A method for detecting Acorus calamus, Acorus calamus and Acorus tatarinowii based on multiple ligation probe amplification technology

Abstract

The present invention discloses a method for detecting Acorus calamus, Acorus calamus and Acorus tatarinowii based on multiple ligation probe amplification technology, which comprises the following steps: 1) extracting sample genomic DNA; 2) using genomic DNA as a template, designing specific primers to amplify nuclear gene fragments; 3) denaturing the amplified product and hybridizing it with an MLPA probe; 4) connecting the hybridization product using DNA ligase; 5) performing real-time fluorescence quantitative PCR amplification on the connection product using universal primers; 6) collecting melting curve signals and observing Tm values. The present invention can identify Acorus calamus, Acorus calamus and Acorus tatarinowii in a relatively short time, and can effectively detect mixed samples. The method has the advantages of strong specificity and high sensitivity, and has a good application prospect in the field of authenticity identification of traditional Chinese medicines.

Description

Technical Field

[0001] The invention belongs to the field of Chinese medicinal material identification, and particularly relates to a method for rapidly identifying Acorus calamus, Acorus calamus and Acorus gramineus based on a multiplex ligation probe amplification technology. Background Art

[0002] There are three types of calamus in the medicinal material market: stone calamus, water calamus, and nine-section calamus. Stone calamus is one of the commonly used wild Chinese medicinal materials. Its original species is the Acorus tatarinowii Schott of the Araceae family (included in Flora of China as Acorus gramineus Soland.), which has the effects of opening the mind and eliminating phlegm, refreshing the mind and improving intelligence, and removing dampness and appetizing. Water calamus is the dried rhizome of the Acorus calamus (Acorus calamus Linnaeus) of the Araceae family, which has the effects of warming the stomach, anti-inflammatory and analgesic. The ancients recorded "calamus" as stone calamus, and it was listed as the top grade of grass in "Shennong's Herbal Classic", and "one inch and nine sections are good" is regarded as the best quality, called "nine-section calamus". However, modern research regards the dried rhizome of Anemone altaica Fischer ex CAMeyer, a plant of the Ranunculaceae family, as Acorus calamus, which has the effects of opening the mind and removing phlegm, calming the nerves and invigorating the spleen. Existing studies have shown that the medicinal sources, chemical components, and pharmacological effects of Acorus calamus and Acorus calamus are different, and they cannot be replaced by each other. At present, in drug supervision, it is found that the drug management and use departments have misused Acorus calamus as Acorus calamus and Acorus calamus as Acorus calamus. At the same time, adulteration caused by homonymous substances in Acorus calamus medicinal materials has seriously affected the clinical efficacy. Therefore, it is particularly important to find a simple, efficient and reliable method to identify Acorus calamus, Acorus calamus, and Acorus calamus.

[0003] Multiplex ligation-dependent probe amplification (MLPA) is a new technology for qualitative and semi-quantitative analysis of target DNA sequences. It has the advantages of good specificity, high sensitivity, good repeatability, simple operation, high throughput and multiple detection. The principle is that the sample DNA sequence is denatured into a single strand at high temperature, the probe is hybridized with the target fragment, and the left and right probes are connected into a complete fragment under the action of ligase. All the connected fragments are amplified by universal primers, and the specific and highly sensitive analysis of the detection product is achieved by capillary electrophoresis. It has the advantages of good specificity, high sensitivity, simple operation and no sequencing. At present, this technology has been applied to clinical diagnosis of HPV, detection of food allergens and genetically modified ingredients, and authenticity identification of traditional Chinese medicines such as Fritillaria cirrhosa and Agkistrodon acutus. There is no report on the use of MLPA method to identify three calamus medicinal materials. Summary of the invention

[0004] The purpose of the present invention is to provide a method for quickly identifying Acorus calamus, Acorus calamus and Acorus gramineus. The method designs specific probes for the nuclear gene sequences of Acorus calamus, Acorus calamus and Acorus gramineus, adopts MLPA technology and combines melting curves, which not only improves the detection efficiency of the three calamus medicinal materials, but also has high detection sensitivity and specificity.

[0005] To achieve the above purpose, the present invention uses the following technical means:

[0006] A method for detecting Acorus calamus, Acorus calamus, and Acorus tatarinowii based on multiplex ligation probe amplification technology, comprising the following steps:

[0007] 1) Extracting sample genomic DNA;

[0008] 2) using the genomic DNA extracted in step 1) as a template, designing specific primers to amplify nuclear gene fragments of Acorus tatarinowii, Acorus calamus, and Acorus calamus;

[0009] 3) Denaturing the amplified product and hybridizing it with the MLPA probe;

[0010] 4) connecting the hybridization products of step 3) using DNA ligase;

[0011] 5) performing real-time fluorescence quantitative PCR amplification on the ligation product of step 4) using universal primers;

[0012] 6) Collect melting curve signals and observe Tm values,

[0013] There are 3 groups of MLPA probes, each group consists of a left probe and a right probe, wherein:

[0014] The first group of left probes: GGGTTCCCTAAGGGTTGGACGGGTCCGGTCGCGGCACGGCATGCGGTGGG (SEQ ID NO: 1); right probe: CTGAGAGAAAGAGTCCCTACCACTCGCTCTAGATTGGATCTTGCTGGCAC (SEQ ID NO: 2);

[0015] The second group of left probes: GGGTTCCCTAAGGGTTGGATTGATCGCGGCACGGCATGCGGTGGC (SEQ ID NO: 3); right probes: CTGAGAGAAAGAGTCCCTACCACTCGCTCTAGATTGGATCTTGCTGGCAC (SEQ ID NO: 2);

[0016] The third group of left probes: GGGTTCCCTAAGGGTTGGATTCAGAATTGTATACTCATCCCCCAAAGACGAAA (SEQ ID NO: 4); right probes: TGACGCGCACGCCTCGCCGCTCTCTAGATTGGATCTTGCTGGCAC (SEQ ID NO: 5).

[0017] Among them, the nucleotide sequence of the Acorus calamus nuclear gene fragment is shown as SEQ ID NO:6; the nucleotide sequence of the Acorus calamus nuclear gene fragment is shown as SEQ ID NO:7, and the nucleotide sequence of the Acorus calamus nuclear gene fragment is shown as SEQ ID NO:8.

[0018] Furthermore, the upstream and downstream primer sequences of the specific primers used to amplify the nuclear gene fragments of Acorus calamus, Acorus calamus, and Acorus tatarinowii are as follows;

[0019] Upstream primer: CGAGGGCACGCCTGCCT (SEQ ID NO: 9)

[0020] Downstream primer: GACGCTTCTCCAGACTACAAT (SEQ ID NO: 10)

[0021] Wherein, the upstream and downstream primer sequences of the universal primer are as follows:

[0022] Upstream primer: GGGTTCCCTAAGGGTTGGA (SEQ ID NO: 11)

[0023] Downstream primer: TCTAGATTGGATCTTGCTGGCAC (SEQ ID NO: 12)

[0024] The DNA ligase is 9°N DNA Ligase, which is used to connect the left and right probes.

[0025] Wherein, the hybridization temperature in step 3) is 70°C and the time is 20 min.

[0026] Wherein, the number of reaction cycles of the real-time fluorescence quantitative PCR amplification in step 5) is 36 cycles.

[0027] In step 6), the result is judged by observing the melting curve peak and Tm value of the sample. If the sample has a single melting curve peak and the Tm value is 84.32℃±0.07℃, it is Acorus calamus; if the sample has a single melting curve peak and the Tm value is 86.03℃±0.06℃, it is Acorus calamus; if the sample has a single melting curve peak and the Tm value is 82.53℃±0.05℃, it is Acorus calamus; if the sample has a single melting curve peak and the Tm value is 82.53℃±0.05℃, it is Acorus calamus; if the sample has two or three melting curve peaks with corresponding Tm values, it is a mixed sample of two or three types of Acorus calamus.

[0028] The beneficial effects of the present invention are as follows: the present invention can be used to identify Acorus calamus, Acorus calamus, Acorus tatarinowii and their mixed medicinal materials, which is conducive to standardizing the use of medicinal materials, improving the effectiveness and safety of clinical medication, and has a good application prospect in the field of authenticity identification of traditional Chinese medicinal materials. The method has strong specificity and high sensitivity, and can detect a very small amount of medicinal material DNA.

[0029] Compared with traditional MLPA, the present invention also shortens the time of hybridization between the probe and the target sequence, applies a ligase with higher ligation efficiency, and achieves the purpose of shortening the sample detection cycle. At the same time, the MLPA method is combined with the melting curve, and the sample is identified by observing the melting curve and Tm value, which further improves the detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the result of method detection specificity experiment.

[0031] Figure 2 It is the result of the method detection sensitivity experiment (Acorus calamus).

[0032] Figure 3 It is the result of the method detection sensitivity experiment (Acorus calamus).

[0033] Figure 4 This is the result of the method detection sensitivity experiment (Acorus calamus).

[0034] Figure 5 It is the test result of the method on the mixed sample (Acorus calamus + Acorus calamus).

[0035] Figure 6 It is the test result of the mixed sample (Acorus calamus + Acorus gramineus).

[0036] Figure 7 It is the test result of the mixed sample (Acorus calamus + Acorus gramineus). DETAILED DESCRIPTION

[0037] The present invention is described in detail below through specific embodiments.

[0038] Example 1 Extraction of genomic DNA from medicinal materials and amplification of target nuclear gene fragments

[0039] 1. Plant Genomic DNA Extraction

[0040] The Tiangen Plant Genomic DNA Extraction Kit was used to extract genomic DNA from Acorus tatarinowii, Acorus calamus, and Acorus tatarinowii.

[0041] 1) Take 30 mg of medicinal material powder, add 1 ml of nuclear isolation buffer and mix thoroughly, centrifuge at 12,000 rpm in a refrigerated high-speed centrifuge for 5 min, discard the supernatant, and repeat this step twice;

[0042] 2) Add 700 μL of buffer GP1 to the sample treated with nuclear isolation buffer and place in a 65°C water bath for 2 h. Invert the centrifuge tube several times to mix the sample during the water bath.

[0043] 3) After the sample is fully soaked in water, add 700 μL of chloroform to the sample tissue lysis mixture, mix thoroughly, centrifuge at 12,000 rpm for 5 min in a refrigerated high-speed centrifuge, and transfer the supernatant obtained by centrifugation to a new centrifuge tube;

[0044] 4) Add 700 μL of buffer GP2 to the supernatant, mix thoroughly by inversion, transfer to the adsorption column, centrifuge at 12,000 rpm for 30 s in a refrigerated high-speed centrifuge, and discard the waste liquid;

[0045] 5) Add 500 μL of buffer GD to the adsorption column, centrifuge at 12,000 rpm for 30 s in a refrigerated high-speed centrifuge, and discard the waste liquid;

[0046] 6) Add 600 μL of rinse solution PW to the adsorption column, centrifuge at 12,000 rpm for 30 seconds in a refrigerated high-speed centrifuge, discard the waste liquid, and repeat this step once;

[0047] 7) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min in a refrigerated high-speed centrifuge, transfer the adsorption column to a new centrifuge tube, and thoroughly dry the rinse solution in the adsorption column;

[0048] 8) Add 50 μL of elution buffer TE dropwise to the center of the adsorption column membrane, leave at room temperature for 5 min to allow the elution buffer TE to fully soak the adsorption column membrane, centrifuge at 12,000 rpm in a refrigerated high-speed centrifuge for 2 min, and collect the solution in a centrifuge tube.

[0049] 2. PCR Amplification

[0050] According to the nuclear gene fragment sequences of Acorus calamus, Acorus calamus and Acorus tatarinowii, PCR amplification primers were designed using Primer 3 (http: / / primer3.ut.ee / ) software targeting the conservative region of the fragment sequence.

[0051] Primer: FP: 5′-CGAGGGCACGCCTGCCT-3′ (SEQ ID NO: 9)

[0052] RR:5′-GACGCTTCTCCAGACTACAAT-3′(SEQ ID NO:10)

[0053] Reaction system:

[0054]

[0055] Reaction procedure:

[0056]

[0057] The nucleotide sequence of the amplified target fragment of Acorus striata is SEQ ID Sequence shown in NO: 6: 5′-CGAGGGCACGCCTGCCTGGGCGTCACGCCTTCCGTCGCTCCGCGGCATCACCCCCGCCCCATCGGGCGGGGGATCGTCCCGGATGCGGATGCTGGCCCTCCGTTCCCCGTGGGCGGTCGGCTGAAACCCAGGGTCCGCTGCGGGGT CGCGGCACGGCATGCGGTGGGCTGAGAGGCAGAGTCCCTACCTCTGGCGTCGGATGCCTCGCCCGGCCGCCGTCACAGCGGGCCCTCGAGAACCCCACCATTGCCACCGTGCGCAACGGCAGTCTGGATCGCGACCTCAGGTCAGGCGGGGCCACC-3′

[0058] The nucleotide sequence of the amplified target fragment of Acorus calamus is SEQ ID Sequence shown in NO:7: 5′-CGAGGGCACGCCTGCCTGGGCGTCACGCCTTCCGTCGCTCCGCGGCACCATCCCCGCCCGATGGCGGGGCTCGTCCGGATGTTGGCCCTCCGTTCCCCCGTGGGCGGTCGGCTGAAACCCAAGGTCCGCTGCGGGTCGCGGC ACGGCATGCGGTGGCCTGAGAGGCAGAGTCCCTACCACTCGCGTCGGATGCCTTGCCCGGCCGCGCGTCACAGCGGGCCCGTATGAACCCCACCATCGCCACCGTCCGCAACGGGCCGGTGGCGGTCTGGATCGCGACCTCAGGTCAGGCGGGGCCACC-3′

[0059] The nucleotide sequence of the target fragment amplified from Acorus calamus is the sequence shown in SEQ ID NO: 8: 5′-CGAGGGCACGCCTGCCTGGGCGTCACACAGCGTCGCCCCCCACCGATCCTTCTGGATGGGATGGGGGGCGGAGATTGGCCCCCCGAGCCCTCCGGGGCACGGTCGGCATAAATGTTGGTCCCCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTATACTCATCCCCCAAAGACGAAATGACGCGCACGCCTCGTCGCTCGGCGGGCAGAGCAAACCCCCGGAAGCCCGGCTTCAACCTGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAGCATATC-3′

[0060] The obtained amplified product sequence was homologously aligned against the NCBI nucleic acid non-redundant database using the BLAST homology alignment program. SEQ ID NO:6 was aligned and only aligned to the ITS2 gene of Acorus tatarinowii, SEQ ID NO:7 was aligned and only aligned to the ITS2 gene of Acorus calamus, and SEQ ID NO:8 was aligned and only aligned to the ITS2 gene of Acorus calamus, indicating that the amplified product was consistent with the target product.

[0061] Example 2 Probe design and screening

[0062] The primers designed in Example 1 were used to amplify the nuclear gene fragments of Acorus tatarinowii, Acorus calamus, and Acorus calamus, and all sequences were compared and analyzed using MEGA 6.05 to obtain multiple differential sites, namely A / C at position 70, C / T at position 89, G / C at position 164, and G / C at position 189. Based on the results of sequence comparison analysis, 4 groups of MLPA probes were designed for different sites. To avoid cross-reactions, BLAST search was used to evaluate the specificity of the probe sequence, and the secondary structure of the probe sequence was analyzed using DNA Folding Form. The RAW program was used to predict the length, GC content, and Tm value of the probe sequence. On this basis, padding sequences were appropriately added so that the predicted Tm values ​​of the three sequences could produce at least a 1.6°C difference. The details are as follows:

[0063] The probe design meets the following conditions: (1) The GC% content of the left hybridization sequence and the right hybridization sequence is between 40% and 60%. (2) The 3' end of the designed left probe and the 5' end of the right probe should be directly connected in position, and C / G aggregation should be avoided. (3) The Tm of the left and right probe hybridization sequences in the range of 23-25 ​​bp should be greater than 72.5℃ in RaW Probe; 26-35 bp, Tm should be greater than 71℃; 36-41 bp, Tm should be greater than 70℃; greater than 40 bp, Tm should be greater than 68℃. (4) The secondary structure and ΔG value of the left and right probe sequences of each species under the experimental reaction conditions are detected on the mfold Web Server website, and the optimal structure probe is selected. (5) The free energy of the left and right probes should be greater than 0.

[0064] After a series of screening, the following four groups of probes were obtained and handed over to Shanghai Bioengineering Co., Ltd. for synthesis. The probes were purified by HPLC, and the 5' end of the right probe was phosphorylated.

[0065] The four probe groups are as follows:

[0066]

[0067]

[0068] Probe preparation: Prepare the probe into a 10μM storage solution and dilute it to a 1μM working solution when used. Take 0.8μL of the left probe and the right probe of each MLPA probe, add TE to 600μL, and prepare the Acorus calamus (Acorus calamus, Acorus calamus) probe solution. That is, 0.8μL of Acorus calamus (Acorus calamus, Acorus calamus) left probe + 0.8μL of Acorus calamus (Acorus calamus, Acorus calamus) right probe + 598.4μl TE, and place it in a 4℃ refrigerator for use.

[0069] The amplified products of Acorus calamus, Acorus tatarinowii and Acorus calamus were hybridized with Acorus calamus, Acorus tatarinowii and Acorus calamus probes respectively, and 8 μL hybridization system (1.5 μl probe, 1 μl template, 5.5 μl TE) was configured, and the reaction procedure was: denaturation at 98°C for 5 min, hybridization at 70°C for 20 min;

[0070] Ligation reaction: Take out 1.28 μL of hybridization product and add it to the ligation system (9°N TM DNA Ligase 0.32μL, NEBuffer for 9°N DNA Ligase 0.8μL, ddH2O 5.6μL). Connect the left and right probes at 45℃ for 15min, and inactivate the ligase at 98℃ for 5min;

[0071] The ligation product was used as a template for fluorescence quantitative PCR amplification. The fluorescence quantitative PCR reaction system was: 2×T5FastqPCR Mix 10μL, upstream primer 0.8μL (10μM), downstream primer 0.8μL (10μM), 50×ROX ReferenceDye I 0.4μL, ligation product 5μL, ddH2O 3μL; the reaction program was 95℃1min; 95℃10s, 60℃5s, 72℃15s, 40 cycles; 72℃5min; obtaining the melting curve: 98℃3min, 45℃-97℃ (0.05℃ / s).

[0072] The results of specific probe screening are as follows: the template DNA of Acorus calamus, Acorus tatarinowii, and Acorus tatarinowii were hybridized, connected, and amplified by fluorescence quantitative PCR with the Acorus calamus, Acorus tatarinowii, and Acorus tatarinowii probes prepared in probe set 1. The results showed that the Acorus calamus probe only produced a single melting curve peak with Acorus calamus, Acorus tatarinowii only produced an amplification curve with the Acorus tatarinowii probe, and Acorus tatarinowii only produced an amplification curve with the Acorus tatarinowii probe. The experimental results of probe sets 2, 3, and 4 showed that the Acorus calamus probe cross-reacted with Acorus tatarinowii DNA, while the Acorus tatarinowii probe did not cross-react with Acorus calamus DNA. The results showed that the MLPA probe designed with the G / C variation at position 164 had good specificity and could be used to identify Acorus calamus, Acorus tatarinowii, and Acorus tatarinowii.

[0073] Therefore, the first probe set was selected as the probe used in this study.

[0074] Example 3 Optimization of detection conditions

[0075] The MLPA reaction includes three parts: hybridization, ligation, and MLPA amplification. The most influential factors are the hybridization temperature during the hybridization process and the number of cycles during the MLPA amplification process. The applicant optimized the reaction conditions by designing a single-factor experiment and finally obtained the following detection steps. The optimized melting curve peak height increased and no non-specific amplification curve appeared, which improved the detection sensitivity and specificity.

[0076] (1) DNA denaturation and hybridization: Take 100 ng of the PCR amplification product of the genomic DNA of the sample to be tested, add 1.5 μL of MLPA mixed probe, and make up the reaction volume to 8 μL with TE buffer. Denature at 98°C for 5 min and hybridize at 70°C for 20 min;

[0077] Preparation of the mixed probe: dilute the left and right probes in the three groups of MLPA probes to 1 μM respectively, take 0.8 μL of each, add TE to 600 μL, and prepare a mixed probe solution.

[0078] (2) Ligation reaction: Take out 1.28 μL of the hybridization product and add it to the ligation system (9°N TMDNA Ligase 0.32μL, NEBuffer for 9°N DNA Ligase 0.8μL, ddH2O 5.6μL). Connect the left and right probes at 45℃ for 15min, and inactivate the ligase at 98℃ for 5min.

[0079] (3) Fluorescence quantitative PCR amplification was performed using the ligation product as a template. The fluorescence quantitative PCR reaction system was: 2×T5Fast qPCR Mix 10μL, Primer F 0.8μL (10μM), Primer R 0.8μL (10μM), 50×ROXReference Dye I 0.4μL, ligation product 5μL, ddH2O 3μL; the reaction program was 95℃ for 1min; 95℃ for 10s, 60℃ for 5s, 72℃ for 15s, 36 cycles; 72℃ for 5min; obtaining the melting curve: 98℃ for 3min, 45℃-97℃ (0.05℃ / s).

[0080] Universal amplification primers:

[0081] Primer F:5′-GGGTTCCCTAAGGGTTGGA-3′(SEQ ID NO:11)

[0082] Primer R:5′-TCTAGATTGGATCTTGCTGGCAC-3′(SEQ ID NO:12)

[0083] Example 4 Specificity test for detecting Acorus calamus, Acorus calamus and Acorus tatarinowii

[0084] DNA denaturation and hybridization: Take about 100ng of the amplified products of Acorus calamus, Acorus calamus, and Acorus tatarinowii, add 1.5μL of Acorus calamus probe, Acorus calamus probe, Acorus tatarinowii probe, and mixed probe, respectively, and make up the volume to 8μL with TE buffer. Take another 8μL of TE buffer as a negative control. Denature at 98℃ for 5min, and hybridize at 70℃ for 20min.

[0085] Ligation reaction: Take out 1.28 μL of hybridization product and add it to the ligation system (9°N TM DNA Ligase 0.32μL, NEBuffer for 9°N DNA Ligase 0.8μL, ddH2O 5.6μL). Connect the left and right probes at 45℃ for 15min, and inactivate the ligase at 98℃ for 5min;

[0086] The fluorescence quantitative PCR reaction system was: 2×T5 Fast qPCR Mix 10μL, Primer F 0.8μL (10μM), Primer R 0.8μL (10μM), 50×ROX Reference Dye I 0.4μL, ligation product 5μL, ddH2O 3μL; the reaction program was 95℃1min; 95℃10s, 60℃5s, 72℃15s, 36 cycles; 72℃5min; obtaining the melting curve: 98℃3min, 45℃-97℃ (0.05℃ / s).

[0087] from Figure 1 It can be seen that the reaction specificity of the three medicinal materials DNA is good. Each medicinal material DNA only reacts with the corresponding single probe and mixed reaction, but not with the single probe of other medicinal materials. The melting curves and corresponding Tm values ​​of Acorus calamus, Acorus tatarinowii, and Acorus tatarinowii were obtained respectively. The results were 84.32℃±0.07℃ for Acorus calamus, 86.03℃±0.06℃ for Acorus tatarinowii, and 82.53℃±0.05℃ for Acorus tatarinowii.

[0088] Example 5: Sensitivity of Detecting Acorus calamus, Acorus calamus, and Acorus tatarinowii

[0089] 1) Continuously dilute the amplification product of the medicinal material DNA from high concentration to low concentration, and take a certain amount of the amplification product for the experiment. The sampling amount is as follows:

[0090]

[0091] 2) DNA denaturation and hybridization: Take different amounts of amplified products of Acorus calamus, Acorus tatarinowii, and Acorus calamus and mix them with 1.5 μL of probe, and use TE buffer to make up the reaction volume to 8 μL. Take another 8 μL of TE buffer as a negative control. Denature at 98℃ for 5 minutes and hybridize at 70℃ for 20 minutes;

[0092] 3) Ligation reaction: Take out 1.28 μL of the hybridization product and add it to the ligation system (9°N TM DNA Ligase 0.32μL, NEBuffer for 9°N DNA Ligase 0.8μL, ddH2O 5.6μL), 45℃15min to connect the left and right probes, 98℃5min to inactivate the ligase;

[0093] 4) Determine Tm value by melting curve: Use the ligation product as template for fluorescence quantitative PCR amplification and obtain the Tm value of the sample. The fluorescence quantitative PCR reaction system is: 2×T5Fast qPCR Mix 10μL, upstream primer 0.8μL (10μM), downstream primer 0.8μL (10μM), 50×ROX Reference Dye I 0.4μL, ligation product 5μL, ddH2O 3μL; the reaction program is 95℃1min; 95℃10s, 60℃5s, 72℃15s, 36 cycles; 72℃5min; obtain melting curve: 98℃3min, 45℃-97℃ (0.05℃ / s);

[0094] 5) Sensitivity verification: The sensitivity of the mixed probe was determined based on the melting curve peaks at 84.32℃±0.07℃, 86.03℃±0.06℃, and 82.53℃±0.05℃. When the DNA template amount was only 0.06-0.08ng, there was still an obvious melting curve ( Figure 2-4 ), indicating that this method has a high sensitivity in detecting calamus medicinal materials.

[0095] Example 5 Detection of mixed samples

[0096] The DNA amplification products of Acorus calamus, Acorus tatarinowii, and Acorus gramineus were mixed in pairs according to different proportions; then the melting curve peaks of the mixed samples were located according to the method determined in Example 3. The mixing conditions were determined according to the melting curve peaks that appeared. When the melting curve peaks appeared at 84.32℃±0.07℃ and 86.03℃±0.06℃ at the same time, it means that the mixed sample contains Acorus calamus and Acorus calamus; when the melting curve peaks appeared at 84.32℃±0.07℃ and 82.53℃±0.05℃ at the same time, it means that the mixed sample contains Acorus calamus and Acorus gramineus; when the melting curve peaks appeared at 86.03℃±0.06℃ and 82.53℃±0.05℃ at the same time, it means that the mixed sample contains Acorus calamus and Acorus gramineus. The present invention can detect a very small amount of DNA mixed with medicinal materials ( Figure 5-7 ).

[0097] In addition, the DNA amplification products of Acorus calamus, Acorus calamus, and Acorus tatarinowii were randomly mixed, and the melting curve peaks of the mixed samples were located according to the method determined in Example 3. The mixing conditions were determined according to the melting curve peaks that appeared. The melting curve peaks appeared at 82.53°C ± 0.05°C, 84.32°C ± 0.07°C, and 86.03°C ± 0.06°C at the same time, proving that the mixed sample contained Acorus calamus, Acorus calamus, and Acorus tatarinowii.

Claims

1. A method for detecting Acorus calamus, Acorus calamus and Acorus tatarinowii based on multiplex ligation probe amplification technology, characterized in that The following steps are involved: 1) Extracting sample genomic DNA; 2) Using the extracted genomic DNA as a template, specific primers were designed to amplify the nuclear gene fragments of Acorus calamus, Acorus tatarinowii, and Acorus calamus; 3) Denaturing the amplified product and hybridizing it with the MLPA probe; 4) connecting the hybridization products of step 3) using DNA ligase; 5) performing real-time fluorescence quantitative PCR amplification on the ligation product of step 4) using universal primers; 6) Collect melting curve signals and observe Tm values, There are 3 groups of MLPA probes, each group consists of a left probe and a right probe, wherein: The first group of left probes: GGGTTCCCTAAGGGTTGGACGGGTCCGGTCGCGGCACGGCAT GCGGTGGG; right probes: CTGAGAGAAAGAGTCCCTACCACTCGCTCTAGATTGGATCT TGCTGGCAC; The second group of left probe: GGGTTCCCTAAGGGTTGGATTGATCGCGGCACGGCATGCGGTG GC; right probe: CTGAGAGAAAGAGTCCCTACCACTCGCTCTAGATTGGATCTTGCTGG CAC; The third group of left probe: GGGTTCCCTAAGGGTTGGATTCAGAATTGTATACTCATCCCCCA AAGACGAAA; right probe: TGACGCGCACGCCTCGCCGCTCTCTAGATTGGATCTTGCT GGCAC; The specific primer sequences for amplifying the nuclear gene fragments of Acorus calamus, Acorus calamus and Acorus tatarinowii are as follows: Upstream primer: CGAGGGCACGCCTGCCT Downstream primer: GACGCTTCTCCAGACTACAAT; The universal primer sequences are as follows: Upstream primer: GGGTTCCCTAAGGGTTGGA Downstream primer: TCTAGATTGGATCTTGCTGGCAC.

2. The detection method according to claim 1, characterized in that The nucleotide sequence of the Acorus calamus nuclear gene fragment is shown in SEQ ID NO:6; the nucleotide sequence of the Acorus calamus nuclear gene fragment is shown in SEQ ID NO:7; and the nucleotide sequence of the Acorus calamus nuclear gene fragment is shown in SEQ ID NO:

8.

3. The detection method according to claim 1, characterized in that: The DNA ligase is 9°N DNALigase.

4. The detection method according to claim 1, characterized in that: The hybridization temperature in step 3) is 70°C and the time is 20 min.

5. The detection method according to claim 1, characterized in that: The number of reaction cycles of the real-time fluorescence quantitative PCR amplification in step 5) is 36 cycles.

6. The detection method according to claim 1, characterized in that: In step 6), the result is judged by observing the melting curve peak and Tm value of the sample. If the sample has a single melting curve peak and the Tm value is 84.32℃±0.07℃, it is Acorus calamus; if the sample has a single melting curve peak and the Tm value is 86.03℃±0.06℃, it is Acorus calamus; if the sample has a single melting curve peak and the Tm value is 82.53℃±0.05℃, it is Acorus calamus; if the sample has a single melting curve peak and the Tm value is 82.53℃±0.05℃, it is Acorus calamus; if the sample has two or three melting curve peaks with corresponding Tm values, it is a mixed sample of two or three types of Acorus calamus.

Images