015] The crRNA comprises an anchor sequence and a spacer sequence;

[0016] The upstream hybridization sequence is complementary to a partial sequence of the target nucleic acid;

[0017] The downstream hybridization sequence is complementary to the remaining sequence of the target nucleic acid;

[0018] The universal sequence is identical to the spacer sequence, so that it can be recognized by crRNA;

[0019] The anchor sequence is specifically recognized by the Cas protein.

[0020] Preferably, the 5' end of the promoter probe contains a phosphate group.

[0021] Preferably, the promoter probe includes an upstream hybridization sequence (UHS) and a T7 promoter sequence from the 5' end to the 3' end.

[0022] Preferably, the reporter probe comprises a universal sequence and a downstream hybridization sequence (DHS) in sequence from the 5' to the 3' end.

[0023] Preferably, the crRNA includes an anchor sequence and a spacer sequence from the 5' end to the 3' end; or a spacer sequence and an anchor sequence.

[0024] Preferably, the T7 promoter sequence is a T7 promoter sequence with a stem-loop structure.

[0025] Preferably, the T7 promoter sequence is shown as positions 25 to 86 of SEQ ID NO.2.

[0026] Preferably, the upstream hybridization sequence has 18 to 24 bases; further preferably, 19 to 24 bases.

[0027] Preferably, the upstream hybridization sequence is complementary to the 5' end of the target nucleic acid, and the downstream hybridization sequence is complementary to the 3' end of the target nucleic acid; or

[0028] The upstream hybridization sequence is complementary to the 3' end of the target nucleic acid, and the downstream hybridization sequence is complementary to the 5' end of the target nucleic acid.

[0029] Preferably, the target nucleic acid is RNA.

[0030] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.1, the upstream hybridization sequence is as shown in positions 1 to 24 of SEQ ID NO.2; and the downstream hybridization sequence is as shown in positions 31 to 48 of SEQ ID NO.4.

[0031] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.6, the upstream hybridization sequence is as shown in positions 1 to 19 of SEQ ID NO.7; and the downstream hybridization sequence is as shown in positions 31 to 50 of SEQ ID NO.8.

[0032] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the upstream hybridization sequence is as shown in positions 1 to 20 of SEQ ID NO.11; and the downstream hybridization sequence is as shown in positions 31 to 50 of SEQ ID NO.13.

[0033] Preferably, the universal sequence is not homologous or complementary to the upstream hybridizing sequence and the downstream hybridizing sequence.

[0034] Preferably, the universal sequence has 26 to 34 bases; further preferably, 26 to 30 bases.

[0035] Preferably, the universal sequence is as shown in positions 1 to 30 of SEQ ID NO.4, or as shown in positions 1 to 30 of SEQ ID NO.13.

[0036] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.1 or SEQ ID NO.6, the universal sequence is as shown in positions 1 to 30 of SEQ ID NO.4.

[0037] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the universal sequence is as shown in positions 1 to 30 of SEQ ID NO.13.

[0038] Preferably, the Cas protein is at least one of LwaCas13a, PsmCas13b, and CcaCas13b; further, at least one of LwaCas13a and PsmCas13b.

[0039] Preferably, when the Cas protein is LwaCas13a, the anchor sequence is shown in positions 1 to 35 of SEQ ID NO.5.

[0040] Preferably, when the Cas protein is PsmCas13b, the anchor sequence is shown at positions 31 to 66 of SEQ ID NO.14.

[0041] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.1 or SEQ ID NO.6, the anchor sequence is as shown in positions 1 to 35 of SEQ ID NO.5.

[0042] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the anchor sequence is as shown in positions 31 to 66 of SEQ ID NO.14.

[0043] Preferably, the spacer sequence needs to replace T in the universal sequence with U.

[0044] Preferably, the number of the target nucleic acid is greater than or equal to 1.

[0045] Preferably, when the number of the target nucleic acid is greater than or equal to 2, the reagent comprises: N groups of probe pairs for detecting nucleic acid and crRNA, where N is equal to the number of the target nucleic acid.

[0046] Preferably, when the number of the target nucleic acids is greater than or equal to 2, the universal sequences in the reporter probes of the probe pairs of different target nucleic acids are different.

[0047] Preferably, when the number of target nucleic acids is greater than or equal to 2, the anchor sequences of crRNAs of different target nucleic acids are different.

[0048] Preferably, when the target nucleic acid comprises: a nucleic acid with a sequence as shown in SEQ ID NO.6 and a nucleic acid with a sequence as shown in SEQ ID NO.10, the reagent comprises a probe pair and crRNA for detecting the target nucleic acid with a sequence as shown in SEQ ID NO.6, and a probe pair and crRNA for detecting the target nucleic acid with a sequence as shown in SEQ ID NO.10,

[0049] The probe pair for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.6 comprises a promoter probe and a reporter probe for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.6;

[0050] The upstream hybridization sequence of the promoter probe of the target nucleic acid of the detection sequence as shown in SEQ ID NO.6 is shown in positions 1 to 19 of SEQ ID NO.7; the downstream hybridization sequence of the reporter probe of the target nucleic acid of the detection sequence as shown in SEQ ID NO.6 is shown in positions 31 to 50 of SEQ ID NO.8; the universal sequence of the reporter probe of the target nucleic acid of the detection sequence as shown in SEQ ID NO.6 is shown in positions 1 to 30 of SEQ ID NO.4;

[0051] The detection sequence is shown in SEQ ID NO.6, and the anchor sequence of the crRNA of the target nucleic acid is shown in positions 1 to 35 of SEQ ID NO.5;

[0052] The probe pair for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.10 comprises a promoter probe and a reporter probe for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.10;

[0053] The upstream hybridization sequence of the promoter probe of the target nucleic acid of the detection sequence as shown in SEQ ID NO.10 is shown in the 1st to 20th positions of SEQ ID NO.11; the downstream hybridization sequence of the reporter probe of the target nucleic acid of the detection sequence as shown in SEQ ID NO.10 is shown in the 31st to 50th positions of SEQ ID NO.13; the universal sequence of the reporter probe of the target nucleic acid of the detection sequence as shown in SEQ ID NO.10 is shown in the 1st to 30th positions of SEQ ID NO.13;

[0054] The detection sequence is shown in SEQ ID NO.10, and the anchor sequence of the crRNA of the target nucleic acid is shown in positions 31 to 66 of SEQ ID NO.14.

[0055] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.1, the sequence of the promoter probe is as shown in SEQ ID NO.2; the sequence of the reporter probe is as shown in SEQ ID NO.4; and the sequence of the CrRNA is as shown in SEQ ID NO.5.

[0056] Preferably, when the sequence of the target nucleic acid is shown as SEQ ID NO.6, the sequence of the promoter probe is shown as SEQ ID NO.7; the sequence of the reporter probe is shown as SEQ ID NO.8; and the sequence of the CrRNA is shown as SEQ ID NO.5.

[0057] Preferably, when the sequence of the target nucleic acid is shown as SEQ ID NO.10, the sequence of the promoter probe is shown as SEQ ID NO.11; the sequence of the reporter probe is shown as SEQ ID NO.13; and the sequence of the CrRNA is shown as SEQ ID NO.14.

[0058] Preferably, when the target nucleic acid comprises: a nucleic acid with a sequence as shown in SEQ ID NO.6 and a nucleic acid with a sequence as shown in SEQ ID NO.10, the reagent comprises a probe pair and crRNA for detecting the target nucleic acid with a sequence as shown in SEQ ID NO.6, and a probe pair and crRNA for detecting the target nucleic acid with a sequence as shown in SEQ ID NO.10,

[0059] The probe pair for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.6 comprises a promoter probe and a reporter probe for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.6;

[0060] The sequence of the promoter probe of the target nucleic acid whose detection sequence is shown in SEQ ID NO.6 is shown in SEQ ID NO.7;

[0061] The sequence of the reporter probe for the target nucleic acid whose detection sequence is shown in SEQ ID NO.6 is shown in SEQ ID NO.8;

[0062] The detection sequence is shown in SEQ ID NO.6, and the sequence of the crRNA of the target nucleic acid is shown in SEQ ID NO.5;

[0063] The probe pair for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.10 comprises a promoter probe and a reporter probe for detecting the target nucleic acid whose sequence is shown in SEQ ID NO.10;

[0064] The sequence of the promoter probe of the target nucleic acid whose detection sequence is shown in SEQ ID NO.10 is shown in SEQ ID NO.11;

[0065] The sequence of the reporter probe for the target nucleic acid whose detection sequence is shown in SEQ ID NO.10 is shown in SEQ ID NO.13;

[0066] The detection sequence is shown in SEQ ID NO.10, and the sequence of the crRNA of the target nucleic acid is shown in SEQ ID NO.14.

[0067] The second aspect of the present invention provides use of the reagent of the first aspect of the present invention in preparing a product for detecting nucleic acid.

[0068] Preferably, the nucleic acid is RNA.

[0069] Preferably, the product is a reagent, a test kit, a test paper or a chip.

[0070] The third aspect of the present invention provides a kit comprising the reagent of the first aspect.

[0071] Preferably, the kit further comprises a signal reporter probe and the Cas protein in the first aspect of the present invention.

[0072] Preferably, the signal reporter probe comprises a nucleic acid sequence, the 5' end of the nucleic acid sequence is labeled with a fluorescent reporter group, and the 3' end of the nucleic acid sequence is labeled with a quencher group.

[0073] Preferably, the fluorescent reporter group is any one of FAM, HEX, ROX, CY5, VIC, JOE, and TAMRA.

[0074] Preferably, the quenching group is at least one of BHQ1 and BHQ2.

[0075] Preferably, the nucleic acid sequence of the signal reporter probe is AAAAA or UUUUU.

[0076] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.1 or SEQ ID NO.6, the Cas protein is LwaCas13a.

[0077] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.1 or SEQ ID NO.6, the signal reporter probe is FAM-5'UUUUU-3'BHQ1.

[0078] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the Cas protein is PsmCas13b.

[0079] Preferably, when the sequence of the target nucleic acid is as shown in SEQ ID NO. 10, the signal reporter probe is HEX-5'AAAAA-3'BHQ1.

[0080] Preferably, when the number of the target nucleic acid is greater than or equal to 2, the Cas protein comprises N types of Cas proteins, the N types of Cas proteins are different from each other, and N is equal to the number of the target nucleic acid.

[0081] Preferably, when the number of the target nucleic acid is greater than or equal to 2, the signal reporter probe comprises N signal reporter probes, the sequences and fluorescent reporter groups of the N signal reporter probes are different from each other, and N is equal to the number of the target nucleic acid.

[0082] Preferably, when the target nucleic acid comprises: a nucleic acid having a sequence as shown in SEQ ID NO.6 and a nucleic acid having a sequence as shown in SEQ ID NO.10, the Cas protein comprises LwaCas13a and PsmCas13b.

[0083] Preferably, when the target nucleic acid comprises: a nucleic acid having a sequence as shown in SEQ ID NO.6 and a nucleic acid having a sequence as shown in SEQ ID NO.10, the signal reporter probe comprises FAM-5'UUUUU-3'BHQ1 (for detecting a nucleic acid having a sequence as shown in SEQ ID NO.6) and HEX-5'AAAAA-3'BHQ1 (for detecting a nucleic acid having a sequence as shown in SEQ ID NO.10).

[0084] Preferably, the kit further comprises SENSR buffer, ET-SSB, T7 RNA polymerase, RNase inhibitor, NTPs and SplintR ligase.

[0085] Preferably, the kit further comprises water.

[0086] Preferably, the water is RNase-free purified water.

[0087] The fourth aspect of the present invention provides use of the reagent of the first aspect and / or the kit of the third aspect in nucleic acid detection for non-diagnostic purposes.

[0088] Preferably, the nucleic acid is RNA.

[0089] The fifth aspect of the present invention provides a method for detecting nucleic acid for non-diagnostic purposes, comprising the steps of using the reagent of the first aspect of the present invention and / or the kit of the third aspect of the present invention.

[0090] The nucleic acid detection method comprises the following steps:

[0091] Mixing the promoter probe, the reporter probe and the SENSR buffer in the kit of the third aspect of the present invention to obtain a hybridization solution;

[0092] Mix water, NTPs, SENSR buffer, ET-SSB, T7 RNA polymerase, RNAse inhibitor, NTPs, SplintR ligase, Cas protein, signal reporter probe, and CrRNA in the kit of the third aspect of the present invention to obtain a detection solution;

[0093] Mixing the nucleic acid to be tested with the hybridization solution, incubating, and obtaining a mixed solution;

[0094] The mixed solution is mixed with the detection solution for reaction and detection.

[0095] Preferably, the incubation condition is 50-60° C. for 2-8 min; further, 55° C. for 5 min.

[0096] Preferably, the temperature of the detection solution before mixing with the mixed solution is 35-39°C.

[0097] Preferably, the reaction is carried out at 35-39° C. for 30-60 min.

[0098] The beneficial effects of the present invention are:

[0099] The present invention provides a reagent for detecting nucleic acid, comprising: a probe pair for detecting a target nucleic acid and crRNA; the probe pair comprises a promoter probe and a reporter probe; the promoter probe comprises an upstream hybridization sequence (UHS) and a T7 promoter sequence; the reporter probe comprises a downstream hybridization sequence (DHS) and a universal sequence; the crRNA comprises an anchor sequence and a spacer sequence; the upstream hybridization sequence is complementary to a partial sequence of the target nucleic acid; the downstream hybridization sequence is complementary to the remaining sequence of the target nucleic acid; the universal sequence is identical to the spacer sequence, so that it can be recognized by crRNA; the anchor sequence is specifically recognized by a Cas protein; the reagent detects nucleic acid based on SENSR and CRISPR technologies, By replacing the dye-bound RNA aptamer template sequence of the reporter probe in the existing SENSR with a universal sequence recognized by crRNA, the Cas protein, under the guidance of crRNA, recognizes the target sequence (i.e., the RNA sequence complementary to the universal sequence template after transcription), stimulates the Cas protein with para-cleavage activity, and generates a detection signal by cutting a specific reporter probe; and, compared with the SENSR method and the improved SENSR method, after using this reagent, there is no significant amplification signal in the blank or negative control, but a significant signal can be obtained after the target nucleic acid with a lower copy number is loaded, so that a highly sensitive one-pot detection of the target nucleic acid can be achieved, that is, the reagent greatly improves the sensitivity of nucleic acid detection; at the same time, the reagent can detect two or more target nucleic acids at the same time. DETAILED DESCRIPTION

[0100] The present invention is further described in detail below through specific examples.

[0101] Unless otherwise specified, the materials and reagents used in this example were obtained from commercial sources.

[0102] The malachite green reagent in the following examples was from SIGMA-ALDRICH, and NTPs, RNase inhibitor, single-strand binding protein ET-SSB, SplintR ligase and T7 RNA polymerase were all from NEB.

[0103] Example 1 Synthesis of probe pairs and crRNA for detecting SARS-COV-2 RNA-dependent RNA polymerase (RdRp) genes

[0104] Guangzhou Bolais Biotechnology Co., Ltd. was commissioned to synthesize the SplintR ligase upstream and downstream probe pairs (promoter probe and reporter probe) for detecting the RdRp target gene fragment and the corresponding detection CrRNA, wherein the promoter probe is MG-PP1 in Table 1, the reporter probe is G-RP1 in Table 1, and the CrRNA is the CrRNA in Table 2.

[0105] Table 1 SplintR ligase upstream and downstream probe sequences targeting SARS-CoV-2 RdRp target sequence

[0106]

[0107]

[0108] *Note: Tm value is based on http: / / www.bio-toyobo.cn / file / tmcal.html Calculation using the online calculation tool provided;

[0109] Document 1 is Sensitive fluorescence detection of SARS-CoV-2RNA in clinicalsamples via one-pot isothermal ligation and transcription. NatBiomedEng.2020Dec; 4(12):1168-1179.doi:10.1038 / s41551-020-00617-5.

[0110] Table 2 R1fL (Reporter 1 for LwaCas13a) CrRNA sequence that recognizes universal sequence 1 in reporter probe

[0111]

[0112] Example 2 Synthesis of probe pairs and CrRNA for detecting SARS-COV-2ORF1ab gene

[0113] 1. Sequence design:

[0114] Determine the conserved region (70 nt length) of the SARS-COV-2ORF1ab gene and design UHS and DHS. Use Primer-BLAST software (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) to design the UHS of the promoter probe and the DHS of the reporter probe:

[0115] a. PCR product length parameters: 40-60 bps to find best candidate sites that ensure specific binding of both probes which are 20-30-nt long and adjacent to each other;

[0116] b. Primer pair specificity checking parameter Database: Refseq mRNA, Organism: Homo sapiens;

[0117] c. Other parameters are unchanged from their default values.

[0118] According to the above parameters, 10 pairs of candidate primers were screened, and the closest primer pairs (the smallest interval between primers or the smallest cross-overlapping fragments) were selected. The fragment sequences were adjusted so that the corresponding UHS primer sequence and DHS primer sequence were adjacent (the 5' end of the UHS was adjacent to the 3' end of the DHS sequence), and the Tm value of the primers was between 58 and 66°C and the Tm difference between primers did not exceed 2.

[0119] According to the above steps, the UHS sequence of the promoter probe and the DHS sequence of the reporter probe designed for SARS-COV-2ORF1ab were obtained. Guangzhou Bolais Biotechnology Co., Ltd. was commissioned to synthesize the SplintR ligase upstream and downstream probe pairs (promoter probe and reporter probe) for detecting the ORF1ab target gene fragment and the corresponding detection CrRNA, wherein the promoter probe is UHS-O1 in Table 3, the reporter probe is DHS-O1 in Table 3, and the CrRNA is the CrRNA in Table 2.

[0120] Table 3 SplintR ligase upstream and downstream probe sequences targeting SARS-CoV-2 ORF1ab target sequence

[0121]

[0122] *Note: Tm value is based on http: / / www.bio-toyobo.cn / file / tmcal.html Calculation is done using the online calculation tool provided.

[0123] Example 3 Synthesis of probe pairs and CrRNA for detecting influenza A virus HA gene

[0124] Guangzhou Bolais Biotechnology Co., Ltd. was commissioned to synthesize the SplintR ligase upstream and downstream probe pairs (promoter probe and reporter probe) for detecting the HA target gene fragment and the corresponding detection CrRNA, wherein the promoter probe is MG-PP in Table 4, the reporter probe is G-RP2 in Table 4, and the CrRNA is the CrRNA in Table 5.

[0125] Table 4 SplintR ligase upstream and downstream probe sequences for Influenza A HA gene target sequence

[0126]

[0127]

[0128] *Note: Tm value is based on http: / / www.bio-toyobo.cn / file / tmcal.html Calculation is done using the online calculation tool provided.

[0129] Table 5 R2fP (Reporter 2for PsmCas13b) CrRNA sequence that recognizes universal sequence 2 in reporter probe

[0130]

[0131] Comparative Example 1 Synthesis of probe pairs for detecting SARS-COV-2 RNA-dependent RNA polymerase (RdRp) genes

[0132] According to the sequence provided in Document 1, Guangzhou Bolais Biotechnology Co., Ltd. was commissioned to synthesize a SplintR ligase upstream and downstream probe pair (promoter probe and reporter probe) for detecting the RdRp target gene fragment, wherein the promoter probe is MG-PP1 in Table 1 and the reporter probe is MG-RP1 in Table 1.

[0133] Comparative Example 2 Synthesis of probe pairs for detecting SARS-COV-2ORF1ab gene

[0134] Guangzhou Bolais Biotechnology Co., Ltd. was commissioned to synthesize a SplintR ligase upstream and downstream probe pair (promoter probe and reporter probe) for detecting the ORF1ab target gene fragment, wherein the promoter probe is UHS-O1 in Table 3, and the reporter probe is DHS-O1MG in Table 3.

[0135] Comparative Example 3 Synthesis of probe pairs for detecting the HA gene of influenza A virus

[0136] Guangzhou Bolais Biotechnology Co., Ltd. was commissioned to synthesize a SplintR ligase upstream and downstream probe pair (promoter probe and reporter probe) for detecting the HA target gene fragment, wherein the promoter probe is MG-PP in Table 4 and the reporter probe is MG-RP in Table 4.

[0137] Effect Example 1 Detection of SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene

[0138] 1. Gene Synthesis

[0139] Guangzhou Aiki Biotechnology Co., Ltd. was commissioned to synthesize the RdRp gene fragment according to the information in Document 1 and subclone it into the SmaI site of the pGSI plasmid; wherein the synthesized RdRp gene fragment is as follows: ATAGGGAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAGTATGTCCGCAATTTAC (SEQ ID NO.15).

[0140] 2. In vitro RNA transcription synthesis

[0141] High-fidelity PCR reaction was performed using the synthesized plasmid as a template. The kit was 2×Hieff CanaceGold Plus Super-Fidelity PCR Master Mix from Shanghai Yisheng. The operation was carried out according to the instructions. The reaction conditions were: 94℃5mins; 55℃30s, 72℃30s, 40cycles; 72℃5mins. The primer sequences are as follows:

[0142] PCR upstream primer sequence: GAAATTAATACGACTCACTATAGGG ACGTGTTGTAGCTTGTCACAC (SEQ ID NO. 16) (the underlined part is the T7 promoter sequence);

[0143] PCR downstream primer sequence: GTAAATTGCGGACATACTATCGG (SEQ ID NO. 17).

[0144] use Gel Extraction Kit was used to purify the amplified PCR target band according to its instructions. The purified target band was dissolved in RNase-free H2O and the volume was adjusted to 1μg / μL, which was used as a template for in vitro transcription by T7 RNA polymerase.

[0145] In vitro transcription was also performed using the T7 in vitro transcription kit from Shanghai Yisheng according to its instructions. The reaction system and reaction procedure are shown in Table 6.

[0146] Table 6 Transcription system and procedure

[0147]

[0148] After the transcription reaction is completed, add 1 μL DNaseⅠ (RNase-free) to each tube, mix well, centrifuge briefly, and incubate at 37°C for 30 minutes to remove the template DNA. RNA purification: The RNA obtained by transcription (after removing the template DNA) is purified using RNA Cleaner magnetic beads (Shanghai Yisheng Cat. No: 12602). The purified RNA is qualified by electrophoresis detection, and after quantification by ultraviolet detection, it is diluted to about 1000 copies / uL with DEPC water, and stored in aliquots at -80°C for later use.

[0149] 3. Detection of SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene

[0150] The SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene was detected by using the probe pair and CrRNA of Example 1, the probe pair of Comparative Example 1 by the SENSR method, and the probe pair of Comparative Example 1 by the improved SENSR method, as follows:

[0151] The steps of using the probe pair of Comparative Example 1 to detect the SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene by the SENSR method are as follows: add the following components in sequence: 53.72 μL of RNase-free purified water, 10 μL of SENSR buffer (500 mM Tris-HCl, 100 mM MgCl2, pH 7.4), 10 μL of NTPs (25 uM per component), 5 μL of malachite green (320 μM), 2 μL of promoter probe MG-PP1 (10 μM), 2.2 μL of reporter probe MG-RP1 (10 μM), 0.5 μL of RNase inhibitor (40 U / μL), 0.8 μL of ET-SSB (extremely high thermal stable single-stranded binding protein, 500 ng / μL), 10 μL of SplintR ligase (25 U / μL), and 10 μL of T7 5 μL of RNA polymerase (50 U / μL) and 0.78 μL of RNA synthesized in step 2 (0, 10, 100, 1000 copies / μL). The above components were mixed and incubated at 37°C for 1 hour. 20 μL of samples were taken at the reaction zero point, 30 minutes, and 1 hour after the reaction for fluorescence detection (ex (excitation wavelength): 616 nm / em (emission wavelength): 665 nm).

[0152] The steps of using the probe pair of Comparative Example 1 to detect the SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene by the improved SENSR method are as follows: mix the following components: SENSR buffer (500mM Tris-HCl, 100mMMgCl2, pH 7.4) 6μL, promoter probe MG-PP1 (10μM) 12μL, reporter probe MG-RP1 (10μM) 12μL, obtain hybridization solution, and store at -20°C for use; mix the following components: 53.72μL of RNase-free purified water, 10μL of NTPs (25uM per component), 5μL of malachite green (320μM), 0.5μL of RNase inhibitor (40U / μL), 0.8μL of ET-SSB (500ng / μL), 10μL of SplintR ligase (25U / μL), and 10μL of T7 5 μL of RNA polymerase (50U / μL) and 9 μL of SENSR buffer (500mM Tris-HCl, 100mMMgCl2, pH 7.4) were added to obtain the detection solution, which was stored at -20℃ for future use; 15 μL of RNA sample (300 copies / μL, 30 copies / μL, 3 copies / μL and 0 copies / μL, respectively) was added to 30uL of hybridization solution and mixed, and the obtained mixed solution was incubated at 55℃ for 5min, and 10uL of the mixed solution was added to the detection solution tube (94.02μL) preheated to 37℃ for reaction; 20uL of samples were taken at the reaction zero point, 30mins after reaction, and 1h after reaction, respectively, and placed in a 384-well flat-bottom black microplate for detection using a TECAN SPARK fluorescence detector (excitation wavelength: 616nm / emission wavelength: 665nm).

[0153] The steps of using the probe pair and crRNA of Example 1 to detect the SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene are as follows: Mix the following components: SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH7.4) 6μL, promoter probe MG-PP1 (10μM) 12μL, reporter probe G-RP1 (10μM) 12μL, to obtain hybridization solution, -20 ℃ storage for later use; the following components were mixed: RNase-free purified water 50.5μL, NTPs (25uM each component) 10μL, RNase inhibitor (40U / μL) 0.5μL, ET-SSB (500ng / μL) 0.8μL, LwaCas13aReporter (FAM-5'-UUUUU-3'BHQ1, 10μM) 5μL, LwaCas13a (Swiss-Prot: U2PSH1.1, 2mg / mL) 2.5μL, CrRNA (1.25uM) 1.25μL, SplintR ligase (25U / μL) 10μL, T7 5 μL of RNA polymerase (50U / μL) and 9 μL of SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) were added to obtain the detection solution, which was stored at -20°C for future use; 15 μL of RNA sample (300 copies / μL, 30 copies / μL, 3 copies / μL and 0 copies / μL, respectively) was added to 30uL of hybridization solution and mixed, and the obtained mixed solution was incubated at 55°C for 5 min. 10uL of the mixed solution was added to the detection solution tube (94.55μL) that had been preheated to 37°C, mixed, and placed in a POCT device (Delix, Guangzhou) for detecting the FAM channel for reaction and detection at 37°C.

[0154] The results of detecting the SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene using the probe pair and crRNA of Example 1, the probe pair of Comparative Example 1 by the SENSR method, and the probe pair of Comparative Example 1 by the improved SENSR method are shown in Tables 7, 8, and 9: As can be seen from the results of Table 7, the SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene was detected by the SENSR method using the probe pair of Comparative Example 1. There was no significant difference in the change in fluorescence intensity over time between the blank sample and the positive sample, indicating that the SENSR detection method in which the detection components including the promoter probe and the reporter probe were mixed together at room temperature to form a detection solution was not feasible. Therefore, this method will no longer be used for SENSR in the future; As can be seen from the results of Table 8, the SARS-COV-2 RNA-dependent RNA polymerase ( The RdRp) gene has a better effect than the unmodified SENSR method. When 100 copies are present, a positive signal can be identified by the ΔRn value in 30 minutes; when 1000 copies are present, a positive signal can be identified by the ΔRn value or the Rn value in 30 minutes; but the blank Rn value and the ΔRn value still have a large growth trend; in addition, when the number of loaded copies is lower (10 copies), the Rn value or the ΔRn is no different from the blank; and when the probe pair and crRNA of Example 1 are used to detect the SARS-COV-2 RNA-dependent RNA polymerase (RdRp) gene, the growth rate of the Rn value and the ΔRn value of the blank sample over time is low, and the detection results of different copy numbers are basically in a dose-effect relationship. When 100 copies are present, it can be judged as positive by Rn or ΔRn within 30 minutes, and when 10 copies are present, it can be judged as positive by ΔRn within 1 hour; it can be seen that the sensitivity of the probe pair and crRNA detection in Example 1 is higher.

[0155] Table 7 Detection results of SARS-CoV-2RdRf gene by SENSR method using probe pair of comparative example 1

[0156]

[0157] Table 8 Detection results of SARS-CoV-2RdRf gene using the probe pair of Comparative Example 1 by the improved SENSR method

[0158]

[0159] Note: * indicates that the sample detection value is more than twice the blank group detection value in the same period, which is judged as a positive signal.

[0160] Table 9 Detection results of SARS-CoV-2RdRf gene using probe pairs and CrRNA of Example 1

[0161]

[0162] Note: * indicates that the sample detection value is more than twice the blank group detection value in the same period, which is judged as a positive signal.

[0163] Effect Example 2 Detection of SARS-COV-2 ORF1ab Gene

[0164] The probe pair and crRNA of Example 2 and the probe pair of Comparative Example 2 were respectively used to detect the SARS-COV-2ORF1ab gene by the improved SENSR method, as follows:

[0165] The steps of using the probe pair of Comparative Example 2 to detect the SARS-COV-2ORF1ab gene by the improved SENSR method are as follows: Take a pseudovirus sample (MS bacteriophage pseudovirus sample (containing 2019-nCoV ORF1ab+E+N gene positive-strand RNA, the MS bacteriophage pseudovirus sample is from Guangzhou Bondeson Company, with the genome copy number information per milliliter of sample liquid attached, item number: BDS-IQC-276) and dilute it with virus preservation solution (Universal Transport Medium, UTM, purchased from Shandong Anpu Future Biotechnology Co., Ltd.) to a genome copy number of 1 copy / μL, 5 copies / μL and 20 copies / μL, respectively, and the blank sample is prepared by 9-fold dilution of physiological saline with UTM; Mix the following components: SENSR buffer (500mM Tris-HCl, 100mMMgCl2, pH 7.4) 6μL, promoter probe UHS-O1 (10μM) 12μL, reporter probe DHS-O1MG (10μM) 12μL, to obtain hybridization solution, stored at -20℃ for later use; the following components were mixed: 53.72μL of RNase-free purified water, 10μL of NTPs (25uM each component), 5μL of malachite green (320μM), 0.5μL of RNase inhibitor (40U / μL), 0.8μL of ET-SSB (500ng / μL), 10μL of SplintR ligase (25U / μL), 5μL of T7 RNA polymerase (50U / μL), SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 9μL to obtain the detection solution, which was stored at -20℃ for future use; 15μL of pseudovirus samples with different copy numbers (1 copy / μL, 5 copies / μL and 20 copies / μL) / blank samples were taken respectively, and incubated at 95℃ for 5mins; then mixed with twice the volume of hybridization solution, and the obtained mixed solution was incubated at 55℃ for 5min, and 10uL of the mixed solution was added to the detection solution tube (94.02μL) preheated to 37℃ for reaction; 20uL of samples were taken at the reaction zero point, 30mins after reaction, and 1h after reaction, respectively, and placed in a 384-well flat-bottom black microplate for detection using a TECAN SPARK fluorescence detector (excitation wavelength: 616nm / emission wavelength: 665nm).

[0166] The steps of detecting the SARS-COV-2ORF1ab gene using the probe pair and CrRNA of Example 2 are as follows: Take a pseudovirus sample (MS bacteriophage pseudovirus sample (containing 2019-nCoV ORF1ab+E+N gene positive-strand RNA, MS bacteriophage pseudovirus sample is from Guangzhou Bondeson Company, with the genome copy number information per milliliter of sample solution, item number: BDS-IQC-276) and dilute it with virus preservation solution (Universal Transport Medium, UTM, purchased from Shandong Anpu Future Biotechnology Co., Ltd.) to a genome copy number of 1 copy / μL, 5 copies / μL and 20 copies / μL, respectively, and the blank sample is prepared by 9-fold dilution of physiological saline with UTM; Mix the following components: SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 6μL, promoter probe UHS-O1 (10μM) 12μL, reporter probe DHS-O1 (10μM) 12μL, to obtain hybridization solution, -20 ℃ storage for later use; the following components were mixed: RNase-free purified water 50.5μL, NTPs (25uM each component) 10μL, RNase inhibitor (40U / μL) 0.5μL, ET-SSB (500ng / μL) 0.8μL, LwaCas13aReporter (FAM-5'UUUUU-3'BHQ1, 10uM) 5μL, LwaCas13a (2mg / mL) 2.5μL, CrRNA (1.25uM) 1.25μL, SplintR ligase (25U / μL) 10μL, T7 RNA polymerase (50U / μL) 5μL, SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 9μL to obtain the detection solution, which was stored at -20℃ for future use; 15μL of pseudovirus samples with different copy numbers (1 copy / μL, 5 copies / μL and 20 copies / μL) / blank samples were taken respectively and incubated at 95℃ for 5mins; then mixed with twice the volume of hybridization solution, the obtained mixed solution was incubated at 55℃ for 5min, 10uL of the mixed solution was added to the detection solution tube (94.55μL) preheated at 37℃, mixed, and placed in a POCT device (Delix, Guangzhou) for detecting FAM channel for reaction and detection at 37℃.

[0167] The results of detecting the SARS-COV-2ORF1ab gene by the improved SENSR method using the probe pair and CrRNA of Example 2 and the probe pair of Comparative Example 2 are shown in Tables 10 and 11: It can be seen from the results in Table 10 that in the process of detecting the SARS-COV-2ORF1ab gene using the probe pair and CrRNA of Example 2, the growth rate of the blank Rn value and the ΔRn value over time is low, and the detection results of different copy numbers are basically dose-effective. The average Rn value and the average ΔRn value of the 25-copy and 100-copy samples are more than 2 times that of the blank when detected for 30 minutes, and it can be judged as positive at this time; while the 5-copy sample is At 60 minutes, the average ΔRn value is twice that of the blank sample, which can be judged as positive at this time; indicating that the probe pair and CrRNA of Example 2 can detect low-copy positive samples (5 copies) in a shorter time; and it can be seen from Table 11 that in the process of detecting SARS-COV-2ORF1ab gene by the improved SENSR method using the probe pair of Comparative Example 2, the blank sample detection signal increases over time, and the difference with the positive sample is not significant. At 60 minutes, the ΔRn value of the high copy group (100 copies) reaches more than twice that of the blank sample; it can be seen that the sensitivity of detection using the probe pair and CrRNA of Example 2 is higher.

[0168] Table 10 Results of detecting SARS-CoV-2 ORF1ab using the probe pair and CrRNA of Example 2

[0169]

[0170] Note: * indicates that the sample test value is more than twice the blank group test value in the same period.

[0171] Table 11 Results of detecting SARS-CoV-2 ORF1ab using the probe pair of Comparative Example 2 by the improved SENSR method

[0172]

[0173] Note: * indicates that the sample test value is more than twice the blank group test value in the same period.

[0174] Effect Example 3 Detection of HA gene of influenza A virus

[0175] 1. Gene Synthesis

[0176] Guangzhou Aiji Biotechnology Co., Ltd. was commissioned to synthesize the influenza A virus HA gene fragment according to reference 1 and subclone it into the SmaI site of the pGSI plasmid. The synthesized HA gene fragment is as follows: AGCTATAGCAGGTTTTATAGAGGGAGGATGGCAGGGAATGGTAGATGGTTGGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGATACGCTGCAGACAAAGAATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAACTCGATCATTGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGAATTTAATAACTTGGAAAGGAGGATAGAGAATTTAAACAAGCAGATGGAAGACGGA (SEQ ID NO. 18).

[0177] 2. In vitro RNA transcription synthesis

[0178] High-fidelity PCR reaction was performed using the synthesized plasmid as a template. The kit was 2×Hieff CanaceGold Plus Super-Fidelity PCR Master Mix from Shanghai Yisheng. The operation was carried out according to the instructions. The reaction conditions were: 94℃5mins; 55℃30s, 72℃30s, 40cycles; 72℃5mins. The primer sequences are as follows:

[0179] PCR upstream primer sequence: GAAATTAATACGACTCACTATAGGG AGCTATAGCAGGTTTTATAGAGGGA (SEQ ID NO. 19) (the underlined part is the T7 promoter sequence);

[0180] PCR downstream primer sequence: AAGCAGATGGAAGACGGA (SEQ ID NO. 20).

[0181] use Gel Extraction Kit was used to purify the amplified PCR target band according to its instructions. The purified target band was dissolved in RNase-free H2O and the volume was adjusted to 1μg / μL, which was used as a template for in vitro transcription by T7 RNA polymerase.

[0182] In vitro transcription was also performed using the T7 in vitro transcription kit from Shanghai Yisheng according to its instructions. The reaction system and reaction procedure are shown in Table 6. After the transcription reaction was completed, 1 μL DNaseⅠ (RNase-free) was added to each tube, mixed, centrifuged briefly, and incubated at 37°C for 30 mins to remove the template DNA. RNA purification: The RNA obtained by transcription (after removing the template DNA) was purified using RNACleaner magnetic beads (Shanghai Yisheng Cat. No: 12602). The purified RNA was qualified by electrophoresis detection, and after quantification by ultraviolet detection, it was diluted to about 1000 copies / uL with DEPC water, and stored in aliquots at -80°C for later use.

[0183] 3. Detection of influenza A virus HA gene

[0184] The probe pair and crRNA of Example 3 and the probe pair of Comparative Example 3 were respectively used to detect the influenza A virus (Influenza A) HA gene by the improved SENSR method, as follows:

[0185] The steps of using the probe pair of Comparative Example 3 to detect the HA gene of influenza A virus (Influenza A) by the improved SENSR method are as follows: the following components are mixed: SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH7.4) 6μL, promoter probe MG-PP (10μM) 12μL, reporter probe MG-RP (10μM) 12μL, to obtain a hybridization solution, which is stored at -20°C for later use; the following components are mixed: RNase-free purified water 53.72μL, NTPs (25uM per component) 10μL, malachite green (320μM) 5μL, RNase inhibitor (40U / μL) 0.5μL, ET-SSB (500ng / μL) 0.8μL, SplintR ligase (25U / μL) 10μL, T7 RNA polymerase (50U / μL) 5μL, SENSR 9μL of buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) was added to obtain the detection solution, which was stored at -20℃ for future use; 15μL of RNA samples with 0 copies of blank sample, 3 copies / μL, 30 copies / μL and 300 copies / μL were respectively taken and added to 30uL of hybridization solution for mixing, and the obtained mixed solution was incubated at 55℃ for 5min, and then 10uL of the mixed solution was added to the detection solution tube (94.02μL) preheated to 37℃ for reaction; 20uL of samples were taken at the reaction zero point, 30mins after reaction, and 1h after reaction, respectively, and placed in a 384-well flat-bottom black microplate for detection using a TECAN SPARK fluorescence detector (excitation wavelength: 616nm / emission wavelength: 665nm).

[0186] The steps of detecting the HA gene of influenza A virus (Influenza A) using the probe pair and crRNA of Example 3 are as follows: the following components are mixed: SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 6μL, promoter probe MG-PP (10μM) 12μL, reporter probe G-RP2 (10μM) 12μL, hybridization solution is obtained, and stored at -20°C for standby use; the following components are mixed: 50.5μL of RNase-free purified water, 10μL of NTPs (25uM per component), 0.5μL of RNase inhibitor (40U / μL), 0.8μL of ET-SSB (500ng / μL), and PsmCas13b Reporter (HEX-5'-AAAAA3'-BHQ1, 10μM) 5μL, PsmCas13b (2mg / mL) 2.5μL, CrRNA (1.25uM) 1.25μL, SplintR ligase (25U / μL) 10μL, T7 RNA polymerase (50U / μL) 5μL, SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 9 μL to obtain the detection solution, which was stored at -20°C for future use; 15 μL of blank sample with 0 copies, 3 copies / μL, 30 copies / μL and 300 copies / μL of RNA sample were respectively added to 30 uL of hybridization solution and mixed, and the obtained mixed solution was incubated at 55°C for 5 min, and 10 uL of the mixed solution was added to the detection solution tube (94.55 μL) which had been preheated at 37°C, mixed, and placed in the BIORAD CFX96 Realtime PCR detection HEX channel for reaction and detection at 37°C.

[0187] The results of detecting the HA gene of influenza A virus (Influenza A) by the improved SENSR method using the probe pair and crRNA of Example 3 and the probe pair of Comparative Example 3 are shown in Tables 12 and 13: As can be seen from the results in Table 13, the detection of influenza A virus (Influenza A) by the probe pair and crRNA of Example 3 is During the detection of A) HA gene, the blank Rn value and ΔRn value increased at a low rate over time, and the detection results of different copy numbers were basically in a dose-effect relationship. The average Rn value and ΔRn value of 1000 copies of the sample at 30 minutes were more than 2 times different from the blank value, and the average Rn value and ΔRn value of 100 copies of the sample at 60 minutes were more than 2 times different from the blank value. The average ΔRn value of 100 copies of the sample at 30 minutes was more than 2 times different from the blank value, and the average ΔRn value of 10 copies of the sample at 60 minutes was more than 2 times different from the blank value, which can be judged as positive at this time; indicating that the probe pair and CrRNA of Example 3 can detect low-copy positive samples (10 copies) in a shorter time; and as can be seen from Table 12, the probe pair of Comparative Example 3 was used to detect influenza A virus (Influenza During the A) HA gene detection process, the detection signal of the blank sample increased over time, and the difference with the positive sample was not significant. At 60 min, the ΔRn value of the high copy group (100 copies) reached more than 2 times that of the blank sample, and at 60 min, the Rn value of the high copy group (1000 copies) reached more than 2 times that of the blank sample; it can be seen that the sensitivity of the probe pair and CrRNA detection using Example 3 is higher.

[0188] Table 12 Detection results of Influenza A HA gene using the probe pair of Comparative Example 3 by the improved SENSR method

[0189]

[0190]

[0191] Note: * indicates that the sample detection value is more than twice the blank group detection value in the same period, which is judged as a positive signal.

[0192] Table 13 Results of Influenza A HA gene detection using the probe pair and crRNA of Example 3

[0193]

[0194] Note: * indicates that the sample test value is more than twice the blank group test value in the same period.

[0195] Effect Example 4 Detection of SARS-COV-2 ORF1ab gene and influenza A virus (Influenza A) HA gene

[0196] 1. RNA Sample

[0197] In this embodiment, the ORF1ab target RNA is derived from the pseudovirus in Embodiment 2. After the pseudovirus RNA is extracted and purified using a viral nucleic acid extraction kit, the volume is fixed to about 200 copies / μL with DEPC purified water. The HA target RNA is derived from the synthetically purified sample in Embodiment 3, and the volume is fixed to 200 copies / μL with DEPC purified water. The sample can be diluted with DEPC water according to the experimental requirements.

[0198] 2. Detection of SARS-COV-2 ORF1ab gene and influenza A virus HA gene

[0199] The probe pairs and crRNA of Examples 2 and 3, the probe pairs of Comparative Examples 2 and 3 were used to detect the SARS-COV-2ORF1ab gene and the influenza A virus (Influenza A) HA gene by the SENSR method, and the probe pairs of Comparative Examples 2 and 3 were used to detect the SARS-COV-2ORF1ab gene by the improved SENSR method, as follows:

[0200] The steps of using the probe pairs of Comparative Examples 2 and 3 to detect the SARS-COV-2ORF1ab gene and the influenza A virus (Influenza A) HA gene by the SENSR method are as follows: add the following components in sequence: 29.52 μL of RNase-free purified water, 10 μL of SENSR buffer (500 mM Tris-HCl, 100 mM MgCl2, pH 7.4), 10 μL of NTPs (25 uM per component), 5 μL of malachite green (320 μM), 20 μL of DFHBI-1T (320 μM), 2 μL of promoter probe UHS-O1 (10 μM), 2.2 μL of reporter probe DHS-O1MG (10 μM), 2 μL of promoter probe MG-PP (10 μM), 2 μL of reporter probe BR-RP ( gtatgtgggagacggtcgggtccag atattcgtatctgtcgagtagagtgtgggctcccacatacTTTGTCTGCAGCGTATCCAC, SEQ ID NO.21, underlined is the RNA aptamer sequence for malachite green fluorescence detection, 10μM) 2.2μL, RNase inhibitor (40U / μL) 0.5μL, ET-SSB (500ng / μL) 0.8μL, SplintR ligase (25U / μL) 10μL, T7 RNA polymerase (50U / μL) 5μL, RNA (200 copies / μL) 20-fold diluted sample or 2-fold diluted sample 0.78μL in step 1. After mixing the above components, incubate at 37°C for 1h, and sample 20μL at the reaction zero point, 30mins, and 1h after the reaction for dual-channel fluorescence detection (ex: 616nm / em: 665nmfor malachite green; ex: 460nm / em: 520nm for DFHBI-1T).

[0201] The steps of using the probe pairs of Comparative Examples 2 and 3 to detect the SARS-COV-2 ORF1ab gene and the influenza A virus (Influenza A) HA gene by the improved SENSR method are as follows: Mix the following components: SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 6μL, promoter probe UHS-O1 (20μM) 6μL, reporter probe MG-RP1 (20μM) 6μL, promoter probe MG-PP (20μM) 6μL, reporter probe BR-RP (20μM) 6μL, to obtain hybridization solution, which was stored at -20°C for later use; the following components were mixed: 48.72μL of RNase-free purified water, 10μL of NTPs (25uM per component), 5μL of malachite green (320μM), 5μL of DFHBI-1T (320μM), 0.5μL of RNase inhibitor (40U / μL), 0.8μL of ET-SSB (500ng / μL), 10μL of SplintR ligase (25U / μL), 5μL of T7 RNA polymerase (50U / μL), SENSR buffer (500mM 9 μL of Tris-HCl, 100 mM MgCl2, pH 7.4) was added to obtain the detection solution, which was stored at -20°C for future use; 15 μL of blank sample, 15 μL of ORF1ab single positive RNA sample diluted to 3 copies / μL and 30 copies / μL with DEPC water, and 15 μL of HA single positive RNA sample diluted to 3 copies / μL and 30 copies / μL with DEPC water were taken respectively, and 30 uL of hybridization solution was added to mix, and the obtained mixed solution was incubated at 55°C for 5 min, and 10 uL of the mixed solution was added to the detection solution tube (94.02 μL) preheated to 37°C for reaction; 20 uL of samples were taken at the reaction zero point, 30 mins after reaction, and 1 h after reaction, respectively, and placed in a 384-well flat-bottom black microplate for dual-channel fluorescence detection using a TECAN SPARK fluorescence detector (excitation wavelength: 616 nm / emission wavelength: 665 nm; excitation wavelength: 460 nm / emission wavelength: 520 nm).

[0202] The steps of using the probe pairs and crRNA of Examples 2 and 3 to detect the SARS-COV-2ORF1ab gene and the influenza A virus (Influenza A) HA gene are as follows: the following components are mixed: SENSR buffer (500mM Tris-HCl, 100mM MgCl2, pH 7.4) 6μL, promoter probe UHS-O1 (20μM) 6μL, reporter probe MG-RP1 (20μM) 6μL, promoter probe MG-PP (20μM) 6μL, reporter probe BR-RP (20μM) 6μL to obtain a hybridization solution, which is stored at -20°C for standby use; the following components are mixed: 43.75μL of RNase-free purified water, 10μL of NTPs (25uM per component), 0.5μL of RNase inhibitor (40U / μL), 0.8μL of ET-SSB (500ng / μL), and 0.6μL of LwaCas13. aReporter (FAM-5'-UUUUU-3'BHQ1, 10μM) 5μL, LwaCas13a (2mg / mL) 1.5μL, PsmCas13bReporter (HEX-5'-AAAAA-3'-BHQ1, 10μM) 5μL, PsmCas13b (2mg / mL) 1.5μL, CrRNA1 (1.25uM) 1.25μL, CrRNA2 (1.25uM) 1.25μL, SplintR ligase (25U / μL) 10μL, T7 5 μL of RNA polymerase (50U / μL) and 9 μL of SENSR buffer (500mM Tris-HCl, 100mMMgCl2, pH 7.4) were added to obtain the detection solution, which was stored at -20°C for future use; 15 μL of blank sample, 15 μL of ORF1ab single positive RNA sample diluted to 3 copies / μL and 30 copies / μL with DEPC water, and 15 μL of HA single positive RNA sample diluted to 3 copies / μL and 30 copies / μL with DEPC water were taken respectively, and 30uL of hybridization solution was added to mix, and the obtained mixed solution was incubated at 55°C for 5min, and 10uL of the mixed solution was added to the detection solution tube (94.55μL) preheated at 37°C, mixed, and placed in the BIORAD CFX96 Realtime PCR for FAM / HEX dual channel detection at 37°C for reaction and detection.

[0203] The results of detecting SARS-COV-2ORF1ab gene and influenza A virus (Influenza A) HA gene by the probe pairs and crRNA of Examples 2 and 3, by the SENSR method of the probe pairs of Comparative Examples 2 and 3, and by the improved SENSR method of the probe pairs of Comparative Examples 2 and 3 are shown in Tables 14, 15, and 16: As can be seen from the results in Table 14, when the probe pairs of Comparative Examples 2 and 3 were used to detect SARS-COV-2ORF1ab gene and influenza A virus (Influenza A) HA gene by the SENSR method, there was no significant difference in the change in fluorescence intensity over time between the blank sample and the positive sample, indicating that the SENSR detection method in which the detection components including the promoter probe and the reporter probe are mixed together at room temperature to form a detection solution is not feasible; As can be seen from the results in Table 15, when the probe pairs of Comparative Examples 2 and 3 were used to detect SARS-COV-2ORF1ab gene and influenza A virus (Influenza A) HA gene by the improved SENSR method A) HA gene has a better effect than the unmodified SENSR method. When 100 copies are present, the positive signal of HA gene can be identified by ΔRn value in 30min; when 100 copies are present, the positive signal of ORF1ab gene can be identified by ΔRn value in 60min; however, the blank Rn value and ΔRn value still have a large growth trend; in addition, when the number of loaded copies is lower (10 copies), the Rn value or ΔRn is no different from the blank; while the probe pairs and CrRNA of Examples 2 and 3 are used to detect SARS-COV-2 ORF1ab gene and influenza A virus (Influenza A) HA gene, the growth rate of Rn value and ΔRn value of the blank sample over time is low, and the detection results of different copy numbers are basically dose-effective. When 100 copies are present, it can be judged as positive by Rn or ΔRn within 30mins (ORF1ab gene, HA gene), and when 10 copies are present, it can be judged as positive by ΔRn within 1h (ORF1ab gene, HA gene); It can be seen that the sensitivity of the probe pairs and CrRNA detection using Examples 2 and 3 is higher.

[0204] Table 14 Results of dual-channel detection of ORF1ab / HA by SENSR method using probe pairs of comparative examples 2 and 3

[0205]

[0206] Table 15 Results of ORF1ab / HA dual-channel detection using the probe pairs of Comparative Examples 2 and 3 by the improved SENSR method

[0207]

[0208] Note: * indicates that the sample test value is more than twice the blank group test value in the same period.

[0209] Table 16 Results of dual-channel detection of ORF1ab / HA using probe pairs and CrRNA of Examples 2 and 3

[0210]

[0211] Note: * indicates that the sample test value is more than twice the blank group test value in the same period.

[0212] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. SEQUENCE LISTING <110> Guangzhou Baiyunshan Baidi Biopharmaceutical Co., Ltd. <120> A nucleic acid detection reagent, kit and application based on SENSR and CRISPR technology <130> <160> twenty one <170> PatentIn version 3.5 <210> 1 <211> 42 <212> DNA <213> SARS-CoV-2 <400> 1 acuauauguu aaaccaggug gaaccucauc aggagaugcc ac 42 <210> 2 <211> 86 <212> DNA <213> Artificial sequence <400> 2 gttccacctg gtttaacata tagtccctat agtgagtcgt attaatttcg cgacaacacg 60 cgaaattaat acgactcact ataggg 86 <210> 3 <211> 56 <212> DNA <213> Artificial sequence <400> 3 ggatccattc gttacctggc tctcgccagt cgggatccgt ggcatctcct gatgag 56 <210> 4 <211> 48 <212> DNA <213> Artificial Sequence <400> 4 ctaccaagta atccatattt ctagaggatc gtggcatctc ctgatgag 48 <210> 5 <211> 65 <212> DNA <213> Artificial Sequence <400> 5 gauuuagacu accccaaaaa cgaaggggac uaaaacuacc aaguaaucca uauuucuaga 60 ggauc 65 <210> 6 <211> 39 <212> DNA <213> SARS-CoV-2 <400> 6 ugugaucaac uccgcgaacc caugcuucag ucagcugau 39 <210> 7 <211> 81 <212> DNA <213> Artificial Sequence <400> 7 gttcgcggag ttgatcacac cctatagtga gtcgtattaa tttcgcgaca acacgcgaaa 60 ttaatacgac tcactatagg g 81 <210> 8 <211> 50 <212> DNA <213> Artificial Sequence <400> 8 ctaccaagta atccatattt ctagaggatc atcagctgac tgaagcatgg 50 <210> 9 <211> 58 <212> DNA <213> Artificial sequence <400> 9 ggatccattc gttacctggc tctcgccagt cgggatccat cagctgactg aagcatgg 58 <210> 10 <211> 40 <212> DNA <213> Influenza A <400> 10 ccauagcaau gagcagggga guggauacgc ugcagacaaaa 40 <210> 11 <211> 82 <212> DNA <213> Artificial sequence <400> 11 tcccctgctc attgctatgg ccctatagtg agtcgtatta atttcgcgac aacacgcgaa 60 attaatacga ctcactatag gg 82 <210> 12 <211> 58 <212> DNA <213> Artificial sequence <400> 12 ggatccattc gttacctggc tctcgccagt cgggatcctt tgtctgcagc gtatccac 58 <210> 13 <211> 50 <212> DNA <213> Artificial sequence <400> 13 cctggttcat gagcttcctg ccactgccaa tttgtctgca gcgtatccac 50 <210> 14 <211> 66 <212> DNA <213> Artificial sequence <400> 14 ccugguucau gagcuuccug ccacugccaa guuguagaag cuuaucguuu ggauagguau 60 gacaac 66 <210> 15 <211> 255 <212> DNA <213> SARS-COV-2 <400> 15 atagggaaac atacaacgtg ttgtagcttg tcacaccgtt tctatagatt agctaatgag 60 tgtgctcaag tattgagtga aatggtcatg tgtggcggtt cactatatgt taaaccaggt 120 ggaacctcat caggagatgc cacaactgct tatgctaata gtgtttttaa catttgtcaa 180 gctgtcacgg ccaatgttaa tgcactttta tctactgatg gtaacaaaat tgccgatagt 240 atgtccgcaa tttac 255 <210> 16 <211> 46 <212> DNA <213> Artificial sequence <400> 16 gaaattaata cgactcacta tagggacgtg ttgtagcttg tcacac 46 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <400> 17 gtaaattgcg gacatactat cgg 23 <210> 18 <211> 250 <212> DNA <213> Influenza A <400> 18 agctatagca ggttttatag agggaggatg gcagggaatg gtagatggtt ggtatgggta 60 ccaccatagc aatgagcagg ggagtggata cgctgcagac aaagaatcca ctcaaaaggc 120 aatagatgga gtcaccaata aggtcaactc gatcattgac aaaatgaaca ctcagtttga 180 ggccgttgga agggaattta ataacttgga aaggaggata gagaatttaa acaagcagat 240 ggaagacgga 250 <210> 19 <211> 50 <212> DNA <213> Artificial Sequence <400> 19 gaaattaata cgactcacta tagggagcta tagcaggttt tatagaggga 50 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <400> 20 aagcagatgg aagacgga 18 <210> 21 <211> 85 <212> DNA <213> Artificial Sequence <400> 21 gtatgtggga gacggtcggg tccagatatt cgtatctgtc gagtagagtg tgggctccca 60 catactttgt ctgcagcgta tccac 85

Claims

1. A reagent for detecting nucleic acid, comprising: a probe pair for detecting a target nucleic acid and crRNA; The probe pair comprises a promoter probe and a reporter probe; The promoter probe comprises an upstream hybridization sequence and a T7 promoter sequence; The reporter probe comprises a downstream hybridization sequence and a universal sequence; The crRNA comprises an anchor sequence and a spacer sequence; The upstream hybridization sequence is complementary to a partial sequence of the target nucleic acid; The downstream hybridization sequence is complementary to the remaining sequence of the target nucleic acid; The universal sequence is the same as the spacer sequence; The anchor sequence specifically recognizes the Cas protein; When the sequence of the target nucleic acid is as shown in SEQ ID NO.1, the sequence of the promoter probe is as shown in SEQ ID NO.2, the sequence of the reporter probe is as shown in SEQ ID NO.4, and the sequence of the crRNA is as shown in SEQ ID NO.5; When the sequence of the target nucleic acid is as shown in SEQ ID NO.6, the sequence of the promoter probe is as shown in SEQ ID NO.7, the sequence of the reporter probe is as shown in SEQ ID NO.8, and the sequence of the crRNA is as shown in SEQ ID NO.5; When the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the sequence of the promoter probe is as shown in SEQ ID NO.11, the sequence of the reporter probe is as shown in SEQ ID NO.13, and the sequence of the crRNA is as shown in SEQ ID NO.

14.

2. The reagent according to claim 1, characterized in that: When the number of the target nucleic acid is greater than or equal to 2, the reagent comprises: N groups of probe pairs for detecting the target nucleic acid and crRNA, where N is equal to the number of the target nucleic acid.

3. Use of the reagent according to claim 1 or 2 in the preparation of a product for detecting nucleic acid.

4. A kit, characterized in that: Contains the reagent according to claim 1 or 2.

5. The kit according to claim 4, characterized in that: The kit also includes a signal reporter probe and the Cas protein of claim 1 or 2.

6. The kit according to claim 5, characterized in that: The signal reporter probe comprises a nucleic acid sequence, wherein the 5' end of the nucleic acid sequence is labeled with a fluorescent reporter group, and the 3' end of the nucleic acid sequence is labeled with a quencher group.

7. The kit according to claim 6, characterized in that The fluorescent reporter group includes any one of FAM, HEX, ROX, CY5, VIC, JOE, and TAMRA.

8. The kit according to claim 6, characterized in that The quenching group comprises at least one of BHQ1 and BHQ2.

9. The kit according to claim 6, characterized in that The nucleic acid sequence of the signal reporter probe is AAAAA or UUUUU.

10. The kit according to claim 6, characterized in that When the number of the target nucleic acid is greater than or equal to 2, the Cas protein comprises N types of Cas proteins, the N types of Cas proteins are different from each other, and N is equal to the number of the target nucleic acid.

11. The kit according to claim 6, characterized in that The Cas protein comprises at least one of LwaCas13a, PsmCas13b, and CcaCas13b.

12. The kit according to claim 6, characterized in that When the number of the target nucleic acid is greater than or equal to 2, the signal reporter probe comprises N signal reporter probes, the sequences and fluorescent reporter groups of the N signal reporter probes are different from each other, and N is equal to the number of the target nucleic acid.

13. The kit according to claim 11, characterized in that When the sequence of the target nucleic acid is as shown in SEQ ID NO.1 or SEQ ID NO.6, the Cas protein is LwaCas13a; when the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the Cas protein is PsmCas13b.

14. The kit according to claim 12, characterized in that When the sequence of the target nucleic acid is as shown in SEQ ID NO.1 or SEQ ID NO.6, the signal reporter probe is FAM-5'UUUUU-3'BHQ1; when the sequence of the target nucleic acid is as shown in SEQ ID NO.10, the signal reporter probe is HEX-5'AAAAA-3'BHQ1.

15. The kit according to claim 6, characterized in that When the target nucleic acid comprises: a nucleic acid with a sequence as shown in SEQ ID NO.6 and a nucleic acid with a sequence as shown in SEQ ID NO.10, the Cas protein comprises LwaCas13a and PsmCas13b; when the target nucleic acid comprises: a nucleic acid with a sequence as shown in SEQ ID NO.6 and a nucleic acid with a sequence as shown in SEQ ID NO.10, the signal reporter probe comprises FAM-5'UUUUU-3'BHQ1 and HEX-5'AAAAA-3'BHQ1.

16. The kit according to claim 6, characterized in that The kit also contains SENSR buffer, ET-SSB, T7 RNA polymerase, RNase inhibitor, NTPs and SplintR ligase.

17. Use of the reagent according to claim 1 or 2 and / or the kit according to any one of claims 4 to 16 in nucleic acid detection for non-diagnostic purposes.

18. A method for detecting nucleic acid for non-diagnostic purposes, comprising the step of using the reagent of claim 1 or 2 and / or the kit of any one of claims 4 to 16; The nucleic acid detection method comprises the following steps: Mixing the promoter probe, the reporter probe and the SENSR buffer in the kit to obtain a hybridization solution; Mix water with NTPs, SENSR buffer, ET-SSB, T7 RNA polymerase, RNase inhibitor, SplintR ligase, Cas protein, signal reporter probe and CrRNA in the kit to obtain a detection solution; Mixing the nucleic acid to be tested with the hybridization solution, incubating, and obtaining a mixed solution; The mixed solution is mixed with the detection solution for reaction and detection.

Images