Construction and application of a post-traumatic stress disorder model mouse

Abstract

The present invention relates to the construction and application of a post-traumatic stress disorder model mouse, and belongs to the field of genetic engineering technology and neuropsychiatric disease research. The present invention knocks out the AtLAS gene through the CRISPR-Cas9 system to obtain AtLAS ‑ / ‑ Mice. AtLAS-deficient mice have obvious difficulty in extinction of fear memory compared with wild-type mice. Its clinical manifestations are similar to those of human PTSD and can be used for the study of human PTSD. The model has no obstacles in related behavioral tests such as depression, anxiety, and autism, indicating that it is specific as a PTSD model mouse and has important practical significance for clarifying the pathogenesis and treatment of PTSD. The model construction method of the present invention is simple, easy to cultivate, has good repeatability, and has a stable phenotype. It is a better animal model of PTSD.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering technology and neuropsychiatric disease research, and relates to the construction and application of a post-traumatic stress disorder model mouse. Background Art

[0002] Post-traumatic stress disorder (PTSD) refers to a delayed and persistent mental disorder caused by an individual experiencing or encountering one or more actual deaths, threats of death, serious injuries, or threats to physical integrity involving oneself or others. In clinical practice, exposure therapy is a common treatment, but there is no specific drug for treatment. In addition, there is currently a lack of stable animal models for PTSD, which has led to a stagnation in the study of the disease and no effective treatment.

[0003] AtLAS is a long non-coding RNA (AK013786). As its gene is located in the synapsin II b region, we named it antisense long non-coding RNA of synapsin II (AtLAS). Previous studies have shown that long non-coding RNA AtLAS can regulate AMPA receptor-mediated synaptic plasticity by affecting the selective splicing of synaptic protein synapsin II (syn2) and then affecting the postsynaptic action of syn2b, thus playing an important role in social hierarchy behavior. At present, there are no reports on AtLAS and post-traumatic stress disorder in the world. Summary of the invention

[0004] The present invention provides a construction and application of a post-traumatic stress disorder model mouse, specifically an AtLAS gene knockout mouse. The AtLAS knockout mouse constructed by the present invention shows an obvious phenomenon of difficulty in extinction of fear memory, and can be used as a good PTSD model. The model has no obstacles in related behavioral tests such as depression, anxiety, and autism, indicating that it is specific as a PTSD model mouse.

[0005] According to a first aspect of the present invention, a method for constructing a gene knockout model mouse is provided, comprising the following steps:

[0006] (1) adding guide RNAs with base sequences of SEQ ID NO: 1 and SEQ ID NO: 2 to Cas9 nuclease to obtain a Cas9 nuclease mixed system;

[0007] (2) injecting the Cas9 nuclease mixed system obtained in step (1) into mouse fertilized eggs, so that the AtLAS gene in the fertilized eggs is cut by the Cas9 nuclease, and then transplanting them into mother mice to obtain F0 generation mice;

[0008] (3) The positive F0 mice are bred with C57BL / 6J mice to obtain chimeric positive F1 mice with AtLAS gene knockout, and the F1 mice are then mated to obtain F2 mice with complete AtLAS gene knockout, thus obtaining the gene knockout model mice.

[0009] Preferably, in step (1), the concentration of Cas9 nuclease in the Cas9 nuclease mixed system is 20 ng / ul-30 ng / ul, and the concentrations of guide RNAs having base sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are 10 ng / ul-20 ng / ul, respectively.

[0010] Preferably, the positive F0 generation mice in step (3) are obtained by identifying the F0 generation mice obtained in step (2), and primers with base sequences of SEQ ID NO: 3 and SEQ ID NO: 4 are designed for PCR amplification. If electrophoresis shows a band of AtLAS gene knockout, the mice are identified as positive F0 generation mice.

[0011] According to another aspect of the present invention, a gene knockout model mouse constructed by any one of the methods is provided.

[0012] According to another aspect of the present invention, there is provided a use of a gene knockout model mouse constructed by any one of the methods as a post-traumatic stress disorder model mouse.

[0013] Preferably, the gene knockout model mice are used to study the pathogenesis of post-traumatic stress disorder or identify molecular targets of post-traumatic stress disorder.

[0014] Preferably, the gene knockout model mice are used for preclinical drug research or biomarker detection.

[0015] In general, the above technical solution conceived by the present invention has the following technical advantages compared with the prior art:

[0016] (1) The present invention first discovered that AtLAS knockout mice exhibited an obvious fear memory refractory phenotype, indicating that the mice can be used as a good post-traumatic stress disorder (PTSD) model. The model showed no impairment in related behavioral tests such as depression, anxiety, and autism, indicating that it is specific as a PTSD model mouse. Therefore, it has important practical significance for clarifying the pathogenesis of post-traumatic stress disorder.

[0017] (2) The AtLAS gene knockout mouse in the present invention fills a gap in the research field of the pathogenesis of post-traumatic stress disorder (PTSD). Not only is the model simple to prepare, with good repeatability and low production cost, but the clinical manifestations of the AtLAS gene knockout mouse model are similar to those of human PTSD and do not have the characteristics of other common neuropsychiatric diseases. Therefore, it can be used for the study of human PTSD, and related drug intervention experiments and biomarker exploration can also be carried out, which can be promoted and applied at home and abroad. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the PCR genotype detection diagram of AtLAS gene knockout mice. From left to right: AtLAS + / - 、AtLAS - / - The genotype identification results of normal wild-type mice and negative control (ddH2O) showed that the wild-type band was 999bp and the knockout mouse band was 279bp.

[0019] Figure 2 AtLAS knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Statistical graph of behavioral extinction of conditioned fear memory. (a) AtLAS gene knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) There was no significant difference in freezing rate during the fear memory acquisition phase, but there was a significant change in freezing rate during the fear memory extinction test. (b) AtLAS knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Changes in freezing rate during fear memory extinction (n=12). a was analyzed by t-test, b was analyzed by two-way ANOVA. Data are mean ± standard error, **P<0.01, ***P<0.001.

[0020] Figure 3 AtLAS knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Weight and morphology comparison chart. (a) is AtLAS + / -AtLAS - / - , and the body and brain morphology of normal wild-type mice. (b) is a comparison of AtLAS + / -AtLAS - / - , body weight statistics of wild-type mice (n=3). b One-way ANOVA was used. Data are mean ± standard error.

[0021] Figure 4 AtLAS knockout mice (AtLAS - / -) and control mice (AtLAS + / + ) Statistical graphs of social behavior in the open field, elevated cross, and three-box. (a) AtLAS gene knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Statistics of distance traveled in open field behavior. (b) AtLAS knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Statistics of time spent in the center area in open field behavior. (c) AtLAS knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Statistics of time spent in the open arms in the cross-elevated behavioral test. (d) AtLAS knockout mice (AtLAS - / - ) and control mice (AtLAS + / + ) Typical diagrams of social behavior in three boxes and statistics of social time with objects and new mice. a, b, c, d were analyzed by t test. Data are mean ± standard error. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0023] The present invention provides a method for establishing an AtLAS gene knockout mouse model, comprising the following steps: designing a gene knockout strategy for the mouse AtLAS gene, adopting a CRISPR-Cas9 gene editing method, and obtaining F0 generation mice; breeding positive F0 generation mice with C57BL / 6J to obtain positive F1 generation mice with AtLAS gene knockout; mating the F1 generation mice to obtain F2 generation mice with complete AtLAS gene knockout (AtLAS - / - ).

[0024] Furthermore, the CRISPR-Cas9 gene editing method includes designing and constructing 5S1sgRNA and 3S1sgRNA, respectively, whose base sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and performing in vitro activity tests to prepare a Cas9 nuclease mixed system; and combining sgRNA with Cas9 protein to guide Cas9 nuclease to target genomic DNA for shearing.

[0025] The specific steps are as follows: (1) designing a gene knockout strategy for the mouse AtLAS non-coding RNA (sequence as shown in SEQ ID NO: 5); (2) designing and constructing 5S1 sgRNA and 3S1 sgRNA respectively, and conducting in vitro activity tests to prepare a Cas9 nuclease mixed system; (3) injecting the Cas9 nuclease mixed system into fertilized eggs for transplantation to obtain F0 generation mice; (4) breeding the positive F0 generation mice with C57BL / 6J to obtain positive F1 generation mice with AtLAS gene knockout (AtLAS + / - The F1 mice were then mated to obtain the F2 mice with complete knockout of the AtLAS gene (AtLAS - / - ). Further, the 5S1 sgRNA and 3S1 sgRNA are 5S1: GTAAAAACGAAGGGTACACGGGG; 3S1: ACCCAGCCATGTCACCGCAAAGG. Further, the cas9 mixed system includes two sgRNAs, 5S1 and 3S1, and cas9. Further, the cas9 mixed system includes 20 ng / μl of Cas9 protein, and the concentrations of the two sgRNAs are 10 ng / μl each. Further, the positive F1 generation mice are used for seed preservation and establishment, and mating between different seed preservation and establishment lines is not allowed in principle.

[0026] The present invention also provides the use of AtLAS knockout mice as a model mouse for the onset study of PTSD. The mice were behaviorally tested using the classic cued conditioned fear memory extinction paradigm. First, 12 male 8-10 week wild-type mice and knockout mice were selected. Before the experiment, the experimenter was contacted for 3 minutes every day for 3 days before the experiment to reduce the stress of the mice. The behavioral training program is divided into 2 stages: cued conditioned fear memory formation and extinction training. On the first day of the experiment, the mice were placed in an electric shock box. At this time, the electric shock box scene was A, and the smell was low-concentration ethanol. After 3 minutes, the first foot shock (0.8mA, 1s) and sound (80db, 4000hz, 30s) were paired, that is, 1s electric shock was performed 29s after the sound appeared, and the sound and electric shock ended at the same time. After 5 such pairing exercises, the interval was 20s. After the last training, the mice were taken out and put back into the mouse cage 60s later, and the stiffness rate of each mouse was recorded. The mice were conditioned for fear memory on the second day. On the third day of the experiment, fear memory extinction training was performed. The mice were placed in the experimental box, and the scene of the experimental box was changed to scene B. The odor was low-concentration acetic acid. After 3 minutes of adaptation, 14 cycles of sound stimulation (80dB, 4000Hz, 20s) were presented, without electric shock. The interval between two adjacent sounds was 20s. 60s after the last training, the mice were taken out of the experimental box and put back into the cage, and the stiffness rate was recorded. On the fourth day of the experiment, the same operation was performed on the third day. Finally, the stiffness rate was counted. The study found that AtLAS gene knockout mice had obvious difficulty in extinction of fear memory and could be used as a PTSD model mouse.

[0027] The present invention also provides experimental data of the AtLAS gene knockout mouse model in other common behaviors. The results show that the mouse has no disorders in related behavioral tests such as depression, anxiety, autism, etc., suggesting that it is specific as a PTSD model mouse.

[0028] Example 1: Establishment of AtLAS knockout mouse model

[0029] 1. Cas9 mixed sample system

[0030] 1.sgRNA design.

[0031] The sgRNA sequences were designed as described below.

[0032] sgRNA name sgRNA sequence (5'→3')

[0033] 5S1 GTAAAAACGAAGGGTACACGGGG

[0034] 3S1 ACCCAGCCATGTCACCGCAAAGG

[0035] That is, the sequences SEQ ID NO:1 and SEQ ID NO:2.

[0036] 2. sgRNA in vitro activity test

[0037] The above two sgRNAs 5S1 and 3S1 were designed and synthesized, and the Cas9 in vitro enzyme cleavage target DNA sequence (sequence as shown in SEQ ID NO:6) was designed and synthesized. The Cas9 enzyme recognized the Pam sequence and cut it to obtain two DNA fragments (5S1 and 3S1 two sgRNAs). The percentage of DNA cleavage mediated by sgRNA was observed by agarose electrophoresis analysis to determine the activity and cutting efficiency of sgRNA. The results show that the cutting efficiency is 70% for 5S1 and 90% for 3S1, respectively, so the sgRNA activity is highly efficient.

[0038] 3. Prepare a Cas9 mixed system, which includes two sgRNAs (i.e., 5S1 and 3S1) and Cas9, with the concentration of Cas9 protein being 20 ng / μl and the concentration of the two sgRNAs being 10 ng / μl each.

[0039] 2. Microinjection and transplantation

[0040] The method for preparing F0 generation mice comprises the following steps: superovulation of mice; injection of fertilized eggs and transplantation; obtaining F0 generation mice. Mouse strain: C57BL / 6J

[0041] Specific methods:

[0042] 1. Selection of experimental mice

[0043] Mice of 5-6 weeks old and weighing 18-22 g were selected.

[0044] 2. Mouse superovulation and injection of fertilized eggs Mouse superovulation and injection refers to the use of 4-week-old female mice, first injected with pregnant mare serum gonadotropin (PSMG), 48 hours later injected with HCG, 24 hours later egg retrieval, and then in vitro fertilization to obtain fertilized eggs. The cas9 mixed system is mixed and injected into the fertilized eggs, and then transplanted into pseudo-pregnant mother mice to obtain F0 generation mice.

[0045] 3. After the transplantation injection is completed, the fertilized eggs are transplanted into the uterus of the pseudo-pregnant female mouse. The transplanted recipients are kept in pairs in a cage and will be continuously observed within one week after the operation. If there is a pain reaction, an analgesic will be given in time.

[0046] 3. Identification and breeding of F0 generation mice The F0 mice born by microinjection were identified by PCR and electrophoresis. The PCR amplification primers and PCR reaction system are as follows:

[0047] Ak013786-PCR-S:ACAGTCTGGTGCAGTTCGA

[0048] Ak013786-PCR-A:CACAGATGACGCACTTAG

[0049] That is, the sequences SEQ ID NO:3 and SEQ ID NO:4.

[0050] The PCR reaction system is: 20 ng of mouse tail DNA template, 1 μL of upstream and downstream primers, 6 μL of 2×Taq Master Mix (Vazyme, P111-01), and H2O added to a total volume of 12 μL. The PCR reaction program is: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 30 seconds, 35 cycles; 72°C final extension for 10 minutes. The PCR product with wild-type mouse tail DNA as template is 999 bp, and the knockout mouse band is 279 bp. Take 10 μL of PCR product and first perform agarose electrophoresis detection. If the electrophoresis shows obvious bands, it is identified as the corresponding mouse (see for details). Figure 1 ).

[0051] Example 2

[0052] The PTSD model mice with AtLAS deficiency obtained in Example 1 (genotype: AtLAS - / - ) and control mice (genotype AtLAS + / + ) was used to conduct behavioral tests on fear memory extinction. First, 12 male 8-10 week old wild-type mice and 12 knockout mice were selected. Before the experiment, the experimenter was contacted for 3 minutes every day for 3 days before the experiment to reduce the stress of the mice. The behavioral training procedure is divided into 2 stages: cue-conditioned fear memory formation and extinction training. On the first day of the experiment, we put the mice into the shock box. At this time, the shock box scene was A and the smell was low-concentration ethanol. After 3 minutes, the first foot shock (0.8mA, 1s) and sound (80db, 4000hz, 30s) were paired, that is, 1s electric shock was performed 29s after the sound appeared, and the sound and electric shock ended at the same time. After 5 such pairing exercises, with an interval of 20s, the mice were taken out and put back into the cage 60s after the last training, and the stiffness rate of each mouse was recorded. On the second day, the mice were not treated specially and the fear memory was consolidated. On the third day of the experiment, fear memory extinction training was performed. The mice were placed in the experimental box, and the scene of the experimental box was changed to scene B. The odor was low-concentration acetic acid. After 3 minutes of adaptation, 14 cycles of sound stimulation (80dB, 4000Hz, 20s) were presented, without electric shock. The interval between two adjacent sounds was 20s. 60s after the last training, the mice were taken out of the experimental box and put back into the cage, and the freezing rate was recorded. On the fourth day of the experiment, the same operation was performed as on the third day. The experimental results showed that AtLAS - / - Mice and AtLAS + / +There was no significant difference in fear memory formation between mice and Figure 2 a), but after extinction training, AtLAS - / - The freezing rate of mice was significantly higher than that of AtLAS + / + Mouse ( Figure 2 a, b) in the figure demonstrate that knockout mice have difficulty in extinction of fear memory and are a good PTSD model.

[0053] At the same time, the present invention detected 2-month-old AtLAS - / - Mice and 2-month-old AtLAS + / + There are no significant differences in morphology and weight between the two, nor in brain appearance ( Figure 3 a, b in the figure). Meanwhile, the present invention performs other behavioral tests on mice. In the open field test (OFT), compared with the control group, there was no significant difference in the movement distance of mice, and there was no significant difference in the movement time in the central area ( Figure 4 The results of the cross-elevation test showed that there was no significant difference in the percentage of time that mice entered the open arm compared with the control group ( Figure 4 c). In the three-box social experiment, there was no significant difference in the social interaction of mice compared with the control group ( Figure 4 In summary, there was no difference in the mice's motor ability, anxiety, or social ability.

[0054] In summary, the present invention discovered for the first time that AtLAS knockout mice exhibited an obvious phenotype of difficulty in extinction of fear memory, and did not show related psychiatric behavioral disorders such as depression, anxiety, autism, etc., indicating that the mice can not only serve as a good model of post-traumatic stress disorder PTSD, but can also be applied to basic scientific research in the future, such as using the mice to explore the molecular mechanism of PTSD pathogenesis (including but not limited to mRNA, important neurotransmitters, hormones and non-coding RNA, protein molecules, etc.), neural circuit mechanism, abnormal synaptic plasticity mechanism and the role of internal and external environmental factors (including but not limited to stress, intestinal flora, metabolic abnormalities, vascular system abnormalities, etc.) in the onset of PTSD; the mice can also be used as a model of difficulty in extinction of fear memory to study the basic neurobiological mechanisms of the formation, consolidation and extinction of fear memory. At the same time, this mouse model can also be applied to the research and development of PTSD-related drugs. For example, this mouse can be used as a mouse model of PTSD to evaluate and identify the efficacy of various drugs (including but not limited to various preclinical experimental drugs, drug precursors, drug or compound screening based on possible targets, and testing of new uses of known drugs) in improving the ability to extinct fear memory.

[0055] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of gene knockout model mice as post-traumatic stress disorder model mice, characterized in that: The gene knockout model mouse was constructed by the following method: (1) adding guide RNAs with base sequences of SEQ ID NO: 1 and SEQ ID NO: 2 to Cas9 nuclease to obtain a Cas9 nuclease mixed system; (2) injecting the Cas9 nuclease mixed system obtained in step (1) into mouse fertilized eggs, so that the AtLAS gene in the fertilized eggs is cut by the Cas9 nuclease, and then transplanting them into mother mice to obtain F0 generation mice; (3) The positive F0 mice are bred with C57BL / 6J mice to obtain chimeric positive F1 mice with AtLAS gene knockout, and the F1 mice are then mated to obtain F2 mice with complete AtLAS gene knockout, thus obtaining the gene knockout model mice.

2. The use according to claim 1, characterized in that In step (1), the concentration of Cas9 nuclease in the Cas9 nuclease mixed system is 20 ng / ul-30 ng / ul, and the concentrations of the guide RNAs having base sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are 10 ng / ul-20 ng / ul, respectively.

3. The use according to claim 1, characterized in that The positive F0 generation mice in step (3) are obtained by identifying the F0 generation mice obtained in step (2), and PCR amplification is performed using primers having base sequences of SEQ ID NO: 3 and SEQ ID NO:

4. If electrophoresis shows a band indicating AtLAS gene knockout, the mice are identified as positive F0 generation mice.

Images