Specific primer set for detecting resistant alopecuroides and LAMP kit and method thereof

Abstract

The present invention relates to a specific primer set for detecting resistant alopecuroides and a LAMP kit and method thereof; the specific primer set for detecting resistant alopecuroides includes a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP. The specific primer set of the present invention can be used for LAMP detection of resistant alopecuroides, and the LAMP detection method provided by the present invention can specifically detect resistant alopecuroides containing Ile‑2041‑Asn mutations, and can be used to detect field resistant alopecuroides populations, thereby timely discovering whether there are resistant alopecuroides populations in the field, and controlling the spread of field resistant alopecuroides populations. At the same time, the specific primer set of the present invention can be prepared into a LAMP kit, which is easy to use.

Description

Technical Field

[0001] The invention relates to the field of agricultural science and technology, and in particular to a specific primer set for detecting resistant alopecuroides and a LAMP kit and a method thereof. Background Art

[0002] Alopecurus aequalis Sobol. is one of the common annual malignant weeds in farmland. It has a large seed yield, high plant maturity rate, and strong adaptability to adverse environments. It is a serious threat to crops such as wheat and rapeseed, which can cause a large reduction in their yield. Fenoxaprop-P-ethyl is the main agent for the control of Alopecurus aequalis. However, long-term single use of fenoxaprop-P-ethyl will not only make Alopecurus aequalis gradually resistant to fenoxaprop-P-ethyl, but also show cross-resistance to other agents. Studies have found that resistance mutations in the herbicide target enzyme gene ACCase are an important cause of Alopecurus aequalis resistance, among which Ile-2041-Asn mutation is one of the main mutations that cause Alopecurus aequalis to develop resistance to herbicides such as fenoxaprop-P-ethyl.

[0003] In order to control the spread of resistant Alopecurus in the field, it is necessary to promptly detect whether there are resistant Alopecurus populations in the field. However, the current detection method of resistant Alopecurus mainly relies on traditional gene amplification and sequencing, which requires expensive PCR (polymerase chain reaction) instruments. The process is cumbersome, time-consuming, and has low sensitivity. In addition, the test results are easily affected by other types of weeds with the Ile-2041-Asn mutation. Summary of the invention

[0004] Based on this, it is necessary to provide a specific primer set and a LAMP kit and method for detecting resistant alopecuroides in order to address the above problems; the specific primer set can quickly and specifically detect resistant alopecuroides with Ile-2041-Asn mutation, and is easy to operate, highly sensitive and inexpensive.

[0005] The present invention provides a specific primer set for detecting resistant alopecuroides, wherein the specific primer set comprises a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP, wherein:

[0006] The nucleotide sequence of the forward outer primer F3 is: 5'GAGGGATTCCTGTTGGTGTT3';

[0007] The nucleotide sequence of the reverse outer primer B3 is: 5'TTAGCTTCAAAAAGATCTCTTTGTCC3';

[0008] The nucleotide sequence of the forward inner primer FIP is: 5'GGAACAGACCGCTCATGGGAACCATGATGCAGCTCGTCC3';

[0009] The nucleotide sequence of the reverse inner primer BIP is: 5'TCTGCTACCAAGACAGCGCAGGCCTCTCCAGTTAGCAAGG3'.

[0010] A LAMP kit for detecting resistant alopecuroides, the LAMP kit comprising the specific primer set.

[0011] In one embodiment, the mass ratio of the first specific primer pair to the second specific primer pair is 1:50-5:4.

[0012] In one embodiment, in the LAMP kit, the concentration of the forward inner primer FIP is 35 μmol / L-45 μmol / L, the concentration of the reverse inner primer BIP is 35 μmol / L-45 μmol / L, the concentration of the forward outer primer F3 is 3 μmol / L-7 μmol / L, and the concentration of the reverse outer primer B3 is 3 μmol / L-7 μmol / L.

[0013] In one embodiment, the LAMP kit further includes 10× amplification buffer, dNTP, MgSO4, BstDNA polymerase, betaine, genomic DNA and water.

[0014] A method for detecting resistant Alopecuroides, comprising the following steps:

[0015] Extracting genomic DNA from the sample to be tested as template DNA;

[0016] The template DNA and the specific primer set are configured to form a LAMP reaction system, or the template DNA and the LAMP kit are configured to form a LAMP reaction system;

[0017] Allowing the LAMP reaction system to perform an amplification reaction to obtain an amplification product;

[0018] The amplified product is subjected to gel electrophoresis, and the result is analyzed according to the bands, or a fluorescent dye is added to the amplified product to obtain a reaction product, and the result is analyzed according to the RGB value of the reaction product.

[0019] In one embodiment, the volume of the LAMP reaction system is 25 μL, which includes the MgSO4 at a concentration of 90 mmol / L-110 mmol / L, the betaine at a concentration of 3 mol / L-5 mol / L, the specific primer set at a concentration of 5 μmol / L-40 μmol / L, the Bst DNA polymerase at a concentration of 4 U-16 U, the template DNA at a concentration of 0.5 μL-1.5 μL, the 10× amplification buffer at a concentration of 1 μL-5 μL, and the balance is water.

[0020] In one embodiment, in the step of subjecting the LAMP reaction system to an amplification reaction, the temperature is 60°C-65°C and the time is 45min-60min, or, it is carried out in two stages, the temperature of the first stage is 60°C-65°C and the time is 45min-60min; the temperature of the second stage is 80°C and the time is 10min.

[0021] In one embodiment, in the step of adding a fluorescent dye to the amplification product, 0.01 mL-0.02 mL of the fluorescent dye is added per mL of the amplification product.

[0022] In one embodiment, the fluorescent dye is selected from at least one of SYBR Green I, HNB or calcein.

[0023] The specific primer set provided by the present invention can be used for detecting resistant alopecurus with Ile-2041-Asn mutation in a LAMP (loop-mediated isothermal amplification) reaction system. Since the specific primer set provided by the present invention can specifically identify six independent regions of the ACCase gene of the resistant alopecurus, the specificity and sensitivity are extremely high. When the specific primer set provided by the present invention is used for detecting resistant alopecurus with Ile-2041-Asn mutation in a LAMP reaction system, on the one hand, the resistant alopecurus with Ile-2041-Asn mutation can be specifically detected without being affected by other resistant weeds such as multiflora ryegrass with Ile-2041-Asn mutation. On the other hand, the detection limit can reach 2.4×10 -4 ng / μL or less.

[0024] Therefore, the specific primer set provided by the present invention can be well used to detect resistant Alopecurus muskegum populations in the field, and can timely discover whether resistant Alopecurus muskegum populations exist in the field, and control the spread of resistant Alopecurus muskegum populations in the field; at the same time, the specific primer set of the present invention can be prepared into a LAMP kit, which is easy to use, simple to operate, highly sensitive and inexpensive. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1The electrophoresis pattern of the resistant Alopecurus australis detected by the LAMP kit in Example 2, wherein M is a 2000 bp marker, R is a resistant Alopecurus australis DNA with Ile-2041-Asn mutation, S is a sensitive Alopecurus australis DNA without Ile-2041-Asn mutation, and CK is a sterile water control without DNA added;

[0026] Figure 2 This is a graph showing the detection result of the LAMP kit for detecting resistant Alopecurus in normal light in Example 2, wherein R is the resistant Alopecurus DNA with the Ile-2041-Asn mutation, S is the sensitive Alopecurus DNA without the Ile-2041-Asn mutation, and CK is a sterile water control without DNA added;

[0027] Figure 3 This is a graph showing the detection result of the LAMP kit under ultraviolet light for detecting resistant Alopecurus in Example 2, wherein R is the resistant Alopecurus DNA with the Ile-2041-Asn mutation, S is the sensitive Alopecurus DNA without the Ile-2041-Asn mutation, and CK is a sterile water control without DNA added;

[0028] Figure 4 The electrophoretic pattern of the sensitivity of the detection method for testing resistant alopecuroides in Example 3, wherein M is a 2000 bp marker, and 1-8 are concentrations of 240 ng / μL, 24 ng / μL, 2.4 ng / μL, 2.4×10 -1 ng / μL、2.4×10 -2 ng / μL、2.4×10 -3 ng / μL、2.4×10 -4 ng / μL、2.4×10 -5 ng / μL resistance depends on Alopecurus DNA, CK is the sterile water control without DNA added;

[0029] Figure 5 The results of the normal light test for the sensitivity of the method for testing the resistance of Alopecurus mume in Example 3 are shown in Figure 1-8, where concentrations 1-8 are 240 ng / μL, 24 ng / μL, 2.4 ng / μL, 2.4×10 -1 ng / μL、2.4×10 -2 ng / μL、2.4×10 - 3 ng / μL、2.4×10 -4 ng / μL、2.4×10 -5 ng / μL resistance depends on Alopecurus DNA, CK is the sterile water control without DNA added;

[0030] Figure 6The electrophoretic pattern of the PCR amplification sensitivity of the test resistant alopecuroides in Example 3, wherein M is a 2000 bp marker, and 1-8 are concentrations of 240 ng / μL, 24 ng / μL, 2.4 ng / μL, 2.4×10 -1 ng / μL、2.4×10 -2 ng / μL、2.4×10 -3 ng / μL、2.4×10 -4 ng / μL、2.4×10 -5 ng / μL resistance depends on Alopecurus DNA, CK is the sterile water control without DNA added;

[0031] Figure 7 The electrophoretic profile of the resistant ryegrass amplified by the LAMP method in Example 4, wherein M is a 2000 bp marker; R is a resistant ryegrass DNA with the Ile-2041-Asn mutation; S is a sensitive ryegrass DNA without the Ile-2041-Asn mutation; CK is a sterile water control without DNA added;

[0032] Figure 8 This is a graph showing the detection results of amplifying resistant ryegrass under normal light using the LAMP method in Example 4, wherein R is resistant ryegrass DNA with the Ile-2041-Asn mutation; S is sensitive ryegrass DNA without the Ile-2041-Asn mutation; and CK is a sterile water control without the addition of DNA. DETAILED DESCRIPTION

[0033] For ease of understanding of the present invention, the present invention will be described more fully below with reference to relevant embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0035] The present invention uses the genome sequence of sensitive Alopecurus myosus acetyl-CoA carboxylase (ACCase) that has not been mutated in the GenBank database (accession number KX571248) as a reference sequence, and designs a specific primer set for detecting resistant Alopecurus myosus provided by the present invention according to the reference sequence. The specific primer set includes a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP, wherein:

[0036] The nucleotide sequence of the forward outer primer F3 was: 5′GAGGGATTCCTGTTGGTGTT3′;

[0037] The nucleotide sequence of the reverse outer primer B3 was: 5′TTAGCTTCAAAAAGATCTCTTTGTCC3′;

[0038] The nucleotide sequence of the forward inner primer FIP was: 5′GGAACAGACCGCTCATGGGAACCATGATGCAGCTCGTCC3′;

[0039] The nucleotide sequence of the reverse inner primer BIP is: 5'TCTGCTACCAAGACAGCGCAGGCCTCTCCAGTTAGCAAGG 3'.

[0040] The specific primer set provided by the present invention can be used for detecting resistant alopecuroides with Ile-2041-Asn mutation in a LAMP reaction system. Since the specific primer set provided by the present invention can specifically identify six independent regions of the ACCase gene of the resistant alopecuroides, the specificity and sensitivity are extremely high. When the specific primer set provided by the present invention is used for detecting resistant alopecuroides with Ile-2041-Asn mutation in a LAMP reaction system, on the one hand, the resistant alopecuroides with Ile-2041-Asn mutation can be specifically detected without being affected by other resistant weeds such as multiflora ryegrass with Ile-2041-Asn mutation. On the other hand, the detection limit can reach 2.4×10 -4 ng / μL or less.

[0041] Therefore, the specific primer set provided by the present invention can be well used to detect resistant Alopecurus muskegia populations in the field, and can timely discover whether resistant Alopecurus muskegia populations exist in the field, thereby controlling the spread of resistant Alopecurus muskegia populations in the field.

[0042] The present invention also provides a LAMP kit for detecting resistant alopecuroides, and the LAMP kit for detecting resistant alopecuroides comprises the above-mentioned specific primer set.

[0043] In order to make the LAMP kit for detecting resistant alopecuroides have a lower detection limit, preferably, the mass ratio of the first specific primer pair to the second specific primer pair is 1:50-5:4.

[0044] In one embodiment, in the LAMP kit for detecting resistant alopecuroides, the concentration of the forward inner primer FIP is 35 μmol / L-45 μmol / L, the concentration of the reverse inner primer BIP is 35 μmol / L-45 μmol / L, the concentration of the forward outer primer F3 is 3 μmol / L-7 μmol / L, and the concentration of the reverse outer primer B3 is 3 μmol / L-7 μmol / L.

[0045] In one embodiment, the LAMP kit for detecting resistant alopecuroides also includes 10× amplification buffer, dNTP (deoxyribonucleoside triphosphate), MgSO4, Bst DNA polymerase, betaine, genomic DNA and water. When used, the LAMP reaction system of corresponding concentration is configured as needed.

[0046] In order to avoid the presence of other DNA interfering with the detection results, preferably, the water in the LAMP kit for detecting resistant alopecuroides is sterile water.

[0047] The LAMP kit for detecting resistant alopecuroides provided by the present invention can quickly and specifically detect resistant alopecuroides with Ile-2041-Asn mutation, thereby avoiding the influence of the malignant weed resistant alopecuroides on economic crops and ensuring the healthy development of economic crops in farmland; meanwhile, the LAMP kit for detecting resistant alopecuroides provided by the present invention is easy to use, simple to operate, highly sensitive and inexpensive.

[0048] The present invention also provides a method for detecting resistant Alopecuroides, comprising the following steps:

[0049] S10, extracting genomic DNA of the sample to be tested as template DNA;

[0050] S20, configuring the template DNA with the specific primer set and the LAMP kit to form a LAMP reaction system;

[0051] S30, performing an amplification reaction on the LAMP reaction system to obtain an amplification product;

[0052] S40, performing gel electrophoresis on the amplified product and analyzing the result according to the bands, or adding fluorescent dye to the amplified product to obtain a reaction product and analyzing the result according to the RGB value of the reaction product.

[0053] In step S10, the present invention does not impose any particular limitation on the method for extracting genomic DNA of the sample to be tested. In one embodiment, the genomic DNA of the sample to be tested can be extracted by the CTAB method or a DNA extraction kit.

[0054] In step S20, in order to meet the requirements of visualization of reaction results and save costs to the greatest extent, in one embodiment, the volume of the above-mentioned LAMP reaction system is 25 μL, which includes MgSO4 with a concentration of 90 mmol / L-110 mmol / L, 3 mol / L-5 mol / L betaine, 5 μmol / L-40 μmol / L specific primer set, 4U-16U Bst DNA polymerase, 0.5 μL-1.5 μL template DNA, 1 μL-5 μL 10× amplification buffer, and the balance is water.

[0055] In order to avoid the presence of other DNA interfering with the detection results, preferably, the water in the above LAMP reaction system is sterile water.

[0056] In step S30, in order to provide mild reaction conditions and maximize the detection efficiency, the temperature of the LAMP reaction system is 60°C-65°C and the time is 45min-60min in the step of amplification reaction, or, it is carried out in two stages, the temperature of the first stage is 60°C-65°C and the time is 45min-60min; the temperature of the second stage is 80°C and the time is 10min.

[0057] In step S40, according to the band analysis results, the amplified product may be subjected to gel electrophoresis using 2%-3% agarose gel.

[0058] Specifically, the method for preparing an agarose gel plate comprises the following steps: preparing agarose gel at a ratio of 2%-3%, weighing 1.0g-1.5g agarose with an analytical balance, adding it to 50mL 1×TBE buffer and shaking it, heating it in a microwave oven until it is completely dissolved, adding 3μL-4μL of nucleic acid dye to the agarose gel solution and mixing it, pouring it into the gel groove of a medium gel plate, inserting a comb with an appropriate number of teeth, cooling it at room temperature and standing it for 15min-20min, and after solidification, pulling out the combs on both sides at the same time to remove excess gel at the edge, and the preparation is completed.

[0059] The specific operation method of gel electrophoresis includes the following steps: put the prepared agarose gel into the electrophoresis tank, add 1×TBE buffer to cover the gel. Add 5μL-10μL DNAMarker 2000, and add 5μL-10μL amplification product of the sample to be tested. Perform nucleic acid electrophoresis at a constant voltage of 80V-100V for 60min-90min. Observe and record the amplification bands of each sample to be tested through the gel imaging system, and analyze the identification results.

[0060] When the results are analyzed based on the RGB values ​​of the reaction products, in one embodiment, 0.01 mL to 0.02 mL of fluorescent dye is added per mL of amplification product.

[0061] In one embodiment, the fluorescent dye is selected from at least one of SYBR Green I, HNB or calcein, and the fluorescent dye can present different RGB values ​​according to the changes in the components in the reaction solution. When the RGB value of the reaction product is (80, 60, 40)-(140, 110, 90), it indicates that the sample to be tested does not contain the DNA of resistant Alopecurus, and the test result is negative. When the RGB value is (120, 130, 50)-(255, 255, 114), it indicates that the sample to be tested contains the DNA of resistant Alopecurus, and the test result is positive.

[0062] The advantage of LAMP reaction is that it is carried out under constant temperature conditions. The experiment can be carried out in a constant temperature water bath or equipment with a stable heat source. The result can be determined by the change in the RGB value of the reaction product, and there is no need for expensive instruments such as PCR instruments. Not only is the amplification reaction extremely fast, generally completed within 1 hour, but the amount of product produced by amplification is large, and the result can even be determined by the naked eye without electrophoresis, only by adding fluorescent dyes.

[0063] The method for detecting resistant alopecuroides provided by the invention can quickly and specifically detect resistant alopecuroides with Ile-2041-Asn mutation, and has the advantages of simple and rapid operation, high sensitivity and low price.

[0064] Hereinafter, the specific primer set and LAMP kit and method for detecting resistant Alopecurus alopecurus will be further described through the following specific examples.

[0065] Example 1: Design of specific primer sets for LAMP reaction

[0066] Based on the Ile-2041-Asn mutation type in which the 2041th amino acid of the ACCase gene of alopecuroid-resistant Alopecuroides mutates from Ile to Asn, LAMP primers were designed. The mutation site of the primer was located at the 5' end of the reverse outer primer B3, and two base mismatch mutations were made downstream of the mutation site. LAMP reaction was carried out using DNA of sensitive and resistant populations of Alopecuroides as templates, and a LAMP primer set that can specifically identify alopecuroid-resistant Alopecuroides population containing the Ile-2041-Asn mutation was selected.

[0067] The selected primer sequences are as follows:

[0068] F3 is: 5'GAGGGATTCCTGTTGGTGTT3';

[0069] B3 is: 5′TTAGCTTCAAAAAGATCTCTTTGTCC3′;

[0070] FIP is: 5'GGAACAGACCGCTCATGGGAACCATGATGCAGCTCGTCC3';

[0071] The BIP is: 5'TCTGCTACCAAGACAGCGCAGGCCTCCAGTTAGCAAGG3'.

[0072] Among the 5'-end bases of the reverse outer primer B3, the first base T is a point mutation base of Alopecurus nucifera resistance to fenoxaprop-butyl, and the third and fourth bases "AG" are artificially set mismatch mutation bases.

[0073] Example 2: LAMP kit system optimization

[0074] Taking the optimal reaction time and temperature as optimization indicators, Bst DNA polymerase, MgSO4, primer pairs FIP / BIP and F3 / B3, and betaine in the LAMP kit were optimized through single-factor experiments.

[0075] Optimize Bst DNA polymerase: select 0.5μL, 1μL, 1.5μL, and 2μL of BstDNA polymerase with an enzyme activity of 8U / μL, 1μL of MgSO4 with a concentration of 100mmol / L, 2μL of primer pair FIP and BIP with a concentration of 40μmol / L, 1μL of primer pair F3 and B3 with a concentration of 5μmol / L, and 5μL of betaine with a concentration of 4mol / L.

[0076] Optimize MgSO4: select 1μL, 1.5μL, 2μL, 2.5μL, 3μL, 3.5μL, and 4μL of 100mmol / L MgSO4, 1μL of 8U / μL Bst DNA polymerase, 2μL of 40μmol / L primer pair FIP and BIP, 1μL of 5μmol / L primer pair F3 and B3, and 5μL of 4mol / L betaine.

[0077] The primer pairs FIP and BIP were optimized: 1 μL, 1.5 μL, 2 μL, 2.5 μL, 3 μL, 3.5 μL, and 4 μL of primer pairs FIP and BIP with a concentration of 40 μmol / L, 1 μL of MgSO4 with a concentration of 100 mmol / L, 1 μL of BstDNA polymerase with an enzyme activity of 8 U / μL, 1 μL of primer pair F3 and B3 with a concentration of 5 μmol / L, and 5 μL of betaine with a concentration of 4 mol / L were selected respectively.

[0078] The primer pairs F3 and B3 were optimized: 2μL, 2.5μL, 3μL, 3.5μL, 4μL, 4.5μL, 5μL, 5.5μL, and 6μL of primer pairs F3 and B3 with a concentration of 40μmol / L, 1μL of MgSO4 with a concentration of 100mmol / L, 1μL of Bst DNA polymerase with an enzyme activity of 8U / μL, 2μL of primer pairs FIP and BIP with a concentration of 5μmol / L, and 5μL of betaine with a concentration of 4mol / L were selected respectively.

[0079] Betaine was optimized by selecting 1 μL, 1.5 μL, 2 μL, 2.5 μL, 3 μL, 3.5 μL, and 4 μL of primer pair F3 and B3 with a concentration of 40 μmol / L, 1 μL of MgSO4 with a concentration of 100 mmol / L, 1 μL of Bst DNA polymerase with an enzyme activity of 8 U / μL, 2 μL of primer pair FIP and BIP with a concentration of 5 μmol / L, and 5 μL of betaine with a concentration of 4 mol / L.

[0080] The LAMP reaction conditions were optimized: taking reaction sensitivity as the optimization index, the temperatures of 60℃, 61℃, 62℃, 63℃, 64℃, and 65℃ were selected for reaction time of 50 min, and then a secondary reaction was carried out at a temperature of 80℃ for 10 min. After selecting the optimal temperature, the reaction times of 45min, 50min, and 55min were selected, and then a secondary reaction was carried out at a temperature of 80℃ for 10 min to select the optimal reaction temperature and time.

[0081] Through the above optimization, the optimal system of LAMP kit was obtained: 10×isothermal amplification buffer 2.5μL, 100mmol / L MgSO4 1.5μL, 10mmol / L dNTP 3μL, 40μmol / L FIP 2μL, 40μmol / L BIP 2μL, 5μmol / L F31μL, 5μmol / L B31μL, 4mol / L betaine 5μL, 8U / μL Bst DNA polymerase 1μL, genomic DNA 1μL, add sterile water to prepare, the total volume is 25μL, and store at -20℃ for 1 year; the optimal reaction conditions of LAMP are: 65℃, 45min.

[0082] Figure 1 This is the electrophoresis pattern of the LAMP kit to detect the resistance of Alopecurus nucifera; Figure 2 This is a graph showing the results of the LAMP kit detecting resistant Alopecurus mume under normal light. The CKRGB values ​​of the resistant population R, the sensitive population S, and the sterile water control are (161, 156, 98), (126, 89, 71), and (128, 99, 81), respectively (the colors are yellow, orange-red, and orange-red, respectively); Figure 3 This is the result of the LAMP kit testing the resistance of Alopecurus nucifera under ultraviolet light. The colors of the resistant population R, sensitive population S, and sterile water control CK are bright white, dark gray, and dark gray, respectively. Figure 1 , Figure 2 and Figure 3 It can be seen that the LAMP kit optimized in this example can detect the Ile-2041-Asn mutation of resistant alopecuroides, which proves that the LAMP kit optimized in this example is effective.

[0083] Example 3: LAMP kit sensitivity detection

[0084] In order to determine the sensitivity of the LAMP kit, a sensitivity comparison analysis was performed with the common PCR amplification product. The optimized LAMP kit was used to purify the genomic DNA of the resistant Alopecurus nucifera containing the Ile-2041-Asn mutation as the template DNA, and the template DNA was diluted with sterile water to a concentration of 240 ng / μL, 24 ng / μL, 2.4 ng / μL, and 2.4×10 -1 ng / μL、2.4×10 -2 ng / μL、2.4×10 -3 ng / μL、2.4×10 -4 ng / μL、2.4×10 -5 ng / μL, the diluted template DNA was used as the amplification template, and 1μL of the diluted template DNA was taken for LAMP and PCR amplification. The LAMP conditions were: the first stage temperature was 65℃, the time was 45min, the second stage temperature was 80℃, the time was 10min; the PCR amplification conditions were: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30s; 59℃ annealing for 30s; 72℃ extension for 20s; 72℃ final extension for 2min; 35 cycles from denaturation to extension. The results are as follows. Figure 4 , Figure 5 , Figure 6 shown.

[0085] Figure 4 The electrophoresis pattern for testing the sensitivity of the detection method for resistant Alopecurus mume; Figure 5 This is a test result diagram under normal light for testing the sensitivity of the detection method for resistant Alopecurus mume, in which the 1-7RGB values ​​are (219, 221, 96), (170, 166, 69), (146, 159, 79), (135, 156, 61), (131, 155, 61), (125, 136, 60), (141, 136, 72) (yellow), and the 8 and CKRGB values ​​are (121, 105, 79), (118, 99, 73) (orange-red); Figure 6To test the resistance, the electrophoresis pattern of PCR amplification sensitivity of Alopecurus mume was used. Figure 4 , Figure 5 and Figure 6 It can be seen that the minimum detection limit of LAMP in this embodiment can reach 2.4×10 -4 ng / μL, while the detection limit of common PCR amplification is 2.4×10 -1 ng / μL, which proves that the LAMP detection method in this example has high sensitivity.

[0086] Example 4: LAMP reaction specificity detection

[0087] The optimized LAMP kit was used to purify the genomic DNA of the ryegrass containing the Ile-2041-Asn mutation and used as a template for LAMP reaction. The reaction conditions were 65°C and 45 min. The results were as follows: Figure 7 , Figure 8 shown.

[0088] Figure 7 This is the electrophoretic pattern of the LAMP method to amplify the resistant Lolium multiflorum; Figure 8 The figure is a normal light detection result diagram of the amplification of resistant multiflora ryegrass by LAMP method. The RGB values ​​of the resistant population R, the sensitive population S, and the sterile water control CK are (96, 79, 55), (91, 69, 48), and (94, 66, 45) respectively (all in orange-red color). It is proved that the LAMP reaction method of this embodiment is specific to the resistant Alopecurus alopecurus with Ile-2041-Asn mutation. The reason may be that although the CT region of the ACCase gene of different weeds is relatively conservative, the two pairs of primers designed by the present invention are for the six regions of the ACCase gene of Alopecurus alopecurus alopecurus, and the specificity is relatively high. The slight difference in the sequence between different species leads to the incompatibility of primers, reaction system and conditions.

[0089] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0090] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A specific primer set for detecting resistant Alopecurus mume, characterized in that: The specific primer set includes a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP, wherein: The nucleotide sequence of the forward outer primer F3 is: 5'GAGGGATTCCTGTTGGTGTT3'; The nucleotide sequence of the reverse outer primer B3 is: 5'TTAGCTTCAAAAAGATCTCTTT GTCC3'; The nucleotide sequence of the forward inner primer FIP is: 5'GGAACAGACCGCTCATGGGAACCATGATGCAGCTCGTCC3'; The nucleotide sequence of the reverse inner primer BIP is: 5'TCTGCTACCAAGACAGCGCAGGCCTCTCCAGTTAGCAAGG3'.

2. A LAMP kit for detecting resistant Alopecuroides, characterized in that: The LAMP kit comprises the specific primer set as claimed in claim 1.

3. The LAMP kit for detecting resistant Alopecurus mume according to claim 2, characterized in that The mass ratio of the first specific primer pair to the second specific primer pair is 1:50-5:

4.

4. The LAMP kit for detecting resistant Alopecurus mume according to claim 2, characterized in that In the LAMP kit, the concentration of the forward inner primer FIP is 35 μmol / L-45 μmol / L, the concentration of the reverse inner primer BIP is 35 μmol / L-45 μmol / L, the concentration of the forward outer primer F3 is 3 μmol / L-7 μmol / L, and the concentration of the reverse outer primer B3 is 3 μmol / L-7 μmol / L.

5. The LAMP kit for detecting resistant Alopecurus mume according to any one of claims 2 to 4, characterized in that: The LAMP kit also includes 10× amplification buffer, dNTP, MgSO4, Bst DNA polymerase, betaine, genomic DNA and water.

6. A method for detecting resistant Alopecurus mume, characterized in that: The following steps are involved: Extracting genomic DNA from the sample to be tested as template DNA; The template DNA is configured with the specific primer set as claimed in claim 1 to form a LAMP reaction system, or the template DNA is configured with the LAMP kit as claimed in any one of claims 2 to 5 to form a LAMP reaction system; Allowing the LAMP reaction system to perform an amplification reaction to obtain an amplification product; The amplified product is subjected to gel electrophoresis, and the result is analyzed according to the bands, or a fluorescent dye is added to the amplified product to obtain a reaction product, and the result is analyzed according to the RGB value of the reaction product.

7. The method for detecting resistant Alopecurus mume according to claim 6, characterized in that: Based on the volume of 25 μL of the LAMP reaction system, it includes MgSO4 with a concentration of 90 mmol / L-110 mmol / L, betaine of 3 mol / L-5 mol / L, the specific primer set of 5 μmol / L-40 μmol / L, 4 U-16 U of Bst DNA polymerase, 0.5 μL-1.5 μL of the template DNA, 1 μL-5 μL of 10× amplification buffer, and the balance is water.

8. The method for detecting resistant Alopecurus mume according to claim 6 or 7, characterized in that: In the step of subjecting the LAMP reaction system to amplification reaction, the temperature is 60°C-65°C and the time is 45min-60min, or it is carried out in two stages, the temperature of the first stage is 60°C-65°C and the time is 45min-60min; the temperature of the second stage is 80°C and the time is 10min.

9. The method for detecting resistant Alopecurus mume according to claim 6 or 7, characterized in that: In the step of adding fluorescent dye to the amplification product, 0.01 mL-0.02 mL of fluorescent dye is added per mL of amplification product.

10. The method for detecting resistant Alopecurus mume according to claim 6 or 7, characterized in that: The fluorescent dye is selected from at least one of SYBR Green I, HNB or calcein.

Images