Anti-SARS-CoV-2 RBD monoclonal antibodies and applications

Abstract

The present invention relates to anti-SARS-CoV-2RBD monoclonal antibodies and applications. The monoclonal antibodies targeting SARS-CoV-2RBD provided by the present invention are different from existing commercial monoclonal antibodies and can specifically bind to highly conserved antigenic epitopes located in SARS-CoV-2RBD. 350 VYAWN 354 , the antigenic epitope is highly conserved among different SARS-CoV-2 strains, and is not affected by the "upward" and "downward" conformational changes of the S protein RBD; experiments have shown that the anti-SARS-CoV-2RBD monoclonal antibody provided by the present application is an effective neutralizing antibody, which can be used for the development of drugs to prevent and / or treat diseases caused by SARS-CoV-2 infection, and has good clinical application value. The monoclonal antibody of the present invention has a clear recognition epitope, can effectively recognize various conformational forms of SARS-CoV-2 or SARS-CoV-2S protein, and has high affinity, strong specificity, and good stability, providing a new tool for the prevention, detection and treatment of SARS-CoV-2.

Description

Technical Field

[0001] The present invention belongs to the technical field of immunology, and in particular relates to anti-SARS-CoV-2 RBD monoclonal antibodies and applications. Background Art

[0002] The ongoing coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused tremendous global health and socioeconomic damage, necessitating the urgent development of safe and effective prevention methods and therapeutics. The spike (S) protein is the major surface antigen of SARS-CoV-2. The receptor binding domain (RBD) of the S protein binds to the host receptor angiotensin-converting enzyme 2 (ACE2) to enable viral entry and plays a crucial role in viral infection. Therefore, antibodies targeting the RBD can neutralize SARS-CoV-2 by blocking ACE2 binding, making the RBD a prime target for the development of neutralizing antibodies.

[0003] There are now a variety of SARS-CoV-2 virus vaccines (new coronavirus vaccines) approved for marketing, and a variety of candidate vaccines for the new coronavirus are in the development stage and have entered clinical trials. At the same time, many antibodies targeting SARS-CoV-2 RBD have been discovered. However, the rapidly spreading mutated new coronavirus may cause antibody escape, and the vaccine efficacy will decrease. More antibodies are needed to neutralize the new mutations, and vaccines and monoclonal antibodies against the mutated strains of the new coronavirus need to be developed to deal with the new mutant strains. Summary of the invention

[0004] The purpose of the present invention is to provide a monoclonal antibody against SARS-CoV-2 RBD, which can specifically recognize the antigenic epitope in the SARS-CoV-2 receptor binding domain 350 VYAWN 354 .

[0005] The second object of the present invention is to provide a nucleic acid molecule comprising the above monoclonal antibody encoding gene, and an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium comprising the nucleic acid molecule.

[0006] The third object of the present invention is to provide the use of the above-mentioned monoclonal antibody, nucleic acid molecule, expression cassette, recombinant vector, recombinant cell or recombinant bacteria.

[0007] The fourth object of the present invention is to provide a pharmaceutical composition comprising the above monoclonal antibody.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] An anti-SARS-CoV-2 RBD monoclonal antibody comprising VHCDR1, VHCDR2 and VHCDR3 having amino acid sequences as shown in SEQ ID NOs: 1-3, and VLCDR1, VLCDR2 and VLCDR3 having amino acid sequences as shown in SEQ ID NOs: 4-6.

[0010] Preferably, the monoclonal antibody comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO.7, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO.8.

[0011] It is obvious to those skilled in the art that, based on the amino acid sequences of the heavy and light chain variable regions of the monoclonal antibodies specifically disclosed in the present invention, one or more amino acids can be added, deleted, substituted, or the like by conventional protein engineering methods to obtain conservative variants or fragments thereof while still maintaining specific binding to SARS-CoV-2 RBD.

[0012] Preferably, the heavy chain constant region of the monoclonal antibody is of IgG1 type, and the light chain constant region is of Kappa type.

[0013] Preferably, the monoclonal antibody specifically binds to an antigenic epitope located in SARS-CoV-2 RBD, and the amino acid sequence of the antigenic epitope is shown in SEQ ID NO.9 or SEQ ID NO.10.

[0014] An antigenic epitope of SARS-CoV-2 RBD, the amino acid sequence of the antigenic epitope is shown in SEQ ID NO.9 or SEQ ID NO.10; or the antigenic epitope is a truncated peptide of SEQ ID NO.9 containing a VYAWN core sequence.

[0015] The application of antigen epitopes is any of the following:

[0016] 1) Application in the preparation of SARS-CoV-2 antiserum or monoclonal antibodies;

[0017] 2) Application in the preparation of SARS-CoV-2 vaccines;

[0018] 3) Application in the preparation of SARS-CoV-2 immunoassay reagents or kits.

[0019] A nucleic acid molecule comprising a gene sequence encoding the above monoclonal antibody. Preferably, the gene sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.11, and the gene sequence of the light chain variable region is shown in SEQ ID NO.12.

[0020] The antibody nucleic acid molecules involved in the present invention can be obtained by genetic engineering recombination technology or chemical synthesis method. It is obvious to those skilled in the art that the variant sequence of the heavy chain variable region nucleotide sequence and / or the light chain variable region nucleotide sequence obtained after one or more nucleotide addition, deletion, substitution, modification or other mutations of the above-mentioned nucleic acid molecules provided by the present invention, the single-chain antibody or chimeric monoclonal antibody or modified monoclonal antibody or other forms of monoclonal antibody or antibody fragment composed of the amino acid sequence encoded by it still retains the ability to specifically bind to SARS-CoV-2 RBD.

[0021] An expression cassette, recombinant vector, recombinant cell or recombinant bacteria containing the above nucleic acid molecule.

[0022] Specifically, the recombinant vector is selected from a prokaryotic or eukaryotic expression vector, and further, the recombinant vector is selected from a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus such as an adenovirus, a retrovirus or other vectors. The expression system is a bacteria, a yeast, a filamentous fungus, a mammalian cell, an insect cell, a plant cell or a cell-free expression system.

[0023] The use of the above monoclonal antibody, nucleic acid molecule or the above expression cassette, recombinant vector, recombinant cell or recombinant bacteria is any of the following:

[0024] 1) Use in the preparation of drugs for preventing and / or treating diseases caused by SARS-CoV-2 infection;

[0025] 2) Application in the preparation of SARS-CoV-2 immunoassay reagents or kits.

[0026] A pharmaceutical composition comprises the above monoclonal antibody and a pharmaceutically acceptable carrier, diluent or excipient.

[0027] Beneficial effects achieved by the present invention:

[0028] The present invention provides an anti-SARS-CoV-2 RBD monoclonal antibody, which can specifically bind to the antigenic epitope located in the SARS-CoV-2 RBD 350 VYAWN 354, the antigenic epitope is highly conserved among different SARS-CoV-2 strains and is not affected by the "upward" and "downward" conformational changes of the S protein RBD; and experiments have shown that the anti-SARS-CoV-2RBD monoclonal antibody provided by the present application is an effective neutralizing antibody, which can be used for the development of drugs to prevent and / or treat diseases caused by SARS-CoV-2 infection, and has good clinical application value. The monoclonal antibody recognition epitope of the present invention is clear, can effectively recognize various conformational forms of SARS-CoV-2 or SARS-CoV-2 S protein, has excellent affinity and high specificity, and has good stability, providing a new tool for the prevention, detection and treatment of SARS-CoV-2.

[0029] The present invention provides the variable region amino acid sequences of the heavy chain and light chain of a monoclonal antibody targeting SARS-CoV-2 RBD. On this basis, conventional antibody engineering methods can be used to obtain the monoclonal antibody of the present invention. Furthermore, modifications such as addition, deletion, and substitution of one or more amino acids can be used to obtain active fragments or conservative variants thereof, laying the foundation for further improving the specificity and affinity of the antibody.

[0030] The present invention also provides a newly discovered antigenic epitope located on the SARS-CoV-2 RBD, which is highly conserved among different SARS-CoV-2 strains, is not affected by the "upward" and "downward" conformational changes of the S protein RBD, has strong immunoreactivity and immunogenicity, and provides an important antigenic target for the design of SARS-CoV-2 vaccines, antibody development, and antibody detection kit development. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The positively reacting polypeptide (SEQ ID NO.9) reacts with the antiserum;

[0032] In the figure, S1-S6 are pig sera obtained by immunization with antigens designed based on RBD; M1-M6 are mouse sera obtained by immunization with antigens designed based on RBD; NC is a non-RBD region polypeptide, which serves as a negative control.

[0033] Figure 2 is the serum titer of immunized mice;

[0034] In the figure, 1-5 are the numbers of 5 Balb / c mice immunized with the positive reaction polypeptide (SEQ ID NO.9); SMCC-BSA is a negative control.

[0035] Figure 3 This is a diagram showing the IFA identification results of the reactivity of the monoclonal antibody of the present invention;

[0036] In the figure, 15G9 is an anti-SARS-CoV-2 RBD monoclonal antibody, Alexa Fluor488 is a goat anti-mouse IgG labeled with Alexa Fluor488; DAPI is a nuclear dye that indicates the cell nucleus.

[0037] Figure 4 This is a diagram showing the Western-blotting identification results of the monoclonal antibody (15G9) of the present invention;

[0038] In the figure, M is a protein marker, and SARS-CoV-2, SARS-CoV, and MERS-CoV represent the S proteins of the corresponding viruses in the corresponding lanes.

[0039] Figure 5 This is a diagram showing the results of the neutralization ability identification of the monoclonal antibody of the present invention;

[0040] In the figure, 15G9 is a monoclonal antibody against SARS-CoV-2 RBD, and NC is a monoclonal antibody against other viruses as a negative control.

[0041] Figure 6 This is the identification result diagram of the minimum motif of the antigen epitope;

[0042] In the figure, the left side shows the reaction results of N-terminal truncated peptides; the right side shows the reaction results of C-terminal truncated peptides.

[0043] Figure 7 is the spatial distribution of the epitope.

[0044] In the figure, the circle indicates the epitope. DETAILED DESCRIPTION

[0045] The present invention is further described below in conjunction with specific implementation methods, but the protection scope of the present invention is not limited thereto; the instruments and equipment involved in the following embodiments are all conventional instruments and equipment unless otherwise specified; the reagents involved are all commercially available conventional reagents unless otherwise specified; the test methods involved are all conventional methods unless otherwise specified.

[0046] Example 1 B cell epitope peptides analyzed in animal serum immunized with antigens designed based on RBD structure

[0047] 1. Antigen design

[0048] Using a strategy similar to that previously reported (A Universal Design of Betacoronavirus Vaccines against COVID-19, MERS, and SARS, Dai, L, etc.), the antigen was engineered based on the SARS-CoV-2 RBD. The engineered antigen was in a stable RBD-dimer form without introducing any exogenous sequences, thereby retaining the antigen potency and improving the neutralizing antibody titer.

[0049] 2. Obtaining Animal Serum

[0050] Antigens designed based on RBD (5 μg per mouse, 50 μg per pig) were injected intramuscularly into mice and pigs, respectively. After the initial injection, all animals were boosted on the 14th and 28th days after the initial immunization, for a total of 2 booster immunizations. Blood samples were collected 14 days after the last booster immunization and used for B cell epitope peptide analysis experiments.

[0051] 3. Analysis of B cell epitope peptides

[0052] According to the reference sequence of SARS-CoV-2 S protein (access number: YP_009724390), 22 overlapping peptides were synthesized to cover the entire RBD, with a length of 20 amino acids and adjacent peptides overlapping by 5 amino acids.

[0053] Each peptide segment was coated with a 96-well ELISA plate and subjected to indirect enzyme-linked immunosorbent assay (ELISA) with the obtained animal serum to determine the positive reaction peptide segment. The amino acid sequence of the positive reaction peptide segment is shown in SEQ ID NO.9. The reaction of the positive reaction polypeptide with the immunized animal serum is shown in Figure 1 .

[0054] The steps of indirect ELISA are as follows:

[0055] (1) Dilute the peptide fragments to a concentration of 2.5 μg / mL using CBS solution, coat the ELISA plate with 100 μl / well, and block overnight at 4°C;

[0056] (2) Discard the coating solution, wash the plate with PBST, and block with 5% skim milk at 4°C overnight;

[0057] (3) Mouse serum samples (primary antibody) diluted 1:100 and pig serum samples (primary antibody) diluted 1:1000 were added to the ELISA plate in sequence, 50 μl / well, and incubated at 37°C for 30 min;

[0058] (4) Discard the primary antibody, wash the plate with PBST, clean it, and pat it dry;

[0059] (5) Add the diluted HRP-labeled goat anti-mouse IgG (secondary antibody) or goat anti-pig IgG (secondary antibody) into the reaction wells, 50 μl / well, and incubate at 37°C for 30 min;

[0060] (6) Discard the secondary antibody, rinse with PBST, and pat dry;

[0061] (7) Add 100 μl of freshly prepared TMB colorimetric solution to each well and react in the dark for 5 min;

[0062] (8) Add 50 μl 2M H2SO4 to each well to terminate the reaction;

[0063] (9) Read the OD of each well using an ELISA reader 450 value.

[0064] Example 2 Preparation of monoclonal antibodies

[0065] 1. Preparation of immunogens - peptide-coupled carrier protein BSA (bovine serum albumin)

[0066] The coupling is carried out using the water-soluble amino-thiol crosslinker Sulfo-SMCC. Sulfo-SMCC has two reactive groups, sulfo-NHS ester and maleimide, which can react between primary amino groups and thiol groups. First, under the condition of pH 7-9, Sulfo-SMCC reacts with the primary amine group of the carrier protein BSA to form a stable amide bond to obtain an activated carrier protein BSA. Secondly, the activated BSA is dialyzed with PBS (pH 7.2-7.4), and the dialysate is changed at least three times, each time at an interval of 6 hours. The dialyzed solution is collected and the protein concentration is adjusted to 5 mg / ml with PBS. Finally, under the condition of pH 6.5-7.5, the activated BSA reacts with the thiol group of the positive reaction peptide SEQ ID NO.9 to form a stable thioether bond, forming an immunogenic carrier protein BSA and a positive reaction peptide conjugate for antibody production.

[0067] 2. Animal Immunization

[0068] (1) Add Freund's complete adjuvant to the immunogen and use it for the first immunization after emulsification;

[0069] (2) Five female BALB / c mice aged 4 to 8 weeks were immunized by multiple subcutaneous injections at the back, with an immunization dose of 20 μg / mouse;

[0070] (3) BALB / c mice were boosted twice every 2 weeks with Freund's incomplete adjuvant emulsified with the immune antigen using the same method and dose;

[0071] (4) After 2 weeks, blood was collected from the tail vein to determine the titer of specific antibodies against SARS-CoV-2, and mice with higher titers were selected ( Figure 2 ), BALB / c mice were super-immunized with an immunogen without adjuvant by tail vein injection 4 days before cell fusion, with an immunization dose of 40 μg / mouse.

[0072] 3. Cell Fusion and Monoclonal Antibody Preparation

[0073] Using the polyethylene glycol method, spleen cells from immunized mice were fused with mouse myeloma cells SP2 / 0 at a ratio of 8:1, and the fused cells were screened using HAT selection medium; 12 days after fusion, SARS-CoV-2 S protein and positive reaction peptides were used as coating antigens, respectively, and positive hybridoma cells were preliminarily screened by indirect ELISA;

[0074] The steps of the indirect ELISA method were carried out as in Example 1, with different primary and secondary antibodies. The primary antibody was a 1:100 diluted hybridoma supernatant, and the secondary antibody was HRP-labeled goat anti-mouse IgG (secondary antibody). Other operations were the same as in Example 1.

[0075] 4. Subcloning of hybridoma cells by limiting dilution

[0076] The positive hybridoma cells were diluted to about 1.5 cells / ml with 1640 / 10 complete medium, and 100 μl was added to each well of a 96-well plate pre-coated with 100 μl feeder cells, and cultured in a 37°C, 5% CO2 incubator for 6 to 8 days; the positive hybridoma cells were further screened by indirect ELISA; 2 to 3 subclonings were performed until a hybridoma cell line that stably secreted monoclonal antibodies against SARS-CoV-2S protein and positive polypeptide SEQ ID NO.9 was obtained, and the target hybridoma cells were obtained. The positive monoclonal clones obtained by screening were expanded and cultured, and the cell number was 1 to 2×10 6 / tube for cryopreservation.

[0077] 5. Stability identification of monoclonal hybridoma cell lines

[0078] The established monoclonal hybridoma cell line was cultured continuously for 3 months and repeatedly cryopreserved and revived in liquid nitrogen to identify the stability of the hybridoma cells; the results showed that the monoclonal hybridoma cell line had good stability.

[0079] 6. Preparation of monoclonal antibodies by inducing ascites in vivo

[0080] Multiparous female Balb / c mice were selected and intraperitoneally injected with 500 μl sterilized paraffin. One week later, the monoclonal hybridoma cells were intraperitoneally injected at a volume of 2 × 10 5After the mouse abdomen was swollen, the ascites was extracted and the supernatant was obtained after centrifugation. The ascites was purified using the saturated ammonium sulfate method.

[0081] Example 3 Purification and identification of antibodies

[0082] 1. Antibody purification was performed by saturated ammonium sulfate precipitation method. The operation method is as follows:

[0083] (1) Take 5 ml of monoclonal antibody ascites, add 5 ml of PBS buffer, and then add 2.5 ml of saturated ammonium sulfate solution dropwise to make a final concentration of 20% ammonium sulfate solution. Stir while adding, mix thoroughly, and let stand for 30 minutes.

[0084] (2) Centrifuge at 8000 r / min for 20 min and discard the precipitate to remove fibrin.

[0085] (3) Add 12.5 ml of saturated ammonium sulfate solution to the supernatant, mix thoroughly, and let stand for 30 minutes.

[0086] (4) Centrifuge at 8000 r / min for 20 min and discard the supernatant.

[0087] (5) Add 10 ml of PBS buffer to the precipitate to dissolve it, then add 5 ml of saturated ammonium sulfate solution to make it a 33% ammonium sulfate solution. After thoroughly mixing, let it stand for 30 minutes.

[0088] (6) Centrifuge at 8000 r / min for 20 min and discard the supernatant to remove albumin.

[0089] (7) Repeat step 5 2 to 3 times.

[0090] (8) Dissolve the precipitate in 5 ml of PBS buffer, place it in a dialysis bag, and dialyze it against PBS buffer at 4°C, changing the buffer four times.

[0091] (9) Centrifuge at 8000 r / min for 20 min, discard the precipitate, and the supernatant is the purified antibody. Measure the antibody concentration, aliquot, and store at -20°C.

[0092] 2. Monoclonal Antibody Titer Determination

[0093] The indirect ELISA assay method was carried out in accordance with Example 1, with a slightly different primary antibody: the purified monoclonal antibody was diluted 2-fold with 5% skim milk starting from 1:200, and added to the ELISA plate in sequence, 50 μl / well, and incubated at 37°C for 30 min; the other steps were carried out in accordance with Example 1, and the ELISA test results showed that the monoclonal antibody titer was 1:4.096×10 5 .

[0094] 3. Subtype identification

[0095] The subtype of the monoclonal antibody was identified using a mouse monoclonal antibody subtype identification kit (Sigma, Mouse Monoclonal Antibody Isotyping Kit). The identification results showed that the monoclonal antibody belonged to IgG1 and the light chain type was Kappa.

[0096] 4. Monoclonal antibody specificity identification

[0097] The above monoclonal antibodies were diluted in a certain ratio and added to 293T cells transiently transfected with the eukaryotic expression vector pLVX-SARS-CoV-2-S. The results were determined by IFA detection method. Figure 3 As shown in Figure 2, the monoclonal antibody reacts specifically with the cell-derived SARS-CoV-2 S protein, but not with untransfected cells; the Western-blotting results are shown in Figure 2. Figure 4 As shown, the monoclonal antibody specifically recognizes and reacts with the S protein of SARS-CoV-2, but does not react with the S protein of SARS-CoV and MERS-CoV.

[0098] 5. Neutralizing activity of monoclonal antibodies

[0099] Through the surrogate virus neutralization test (sVNT), specifically using cPass TM SARS-CoV-2 Neutralizing Antibody Kit (GenScript, Nanjing, China) was used to evaluate the neutralizing ability of the monoclonal antibody. The specific operation steps were carried out according to the product instructions. The negative control was a monoclonal antibody against African swine fever virus. The results are shown in Figure 5 Inhibition (inhibition value) = (1-sample OD value / negative control OD value) × 100%. When the inhibition value is ≥ 20%, the result is positive, indicating that the tested monoclonal antibody is a neutralizing antibody; when the inhibition value is < 20%, the result is negative, indicating that no neutralizing antibody is detected. Figure 5 It can be seen that the monoclonal antibody is a neutralizing antibody.

[0100] Example 4 Monoclonal Antibody Variable Region Gene Amplification and Sequencing

[0101] 1. Primer Design

[0102] Design the heavy chain variable region primer sequence based on the sequence characteristics of mouse monoclonal antibodies

[0103] P1: 5'-AGGTSMARC TGCAGSAGTCWGG-3';

[0104] P2: 5'-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC-3'.

[0105] Design of light chain variable region primer sequences

[0106] P3: 5'-ACTAGTCGACATGGAGWCAGACACACTSCTGYTATGGGT-3';

[0107] P4: 5'-CCAGCTTGGTCCCCCCTCCGAACGTGT-3'.

[0108] 2. Polymerase chain reaction (PCR) amplification

[0109] The variable region sequences of monoclonal antibodies were obtained through molecular cloning technology and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.

[0110] Total RNA from hybridoma cells was isolated using TRIzol and analyzed using PrimeScript TM cDNA was synthesized using the Takara Biomedical Technology (Beijing) Co. II kit. The variable light chain region (VL) and variable heavy chain region (VH) of the monoclonal antibody were amplified using the above primers in two separate PCR reactions.

[0111] The sequencing results are as follows: the amino acid sequences of the heavy chain variable region and light chain variable region of the monoclonal antibody of the present invention are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively. Further analysis revealed that the amino acid sequences of the heavy chain variable region VHCDR1-3 of the monoclonal antibody are shown in SEQ ID NO.1-3, respectively; the amino acid sequences of the light chain variable region VLCDR1-3 of the monoclonal antibody are shown in SEQ ID NO.4-6, respectively.

[0112] Example 5 Identification of the Minimal Motif of the Epitope Recognized by Anti-SARS-CoV-2 RBD Monoclonal Antibody

[0113] By systematically truncating the positive polypeptide R345 (SEQ ID NO.9) from both ends, a truncated library was established, as shown in Table 1, and the reaction between the truncated polypeptide and the monoclonal antibody was identified by indirect ELISA. The indirect ELISA assay method was performed with reference to Example 1, except that the primary antibody was different. The primary antibody used was the monoclonal antibody of the present invention. The results are shown in Table 1. Figure 6 As shown, the left side shows the reaction result of N-terminal truncated polypeptide and monoclonal antibody, and the right side shows the reaction result of C-terminal truncated polypeptide and monoclonal antibody. Figure 6 It can be seen that the minimum epitope peptide required for epitope activity is " 350 VYAWN 354 ” (SEQ ID NO.10).

[0114] Table 1 Truncated peptide amino acid sequence table

[0115]

[0116] Example 6 Conservation Analysis of Antigenic Epitopes

[0117] In order to analyze the conservation of the antigenic epitope in the currently prevalent SARS-CoV-2 strains, the receptor binding site changes that occurred in different SARS-CoV-2 virus strains were collected from the GISAID database. A total of 431,752 SARS-CoV-2 virus data were collected. The results showed that the epitope was highly conserved among different SARS-CoV-2 strains, and no mutations were observed at the site where the epitope was located.

[0118] Example 7 Spatial localization and structural analysis of antigenic epitopes

[0119] The RBD of SARS-CoV-2 S protein includes two different conformational forms: "up" and "down". When all RBDs of the SARS-CoV-2 S protein trimer are in the "down" conformation, some amino acid residues of the RBD are hidden, which makes some antibodies that recognize hidden region epitopes unable to recognize SARS-CoV-2 or SARS-CoV-2 S protein, affecting the binding ability of monoclonal antibodies and the accuracy of the immune detection method established with the corresponding antibodies. By mapping to the SARS-CoV-2 S protein trimer (PDBID: 7A95), the spatial distribution and structural characteristics of the epitope (SEQ ID NO.10) were analyzed. The results are as follows: Figure 7 As shown, the epitope is exposed on the surface of the SARS-CoV-2 S protein trimer, indicating that the recognition of the epitope is not affected by the "up" and "down" conformational changes of the S protein RBD, and can effectively recognize various conformational forms of SARS-CoV-2 or SARS-CoV-2 S protein, ensuring the stability of the immunoassay. <110> Zhengzhou University <120> Anti-SARS-CoV-2 RBD monoclonal antibodies and applications <160> 28 <170> PatentIn version 3.5 <210> 1 <211> 8 <212> PRT <213> Artificial sequence <221> VHCDR1 <400> 1 Gly Tyr Thr Phe Thr Asp Tyr Ala 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial sequence <221> VHCDR2 <400> 2 Ile Ser Ser His Asn Gly Asn Arg 1 5 <210> 3 <211> 9 <212> PRT <213> Artificial sequence <221> VHCDR3 <400> 3 Ala Ile Phe Asp Tyr Asp Phe Asp Tyr 1 5 <210> 4 <211> 10 <212> PRT <213> Artificial sequence <221> VLCDR1 <400> 4 Lys Ser Val Ser Thr Ser Gly Tyr Ser Tyr 1 5 10 <210> 5 <211> 3 <212> PRT <213> Artificial sequence <221> VLCDR2 <400> 5 Leu Val Ser 1 <210> 6 <211> 9 <212> PRT <213> Artificial sequence <221> VLCDR3 <400> 6 Gln His Ile Arg Glu Leu Thr Arg Ser 1 5 <210> 7 <211> 115 <212> PRT <213> Artificial sequence <221> Heavy chain variable region <400> 7 Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg Pro Gly Val Ser 1 5 10 15 Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe Thr Asp Tyr Ala 20 25 30 Ile His Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile Gly 35 40 45 Val Ile Ser Ser His Asn Gly Asn Arg Gly Tyr Asn Gln Lys Phe Lys 50 55 60 Gly Met Ala Thr Val Thr Val Asp Arg Ser Ser Ser Thr Ala Tyr Met 65 70 75 80 Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys Ala 85 90 95 Ile Phe Asp Tyr Asp Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Met 100 105 110 Val Ser Ser 115 <210> 8 <211> 107 <212> PRT <213> Artificial sequence <221> Light chain variable region <400> 8 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Tyr Arg Ala Ser Lys Ser Val Ser Thr Ser 20 25 30 Gly Tyr Ser Tyr Met His Trp Asn Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 Arg Leu Leu Ile Tyr Leu Val Ser Asn Leu Glu Ser Gly Val Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His 65 70 75 80 Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys Gln His Ile Arg 85 90 95 Glu Leu Thr Arg Ser Glu Gly Gly Pro Ser Trp 100 105 <210> 9 <211> twenty one <212> PRT <213> Artificial sequence <221> SARS-CoV-2 RBD epitopes <400> 9 Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser 1 5 10 15 Asn Cys Val Ala Asp 20 <210> 10 <211> 5 <212> PRT <213> Artificial sequence <221> SARS-CoV-2 RBD epitope (core sequence) <400> 10 Val Tyr Ala Trp Asn 1 5 <210> 11 <211> 345 <212> DNA <213> Artificial sequence <221> Heavy chain variable region <400> 11 gtgcagctgc agcagtctgg gcctgaggtg gtgaggcctg gggtctcagt gaagatttcc 60 tgcaagggtt ccggctacac attcactgat tacgctattc attgggtgaa gcagagtcat 120 gcaaagagtc tagagtggat tggagttatt agttctcaca atggtaatag aggctacaac 180 cagaaattta agggcatggc cacagtgact gttgacagat cctccagcac agcctatatg 240 gaacttgcca gattgacatc tgaggattct gccatctatt actgtgcaat ctttgattac 300 gactttgact actggggcca agggaccacg gtcatggtct cctca 345 <210> 12 <211> 321 <212> DNA <213> Artificial sequence <221> Light chain variable region <400> 12 gacattgtgc tgacacagtc tcctgcttcc ttagctgtat ctctggggca gagggccacc 60 atctcataca gggccagcaa aagtgtcagt acatctggct atagttatat gcactggaac 120 180. acccagactc ctcatctatc ttgtatcca cctagaatct ggggtccctg ccaggttcag tggcagtggg tctgggacag acttcaccct caacatccat 240 cctgtggagg aggaggatgc tgcaacctat tactgtcagc acattaggg gcttacacgt tcggaggggg gaccaagctg g <210> 13 <211> 19 <212> PRT <213> The snowstorm <221> aa347-3 <400> 13 Cys Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys 1 5 10 15 Val Ala Asp <210> 14 <211> 17 <212> PRT <213> The snowstorm <221> aa 349-3 <400> 14 Cys Ser Val Tyr Ala Trp Asn Arg Light Arg Ile Ser Asn Cys Val Ala 1 5 10 15 Asp <210> 15 <211> 16 <212> PRT <213> The snowstorm <221> aa350-3 <400> 15 Cys Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp 1 5 10 15 <210> 16 <211> 15 <212> PRT <213> Artificial sequence <221> aa 351-364 <400> 16 Cys Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp 1 5 10 15 <210> 17 <211> 14 <212> PRT <213> Artificial sequence <221> aa352-364 <400> 17 Cys Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp 1 5 10 <210> 18 <211> 13 <212> PRT <213> Artificial sequence <221> aa 353-364 <400> 18 Cys Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp 1 5 10 <210> 19 <211> 19 <212> PRT <213> Artificial sequence <221> aa 345-362 <400> 19 Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser 1 5 10 15 Asn Cys Val <210> 20 <211> 17 <212> PRT <213> Artificial sequence <221> aa 345-360 <400> 20 Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser 1 5 10 15 Asn <210> twenty one <211> 15 <212> PRT <213> Artificial sequence <221> aa345-358 <400> twenty one Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile 1 5 10 15 <210> twenty two <211> 13 <212> PRT <213> Artificial sequence <221> aa 345-356 <400> twenty two Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys 1 5 10 <210> twenty three <211> 11 <212> PRT <213> Artificial sequence <221> aa 345-354 <400> twenty three Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn 1 5 10 <210> twenty four <211> 10 <212> PRT <213> Artificial sequence <221> aa 345-353 <400> twenty four Cys Thr Arg Phe Ala Ser Val Tyr Ala Trp 1 5 10 <210> 25 <211> twenty two <212> DNA <213> Artificial sequence <221> Heavy chain variable region upstream primer <400> 25 aggtsmarct gcagsagtcw gg 22 <210> 26 <211> 32 <212> DNA <213> Artificial sequence <221> Heavy chain variable region downstream primer <400> 26 tgaggagacg gtgaccgtgg tcccttggcc cc 32 <210> 27 <211> 39 <212> DNA <213> Artificial sequence <221> Light chain variable region upstream primer <400> 27 actagtcgac atggagwcag acacactsct gytatgggt 39 <210> 28 <211> 27 <212> DNA <213> Artificial sequence <221> Light chain variable region downstream primer <400> 28 ccagcttggtcccccctccgaacgtgt 27

Claims

1. Anti-SARS-CoV-2RBD monoclonal antibody, characterized in that: It comprises VHCDR1, VHCDR2 and VHCDR3 whose amino acid sequences are shown in SEQ ID NOs: 1-3, and VLCDR1, VLCDR2 and VLCDR3 whose amino acid sequences are shown in SEQ ID NOs: 4-6.

2. The monoclonal antibody according to claim 1, characterized in that The monoclonal antibody comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO.7, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO.

8.

3. The monoclonal antibody according to claim 1, characterized in that The heavy chain constant region of the monoclonal antibody is of IgG1 type, and the light chain constant region is of Kappa type.

4. The monoclonal antibody according to claim 1, characterized in that The monoclonal antibody specifically binds to an antigenic epitope on SARS-CoV-2 RBD, and the amino acid sequence of the antigenic epitope is shown in SEQ ID NO.9 or SEQ ID NO.

10.

5. A nucleic acid molecule, characterized in that The method comprises a gene sequence encoding the monoclonal antibody according to claim 1 or 2.

6. The nucleic acid molecule according to claim 5, characterized in that The gene sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.11, and the gene sequence of the light chain variable region is shown in SEQ ID NO.

12.

7. An expression cassette, recombinant vector, recombinant cell or recombinant bacterium containing the nucleic acid molecule according to claim 5 or 6.

8. Use of the monoclonal antibody according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5 or 6, or the expression cassette, recombinant vector, recombinant cell or recombinant bacterium according to claim 7, which is any of the following: 1) Use in the preparation of drugs for preventing and / or treating diseases caused by SARS-CoV-2 infection; 2) Application in the preparation of SARS-CoV-2 immunoassay reagents or kits.

9. A pharmaceutical composition, characterized in that The composition comprises the monoclonal antibody according to any one of claims 1 to 4 and a pharmaceutically acceptable carrier, diluent or excipient.

Images