Preparation method and application of uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF

Abstract

The present invention discloses a preparation method and application research of uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF. Compared with electrochemical sensors without HCR reaction, the present invention first synthesizes DNA nanotriangular prisms carrying UDG shearing sites, and uracil bases are recognized and removed by UDG, so that hairpin DNA becomes straight-chain DNA to start hybridization chain reaction to achieve alternating hybridization of hairpin H1 and H2. This new and powerful DNA nanobody can "grasp" Ag@Cu-MOF in multiple dimensions through π-π conjugation, build a balanced homeostatic environment, better catalyze 3,3,5',5'-tetramethylbenzidine solution (TMB) reaction, facilitate electron transport and transfer during the reaction to achieve signal amplification, and realize UDG analysis and detection through current-time curve, while when UDG is not present, the electrochemical signal that can be monitored is relatively small, based on which a new electrochemical biosensor is constructed to achieve sensitive analysis of UDG activity and its small molecule inhibitors.

Description

Technical Field

[0001] The present invention relates to an electrochemical biosensor and a detection method thereof, in particular to a preparation method and application research of a uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF, belonging to the technical field of functional materials and biosensor. Background Art

[0002] Every cell in the human body is exposed to tens of thousands of DNA damages from various sources every day. In order to reduce the adverse effects of DNA damage, there are multiple DNA repair mechanisms in organisms. Most DNA repair methods rely mainly on base excision repair (BER) in the body. BER is triggered by DNA glycosylase, which recognizes mismatched and abnormal bases, removes damaged bases from genes by hydrolyzing the N-glycosidic bond between the base and deoxyribose, produces apurinic / apyrimidinic (AP) sites, and finally cooperates with other repair proteins to complete gene repair. Uracil-DNA glycosylase (UDG) is an important DNA repair enzyme in the BER process, which is used to repair uracil produced by cytosine deamination in genomic DNA. UDG can specifically recognize and catalyze the break of the N-glycosidic bond between uracil and the DNA backbone, release the damaged base, produce AP sites, and finally cooperate with other repair enzymes to complete DNA repair. Abnormalities in UDG are closely related to certain human diseases and cancers. Therefore, highly sensitive and specific detection of UDG activity is crucial for biomedical research and clinical diagnosis.

[0003] Traditional methods for UDG detection mainly include high-performance chromatography and mass spectrometry, gel electrophoresis analysis, and radioactive labeling, but most of them are time-consuming, have high radiation, and low sensitivity. In order to detect UDG activity more simply and sensitively, researchers have designed a series of new methods, including polymerase chain reaction (PCR), colorimetry, electrochemiluminescence, and fluorescence. Among these methods, electrochemical technology has attracted attention due to its simplicity, high sensitivity, and good selectivity. In order to further improve the sensitivity, amplification strategies were subsequently introduced to amplify electrochemical signals, such as hybridization chain reaction (HCR), target-induced strand displacement (TISD), and rolling circle amplification (RCA). Various genetic testing and medical diagnostic strategies have been developed by using different nucleic acid amplification technologies and combining multiple detection methods (electrochemical, optical, and colorimetric). Among them, electrochemical detection technology has been increasingly widely used in recent years due to its advantages of high sensitivity, low cost, and simple operation.

[0004] Metal-organic frameworks (MOFs), also known as porous coordination polymers, are composed of metal-based nodes and organic linker molecules. Compared with traditional porous materials (such as porous carbon, porous SiO2, and porous polymers), MOFs have the advantages of adjustable pores, high specific surface area, and customizable structure. They have been applied in the field of electrochemical biosensing. Biosensors prepared based on MOFs can sensitively detect various analytes, such as cancer biomarkers, living cancer cells, proteins, antibiotics, and heavy metal ions. However, due to the poor conductivity of MOFs, the application of MOFs in electrochemical sensors is very limited. Introducing materials with excellent conductivity to form composite materials with MOFs can improve conductivity, increase electron transfer kinetics and electrolytic activity, and have great application value.

[0005] The present invention introduces Ag and Cu with good conductivity into the synthesis of MOF materials, and proposes a method for monitoring UDG activity based on Ag@Cu-MOF materials. The Ag@Cu-MOF material synthesized by hydrothermal method in the invention has good conductivity and high surface area, and can well catalyze TMB reaction in 100.0mM, pH 7.0 PBS buffer (containing 3,3,5',5'-tetramethylbenzidine solution TMB single component solution). First, a DNA nano-triangular prism carrying a UDG shearing site was synthesized and modified onto the gold electrode surface. Under UDG conditions, the uracil base was recognized and removed by UDG, and the hairpin DNA chain changed from a hairpin to a straight-chain DNA. The straight-chain DNA could recognize the hairpin H1 to initiate the hybridization chain reaction to achieve alternating hybridization of the hairpins H1 and H2. Subsequently, a powerful DNA nanobody was formed on the electrode surface. We designed a free end on both H1 and H2. These free ends can "grab" Ag@Cu-MOF in multiple dimensions through π-π conjugation, build a balanced homeostatic environment, better catalyze the TMB reaction, facilitate the electron transport and transfer during the reaction to achieve signal amplification, and realize the analysis and detection of UDG through the current-time curve. When UDG is not present, the electrochemical signal that can be monitored is relatively small. Based on this, a new electrochemical biosensor was constructed to achieve sensitive analysis of UDG activity and its small molecule inhibitors. At present, there is no report on the electrochemical biosensor of uracil-DNA glycosylase based on Ag@Cu-MOF materials. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a method for preparing an electrochemical sensor for uracil-DNA glycosylase with good specificity, high sensitivity, fast detection speed, accurate and reliable results and low cost, and its application research, through the electrochemical catalysis of 3,3,5',5'-tetramethylbenzidine (TMB), thereby realizing the detection of uracil-DNA glycosylase activity and the screening of its inhibitors.

[0007] The technical solution adopted by the present invention to solve the above technical problems is: a preparation method and application research of uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF, and the specific steps are as follows:

[0008] (1) Synthesis of DNA prisms containing UDG cleavage sites

[0009] ① Add L3 (0.1~1.5μM, 5~15μL), S a (0.1~1.5μM, 10~50μL), 10×TAE / Mg 2+ ② Mix L3 (0.1~1.5μM, 5~15μL), S b (0.1~1.5μM, 10~50μL) and 10×TAF / Mg 2+ (2-10 μL) mix, add DEPC water to a total volume of 20-100 μL, mix well, and anneal; ③ Mix ① and ② solutions in a ratio of 1:1, anneal and assemble, and anneal.

[0010] L3, S a and S b are the names of the three DNA strands involved in the synthesis of the DNA triangular prism in the present invention, wherein S a Contains UDG splicing site, three DNA sequences are as follows:

[0011]

[0012] 10×TAE / Mg 2+ Solution composition: 40mM Tris, 20mM acetic acid, 2mM EDTA and 12.5mM Mg 2+ , pH 7.4, and DEPC water was used to prepare the solution.

[0013] The annealing conditions in the prism synthesis step are: 95℃, 5min; 65℃, 30min; 50℃, 30min; 37℃, 30min; 22℃, 30min; 4℃, 30min; hold, 4℃.

[0014] (2) Cu-MOF synthesis

[0015] Mix Cu(NO3)2·3H2O (21.6~43.2mg, 0.09~0.18mmol), meso-tetrakis(4-carboxyphenyl)porphine (TCPP) (23.7~47.4mg, 0.03~0.06mmol), dimethyl sulfoxide (DMF) (4.5~9.0mL) and ethanol (1.5~3.0mL) evenly, heat at 60~80℃ for 12~24h, wash twice with ethanol, disperse in 5~10mL ethanol solution and set aside.

[0016] (3) Ag@Cu-MOF synthesis

[0017] Take 1-5 mL of the Cu-MOF solution prepared in step (2), add it to 0.9-4.5 mL of a solution containing 0.5-1 mM AgNO3 (solvent: H2O / DMF=1:2, volume ratio) and stir for 1-5 h. The obtained solution is centrifuged and washed with ethanol. The obtained substance is dispersed in 1-10 mL of a solution (solvent: H2O / DMF=1:2, volume ratio), and then added to 1-10 mL of a NaBH4 solution containing 0.756-7.56 mg. Filter to obtain a black sample, which can be dispersed in an ethanol-DEPC aqueous solution (volume ratio of 2:8) for later use.

[0018] (4) Preparation of uracil-DNA glycosylase electrochemical sensor

[0019] Preparation of Electrode 1: Before use, the gold electrode was polished with Al2O3 powder with a diameter of 0.3μm and 0.05μm respectively, cleaned three times by ultrasound with ultrapure water, dried with an ear bulb, and then immersed in 0.1M H2SO4 solution. Cyclic voltammetry scanning was performed in the range of -0.3V to +1.2V for 5 to 30min. Finally, it was washed with DEPC water and dried with an ear bulb for later use.

[0020] Preparation of Electrode 2: drop 2.5-5 μL of synthesized DNA triangular prism solution onto the surface of Electrode 1 and place in a refrigerator overnight; after washing with DEPC water, drop 2.5-5 μL of 1×UDG reaction buffer of the reaction system and different concentrations of UDG onto the surface of the triangular prism modified electrode, incubate at 37°C for 1-3 hours, slowly rinse the electrode with DEPC water, and the successfully prepared electrode is marked as Electrode 2 for use.

[0021] Preparation of Electrode 3: Two H1 and H2 hairpin probes (1-4 μM) were placed in a buffer solution and heated to 95°C for 5 min, then quickly cooled to 25°C for 1-2 h. H1 (10-20 nM) and H2 (50-100 nM) were mixed and then dropped on Electrode 2 to trigger the HCR reaction, and incubated at 37°C for 1-3 h. The electrode was slowly rinsed with buffer solution and set aside. The buffer solution ratio is: 10 mM HEPES, 1 M NaCl, 50 mM MgCl2; the sequence of H1 is: TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGATCGA; the sequence of H2 is: ATCGAAGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG; all the above solutions were prepared with DEPC water.

[0022] Preparation of Electrode 4: 2.5-5 μL of Ag@Cu-MOF was dropped onto Electrode 3, and the reaction was carried out at 4°C overnight. The electrode was slowly rinsed with DEPC water and set aside.

[0023] The electrocatalytic activity of TMB single-component solution (containing H2O2 and TMB) was detected using the above-mentioned Ag@Cu-MOF-based uracil-DNA glycosylase electrochemical sensor. The chronoamperometry was used to detect the activity of UDG and screen its inhibitors. The initial voltage was set to 0.1 V and the running time was 100 s. The catalytic current corresponding to a series of different concentrations of UDG was obtained to explore the relationship between the current response and the UDG concentration.

[0024] Invention principle: The present invention is a method for preparing an electrochemical sensor and its application research, based on Cu by hydrothermal method 2+ and tetrakis(4-carboxyphenyl)porphyrin (TCPP), which can be used as a nanocarrier to fix the detection probe and as an excellent electrocatalyst for signal amplification. By introducing Ag nanoparticles into Cu-MOF, the surface area and capacity are increased while the electron transfer and chemical activity are enhanced. After UDG shearing, the Binkin structure (including UDG shearing site) on the DNA nanotriangular prism modified on the surface of the gold electrode becomes a long-chain DNA. This part of DNA can trigger a series of HCR reactions to form a long DNA double-stranded ladder, which can better capture Ag@Cu-MOF through the conjugated π electron system and generate electrochemical signals in TMB single-component solution. The present invention utilizes the specificity of UDG recognition to construct a simple, rapid, highly sensitive and highly selective analytical method for UDG activity detection and screening of its small molecule inhibitors. Compared with the prior art, the advantages of the present invention are:

[0025] (1) High sensitivity. The linear correlation equation of the current response of the sensor constructed based on Cu-MOF to the logarithmic value of UDG concentration is y = 48.91lgC UDG +199.91, R 2 =0.9968, the linear range is 0.0001~0.1U / mL, and the detection limit is 3.6×10 -5 U / mL; The linear correlation equation of the current response of the sensor constructed based on Ag@Cu-MOF to the logarithmic value of UDG concentration is y=75.21lgC UDG +358.11, R 2 =0.9987, the linear range is 0.00002~0.5U / mL, and the detection limit is 2.8×10 - 6 U / mL. This shows that the sensor can achieve high sensitivity detection of UDG.

[0026] (2) High specificity. Other common enzymes such as endonuclease IV (Endo IV), protein kinase (PKA), histone acetyltransferase (HAT), alkaline phosphatase (ALP), and glucose oxidase (GOx) have no interference with this detection system.

[0027] (3) Excellent stability. Relative standard deviation (RSD) is less than 6%.

[0028] (4) The results are accurate. The recovery rate is between 90% and 110%.

[0029] (5) Preparation and detection methods require less reagents, have fast detection speed and low cost. The present invention only requires a small amount of materials and reagents to prepare the uracil-DNA glycosylase electrochemical biosensor, and detects the catalytic activity of the TMB single-component solution, thereby realizing the detection of UDG and its small molecule inhibitors. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a comparison diagram of the electrochemical responses of various modified electrodes in the present invention;

[0031] Figure 2 The electrochemical response diagram of the sensor of the present invention to the reaction system with or without UDG;

[0032] Figure 3 The calibration curve diagram of the current response of the sensor of the present invention to different concentrations of UDG versus concentration;

[0033] Figure 4 is a calibration curve diagram of the current response of the sensor of the present invention to different concentrations of UGI versus concentration;

[0034] Figure 5This is an experimental diagram of the selectivity of the sensor of the present invention to UDG;

[0035] Figure 6 This is a graph showing the reproducibility of the sensor of the present invention for UDG. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below with reference to the accompanying drawings.

[0037] Example 1 Preparation of sensor

[0038] Preparation method and application research of uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF. The specific steps are as follows:

[0039] (1) Synthesis of DNA prisms containing UDG cleavage sites

[0040] ① L3 (1.18 μM, 10 μL), S a (1.21μM, 29.2μL), 10×TAE / Mg 2+ ② Mix L3 (1.18 μM, 10 μL), S b (1.1μM, 32.2μL) and 10×TAE / Mg 2+ (5.9 μL) and add DEPC water to a total volume of 59 μL, mix well, and anneal; ③ Mix ① and ② solutions in a ratio of 1:1, anneal and assemble, and anneal.

[0041] 10×TAE / Mg 2+ Composition: 40mM Tris, 20mM acetic acid, 2mM EDTA and 12.5mM Mg 2+ , pH 7.4, and DEPC water was used to prepare the solution.

[0042] The annealing conditions in the prism synthesis step are: 95℃, 5min; 65℃, 30min; 50℃, 30min; 37℃, 30min; 22℃, 30min; 4℃, 30min; hold, 4℃.

[0043] (2) Cu-MOF synthesis

[0044] Mix Cu(NO3)2·3H2O (21.6 mg, 0.09 mmol), meso-tetrakis(4-carboxyphenyl)porphine (TCPP) (23.7 mg, 0.03 mmol), DMF (4.5 mL), and ethanol (1.5 mL), heat at 80°C for 24 h, then wash with ethanol, disperse in 5 mL of ethanol solution, and set aside.

[0045] (3) Ag@Cu-MOF synthesis

[0046] Take 1mL of the above Cu-MOF solution and add it to 0.9mL of a solution containing 1mM AgNO3 (H2O / DMF=1:2, volume ratio) and stir for 2.5h. The obtained solution is centrifuged and washed with ethanol. The obtained substance is dispersed in 10mL of a solution (H2O / DMF=1:2, volume ratio), and then added to 5mL of a solution containing 3.78mg of NaBH4. The black sample is filtered and can be dispersed in an ethanol-DEPC aqueous solution (volume ratio of 2:8) for later use.

[0047] (4) Preparation of uracil-DNA glycosylase electrochemical sensor

[0048] Preparation of Electrode 1: Before use, the gold electrode was polished with Al2O3 powder with a diameter of 0.3μm and 0.05μm respectively, cleaned three times by ultrasound with ultrapure water, dried with an ear bulb, and then immersed in 0.1M H2SO4 solution. Cyclic voltammetry scanning was performed in the range of -0.3V to +1.2V for 10min. Finally, it was washed with ultrapure water and dried with an ear bulb for later use.

[0049] Preparation of Electrode 2: drop 5 μL of synthesized DNA triangular prism solution onto the surface of Electrode 1 and place it in a refrigerator overnight; after washing with DEPC water, drop 5 μL of 1×UDG reaction buffer of the reaction system and different concentrations of UDG onto the surface of the triangular prism modified electrode, incubate at 37°C for 1 hour, slowly rinse the electrode with DEPC water, and the successfully prepared electrode is marked as Electrode 2 for use.

[0050] Preparation of Electrode 3: Two H1 and H2 hairpin probes (2μM) were placed in a buffer solution and heated to 95℃ for 5min, then quickly cooled to 25℃ for 2h. H1 (20nM) and H2 (100nM) were mixed and then dropped on Electrode 2 to trigger the HCR reaction and incubated at 37℃ for 2h. The electrode was slowly rinsed with distilled water and set aside. The buffer solution ratio is: 10mM HEPES, 1M NaCl, 50mM MgCl2; the H1 sequence is: TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGATCGA; the H2 sequence is: ATCGAAGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTITG; all the above solutions were prepared with DEPC water.

[0051] Preparation of Electrode 4: 5 μL of Cu-MOF or Ag@Cu-MOF was dropped onto Electrode 3 and reacted overnight at 4°C. The electrode was slowly rinsed with DEPC water and set aside. The it current response of the four prepared electrodes was tested, see Figure 1 It can be seen that the prepared Electrode 4 has a very obvious electrochemical response compared with the other three electrodes.

[0052] Example 2 Electrochemical response with and without UDG

[0053] Preparation method and application of uracil-DNA glycosylase electrochemical biosensor based on Ag@Cu-MOF, our biosensor was prepared based on Example 1. Figure 2 When UDG was present, the sensor had a more obvious it response in 100.0 mM, pH 7.0 PBS buffer (containing TMB single-component solution), while when UDG was absent, there was a weaker electrochemical current response, which proved that the sensor can be used for UDG activity detection.

[0054] Example 3 UDG activity detection

[0055] Preparation method and application research of uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF. The preparation steps of the sensor are the same as those in specific embodiment 1. During the construction of Electrode 2, the concentration of UDG is changed sequentially. For the sensor constructed with Cu-MOF, the concentration of UDG is: 0, 0.0001, 0.0002, 0.0003, 0.0005, 0.0008, 0.001, 0.002, 0.005, 0.01, 0.02, 0.03, 0.05, 0.1, 0.2, 0.5 U / mL. For the sensor constructed with Ag@Cu-MOF, the concentration of UDG is: 0, 0.00002, 0.00005, 0.0001, 0.0002, 0.0005, 0.001, 0.002, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.5, 1, 5 U / mL. The current response of the sensor in 100.0 mM, pH 7.0 PBS buffer (containing TMB single-component solution) was recorded. According to the experimental results, a series of electrochemical response curves corresponding to different concentrations of UDG were obtained, and the quantitative relationship between the current response and the UDG concentration was established. According to the quantitative relationship between the two, the concentration of UDG in the sample to be tested was determined. The experimental results are shown in Figure 2. Figure 3 As shown in the figure, it shows that as the UDG concentration increases, the electrochemical response of the sensor becomes stronger. The linear correlation equation of the sensor built based on Cu-MOF is y=48.91lgC UDG +199.91, R 2 =0.9968; the linear correlation equation of the sensor based on Ag@Cu-MOF is y=75.21lgC UDG +358.11, R 2 =0.9987, the linear ranges were 0.0001-0.1U / mL and 0.00002-0.5U / mL, and the detection limits were 3.6×10 -5 U / mL, 2.8×10 -6 U / mL, indicating that the sensor can achieve high-sensitivity detection of UDG activity.

[0056] Example 4 Detection of UDG Inhibitor UGI

[0057] Preparation method and application of uracil-DNA glycosylase electrochemical biosensor based on Ag@Cu-MOF. The preparation steps of the sensor are the same as those in specific embodiment 1. During the construction of Electrode 2, the concentration of UDG is 0.1U / mL. Different concentrations of inhibitor UGI are added in sequence. The concentrations of UGI are: 0, 0.001, 0.002, 0.003, 0.005, 0.008, 0.01, 0.02, 0.03, 0.05, 0.08, 0.1, 0.2, 0.3, 0.5, 0.8U / mL, and then used to prepare the sensor. The electrochemical response of the sensor in 100.0mM, pH7.0 PBS buffer (containing TMB single-component solution) was recorded. According to the experimental results (such as Figure 4 ), with the increase of the concentration of inhibitor UGI, the corresponding current response is more obvious, indicating that UGI has a stronger inhibitory effect on UDG activity. For the sensor constructed by Cu-MOF and the sensor constructed by Ag@Cu-MOF, the half-inhibitory concentrations are 0.032U / mL and 0.031U / mL, respectively.

[0058] Example 5 Specificity Detection

[0059] The concentration of UDG and other enzymes in the selective experiment was 0.1 U / mL. The abbreviations of the other enzymes used are as follows: endonuclease IV (Endo IV), protein kinase (PKA), histone acetyltransferase (HAT), alkaline phosphatase (ALP), glucose oxidase (GOx). According to the sensor preparation steps of Example 1 above, during the construction of Electrode 2, other enzymes of the same concentration were used instead of UDG to prepare the sensor. The results are shown in FIG. Figure 5 As shown, compared with UDG, the electrochemical response of the sensor to other enzymes is smaller, indicating that the sensor has good selectivity for the detection of UDG.

[0060] Example 6 Reproducibility Test

[0061] According to the sensor preparation steps of Example 1 above, the concentration of UDG was fixed at 0.1 U / mL to prepare the sensor. The current responses of different electrodes to 100.0 mM, pH 7.0 PBS buffer (containing TMB single component solution) were detected under the same experimental conditions, and their current responses were compared. The results are shown in Figure 2. Figure 6 As shown, the relative standard deviations (RSD) are 4.54% and 3.97% respectively, proving that the electrode has excellent reproducibility.

[0062] Of course, the above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by ordinary technicians in the technical field within the essential scope of the present invention should also fall within the protection scope of the present invention.

Claims

1. A method for preparing a uracil-DNA glycosylase electrochemical sensor based on Ag@Cu-MOF, characterized in that: The specific steps are as follows: (1) Synthesis of DNA triangular prisms containing UDG cleavage sites ① Add 5 to 15 μL of 0.1 to 1.5 μM L3 and 10 to 50 μL of 0.1 to 1.5 μM S a , 2-10 μL 10×TAE / Mg 2+ The solution was mixed with 1 to 5 μL of 10 to 50 mM tris(2-carboxyethyl)phosphine, DEPC water was added to a total volume of 20 to 100 μL, mixed, and annealed; ② Add 5-15 μL of 0.1-1.5 μM L3 and 10-50 μL of 0.1-1.5 μM S b and 2-10 μL of 10×TAF / Mg 2+ The solutions were mixed, DEPC water was added to a total volume of 20 to 100 μL, mixed well, and annealed; ③ Mix solution ① and solution ② in a ratio of 1:1, perform annealing assembly, and annealing; Among them, 10×TAE / Mg 2+ The solution composition is: 40mM tris(hydroxymethyl)aminomethane, 20mM acetic acid, 2mM EDTA and 12.5mM Mg 2+ , pH 7.4, DEPC water was used to prepare the solution; And among them, L3, S a and S b The names of the three DNA strands involved in the synthesis of the DNA triangular prism, among which S a Contains UDG splicing site, three DNA sequences are as follows: (2) Cu-MOF synthesis 0.09-0.18 mmol of Cu(NO3)2·3H2O, 0.03-0.06 mmol of meso-tetrakis(4-carboxyphenyl)porphine, 4.5-9.0 mL of DMF and 1.5-3.0 mL of ethanol were mixed evenly, heated at 60-80°C for 12-24 h, washed twice with ethanol, dispersed in 5-10 mL of ethanol solution, and set aside; (3) Ag@Cu-MOF synthesis 1-5 mL of the Cu-MOF solution prepared in step (2) was added to 0.9-4.5 mL of a 0.5-1 mM AgNO3 solution and stirred for 1-5 h. The obtained solution was centrifuged and washed with ethanol. The obtained substance was dispersed in 1-10 mL of the solution, and then added to 1-10 mL of a NaBH4 solution containing 0.756-7.56 mg. The black sample was filtered and dispersed in an ethanol-DEPC aqueous solution for later use. Wherein, the solvent in the AgNO3 solution is: H2O / DMF=1:2, volume ratio; The solution used for material dispersion is: H2O / DMF = 1:2, volume ratio; The volume ratio of ethanol to DEPC water in the ethanol-DEPC aqueous solution is 2:8; (4) Preparation of uracil-DNA glycosylase electrochemical sensor Preparation of Electrode 1: Before use, the gold electrode was polished with Al2O3 powder with a diameter of 0.3μm and 0.05μm respectively, cleaned by ultrasound with ultrapure water for 3 times, dried with an ear bulb, and then immersed in 0.1M H2SO4 solution, and cyclic voltammetry scan was performed in the range of -0.3V to +1.2V for 5 to 30min, and finally washed with DEPC water, dried with an ear bulb, and set aside; Preparation of Electrode 2: drop 2.5-5 μL of the DNA triangular prism solution synthesized in step (1) onto the surface of Electrode 1 and place in a refrigerator overnight; after washing with DEPC water, drop 2.5-5 μL of 1×UDG reaction buffer of the reaction system and UDG of different concentrations onto the surface of the triangular prism modified electrode, incubate at 37°C for 1-3 hours, slowly rinse the electrode with DEPC water, mark it as Electrode 2, and set aside; UDG represents uracil-DNA glycosylase; Preparation of Electrode 3: Two H1 and H2 hairpin probes are placed in a buffer solution and heated to 95°C for 5 min, then quickly cooled to 25°C for 1-2 h; H1 and H2 are mixed and then dropped onto Electrode 2 to trigger the HCR reaction, and incubated at 37°C for 1-3 h; the electrode is slowly rinsed with the buffer solution and set aside; The buffer ratio is: 10mM HEPES, 1M NaCl, 50mM MgCl2; The H1 sequence is: TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGATCGA; The H2 sequence is: ATCGAAGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG; All solutions were prepared with DEPC water; Preparation of Electrode 4: 2.5-5 μL of the Ag@Cu-MOF prepared in step (3) was dropped onto Electrode 3, reacted at 4°C overnight, and the electrode was slowly rinsed with DEPC water for later use.

2. The preparation method according to claim 1, characterized in that: The annealing conditions in step (1) are: 95°C, 5 min; 65°C, 30 min; 50°C, 30 min; 37°C, 30 min; 22°C, 30 min; 4°C, 30 min; hold at 4°C.

3. Use of the Ag@Cu-MOF-based uracil-DNA glycosylase electrochemical sensor prepared according to the method described in claim 1, characterized in that: The sensor was used to detect the electrocatalytic activity of TMB single-component solution, and the chronoamperometry was used to detect the activity of UDG. The initial voltage was set to 0.1V and the running time was 100s. The catalytic current corresponding to a series of different concentrations of UDG was obtained to explore the relationship between the current response and the UDG concentration; TMB is 3,3,5′,5′-tetramethylbenzidine.

4. The use according to claim 3, characterized in that TMB single component solution contains H2O2 and TMB.

5. The use according to claim 3 or 4, characterized in that: The linear correlation equation of the current response of the sensor to the logarithmic value of UDG concentration is y = 75.21lgC UDG +358.11, R 2 =0.9987, the linear range is 0.00002~0.5U / mL, and the detection limit is 2.8×10 -6 U / mL.

Images