Use of tricyclic compounds and pharmaceutical compositions containing the same

Abstract

The present invention provides a use of a tricyclic compound and a pharmaceutical composition containing the same, the use of the tricyclic compound as a STING agonist and the preparation of a drug for treating a disease related to the function of the STING protein. The tricyclic compound is a compound represented by formula I, its tautomers, racemates, mesomers, enantiomers, diastereomers, and pharmaceutically acceptable salts. Formula I is: The tricyclic compound or a pharmaceutical composition containing the same can be used to prepare an interferon gene stimulator agonist or an immune adjuvant, or to prepare a drug for treating a disease related to the function of the STING protein.

Description

Technical Field

[0001] The present invention relates to the application field of organic compounds, and in particular to the use of a compound with a tricyclic structure and a pharmaceutical composition containing the tricyclic compound. Background Art

[0002] Stimulator of interferon gene (STING) is a key node protein that specifically regulates the innate immune system. As the first line of defense in the human body, the innate immune system can quickly identify the invasion of foreign pathogens through pattern recognition receptors (PRRs), induce macrophages (MC) and natural killer cells (NK) to perform phagocytosis and degradation functions, and at the same time secrete a large number of inflammatory factors or chemokines to promote dendritic cells (DC) to present antigens and activate adaptive immunity. Among them, pattern recognition receptors include nucleotide binding domain-like receptors (NOD-like receptors, NLRs), Toll-like receptors (Toll-like receptors, TLRs), retinoic acid-inducible gene I-like receptors (RIG-Ⅰ like receptors, RLRs), C-type lectin receptors (C-type lectinreceptors, CLRs), guanylate-adenylate synthetase (Cyclic GMP-AMP synthase, cGAS), etc. Studies have shown that PRRs can recognize pathogen associated molecular patterns (PAMPs, such as single / double-stranded ribonucleotides and lipopolysaccharides) or damage associated molecular patterns (DAMPs) and further initiate downstream signaling pathways to release cytokines and regulate the body's immune response. As a key adaptor protein in the innate immune response, the activation of STING can enhance the immune effect of immunotherapy, more widely activate and enhance the body's innate immune system and adaptive immune function. Therefore, it is expected to be applicable to various types of cancer, and even to the treatment of other diseases besides cancer. It is one of the possible effective targets for small molecule tumor immunotherapy. Similarly, abnormal activation of the SITNG signaling pathway can trigger autoimmune and inflammatory diseases.

[0003] Therefore, it is of great significance to study compounds that can activate the STING signaling pathway. Chinese patent application 2022107988350 discloses a benzimidazole compound, a pharmaceutical composition containing the same, and the use of the two. The benzimidazole compound has the function of activating the STING signaling pathway. In view of the broad application prospects of STING activation, more compounds that activate the STING signaling pathway remain to be discovered. Summary of the invention

[0004] The object of the present invention is to provide a use of a tricyclic compound as a STING agonist or immune adjuvant and a pharmaceutical composition comprising the tricyclic compound.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] A use of a tricyclic compound, wherein the tricyclic compound is used as a STING agonist, an immune adjuvant, or a drug for treating a disease related to the function of the STING protein. The tricyclic compound is a compound represented by formula I, its tautomers, racemates, mesomers, enantiomers, diastereomers, and pharmaceutically acceptable salts. Formula I is:

[0007] in,

[0008] R 1 , R 2 are independently selected from hydrogen, halogen, substituted or unsubstituted C 1-4 One of alkyl, aryl and heteroaryl, C 1-4 The substituent of the alkyl group is alkoxy, thiol, cyano, amino, amide or carboxyl; the preferred heteroaryl group is triazole.

[0009] X is selected from N or C; Y is selected from one of S, O, C, N and sulfoxide; n is selected from 0, 1 or 2.

[0010] L is a substituted or unsubstituted main chain containing 1 to 4 atoms, the main chain is C 1-4 Alkylene, or, the main chain contains a carbonyl group or an amide group, and the rest is an alkylene group; the substituent of the main chain is a methyl group or a hydroxyl group.

[0011] Ring A and Ring B are independently selected from aromatic rings and C 5-6 A type of aromatic heterocycle.

[0012] Ring Q is selected from a 5-7 membered aliphatic heterocyclic ring or an aromatic ring, and the heteroatom is selected from one or more of N, O and S, and the number of the heteroatoms is 1-3.

[0013] Z is substituted or unsubstituted C 1-4 Alkyl, C 1-4The substituent of the alkyl group is a hydroxyl group, an amino group or an amide group. As a further improvement of the technical solution, the chemical structure of the tricyclic compound is shown in Formula II,

[0014] Where n is 0 or 1;

[0015] R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 are independently selected from hydrogen, halogen, substituted or unsubstituted C 1-4 One of alkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl, C 1-4 The substituent of the alkyl group is an alkoxy group, a thiol group, a cyano group, an amino group, an amide group or a carboxyl group, and the aryl group or the heteroaryl group is a triazole.

[0016] As a further improvement of the technical solution, R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 All are hydrogen atoms;

[0017] Or, R 3 , R 6 , R 7 , R 9 are all hydrogen atoms, R 4 and R 9 independently selected from one of hydrogen, halogen, cyano, formamide, methoxy, methylthio, triazole and formyl;

[0018] Or, R 3 , R 4 , R 6 , R 7 , R 9 , R 10 are all hydrogen atoms, R 5 and R 8 Also selected from cyano or formamide;

[0019] Or, R 3 , R 4 , R 5 , R 6 , R 8 , R 10 are all hydrogen atoms, R 7 and R 9Also selected from cyano or formamide.

[0020] As a further improvement of the technical solution, L is a substituted or unsubstituted main chain containing 1 to 4 atoms, the main chain is C 1-4 Alkylene, or, the main chain contains a carbonyl group or an amide group, and the rest is alkylene; the substituent of L is methyl or hydroxyl.

[0021] As a further improvement of the technical solution, Q is selected from a 5-7 membered aliphatic heterocycle or an aromatic ring, the aliphatic heterocycle is selected from piperidine or piperazine, and the aromatic ring is a benzene ring.

[0022] As a further improvement of the technical solution, Z is selected from hydroxyethyl, N-ethyl, aminoethyl or aminoacetyl.

[0023] As a further improvement of the technical solution, the tricyclic compound is any of the following compounds:

[0024]

[0025]

[0026] Another aspect of the technical solution of the present invention is to provide a method for preparing compounds having the general structural formula I and II, and the synthetic route thereof is as follows:

[0027]

[0028] The reaction conditions are: (a) sodium hydride, anhydrous N,N-dimethylformamide, room temperature, 2-3h; (b) potassium carbonate, sodium iodide, N,N-dimethylformamide or acetonitrile. When the two rings A and B are benzene rings, the structure of general formula II is synthesized. The above R1, R2, n, A, B, X, Y, L, Q, and Z are defined as above.

[0029] Since the tricyclic compounds in the present invention have the use of activating the STING signaling pathway and have application prospects in treating diseases related to the function of the STING protein, the present invention also provides a pharmaceutical composition based on the use of the compound to activate the STING signaling pathway, the pharmaceutical composition comprising a therapeutically effective amount of the above-mentioned tricyclic compound, one or a mixture of its pharmaceutically acceptable crystal form, hydrate, solvate, prodrug, metabolite, and further comprising a pharmaceutical excipient and / or a pharmaceutically acceptable carrier.

[0030] Pharmaceutical excipients refer to excipients and additives used in the production of medicines and the preparation of prescriptions, including solvents, propellants, solubilizers, co-solvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrators, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculants, filter aids, release retardants, etc. Oral pharmaceutical excipients such as disintegrants, co-solvents, solvents, lubricants, etc. are preferred.

[0031] Pharmaceutically acceptable carriers refer to systems that can change the way drugs enter the human body and their distribution in the body, control the release rate of drugs, and deliver drugs to targeted organs, including microcapsules and microspheres, nanoparticles, liposomes, etc. When the pharmaceutical composition is used for solid tumor diseases, the preferred composition is in the form of active ingredient + carrier.

[0032] The pharmaceutical composition has the use in a drug for treating diseases related to the function of the STING protein, wherein the diseases related to the function of the STING protein are one or more of inflammation, autoimmune diseases, infectious diseases, and tumor-related diseases. The inflammatory disease is selected from acne vulgaris, rheumatoid arthritis, pelvic inflammatory disease, asthma, celiac disease, inflammatory bowel disease, reperfusion injury, chronic prostatitis, glomerulonephritis, sarcoidosis, vasculitis, airway inflammation caused by house dust mites, and interstitial cystitis. The infectious disease is selected from bacterial and viral infections, especially diseases related to hepatitis B virus (HBV), hepatitis C virus (HCV), nasopharyngeal carcinoma-related Epstein-Barr virus (EBV), human papillomavirus (HPV), and human immunodeficiency virus (HIV) infection.

[0033] The tumor-related diseases are selected from colon cancer, gastric cancer, breast cancer, fibrosarcoma and squamous cell carcinoma, lung cancer, melanoma, ovarian cancer, brain cancer, brain cancer and spinal cancer, liver cancer, cervical cancer, head and neck cancer, leukemia and blood cancer, skin cancer, reproductive system cancer, lung cancer, malignant mesothelioma, sarcoma, lymphoma, adenocarcinoma, thyroid cancer, heart tumors, germ cell tumors, gastrointestinal system cancer, liver and bile duct cancer, kidney cancer and bladder cancer, bone cancer and other cancers.

[0034] The present invention has outstanding substantial features and significant progress compared to the prior art. Specifically, the tricyclic compounds of the present invention have an agonistic effect on the interferon gene stimulation (STING) protein. The pharmaceutical composition containing the tricyclic compounds of the present invention can be used to treat cancer, inflammation, autoimmune diseases, infectious diseases, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1This is the ITC titration curve of compound 1 and STING protein.

[0036] Figure 2 This is the STD spectrum of the interaction between compound 1 and STING protein.

[0037] Figure 3 This is the result of qPCR experiment investigating the effect of compound 1 on STING downstream mRNA.

[0038] Figure 4 This is a diagram showing the results of a Western-Blot experiment investigating the effect of compound 1 on STING downstream proteins. DETAILED DESCRIPTION

[0039] The experimental methods without specific conditions in the examples of the present invention are selected according to conventional methods and conditions, or according to the product instructions.

[0040] The structures of the compounds were determined by nuclear magnetic resonance (NMR) and / or high resolution mass spectrometry (HRMS). 1 H NMR spectra were measured by Bruker AV-300 NMR spectrometer, the solvents were deuterated dimethyl sulfoxide (DMSO-d6) and deuterated chloroform (CDCl3), and the internal standard was tetramethylsilane (TMS). High-resolution mass spectra were measured by Water Q-Tofmicro mass spectrometer from Waters Corporation, USA.

[0041] The chemical reaction was detected using 0.25 mm GF254 thin layer chromatography silica gel plates and observed by a ZF7 three-purpose UV analyzer.

[0042] Unless otherwise specified in the examples, the reactions were carried out under air atmosphere.

[0043] Unless otherwise specified in the examples, solution refers to aqueous solution.

[0044] Unless otherwise specified in the examples, the reaction temperature is room temperature and is 20°C to 30°C.

[0045] The purity of the compounds in the examples was determined by HPLC using an Agilent C18 (4.6 mm × 150 mm, 3.5 μm) reverse phase column under the following conditions: a methanol / water (80:20) mixed solvent as the mobile phase at a flow rate of 1 mL / min and detection by UV absorption at 254 nm and 365 nm.

[0046] Example 1: Preparation of Compound 2

[0047]

[0048] Step 1: Synthesis of compound 1-1

[0049] Hydroxyethylpiperazine (2 g, 15.4 mmol) and 1-bromo-3-chloropropane (3.63 g, 23.1 mmol) were dissolved in acetonitrile, and Et3N (3.12 g, 30.8 mmol) was added and stirred at room temperature overnight. After the reaction was complete, rotary evaporation, sand making, and column chromatography were performed to obtain a light yellow or white oil 1-1 (2.56 g, yield 80.62%). 1 H NMR (300MHz, DMSO-d6) δ4.21(t,J=8.3Hz,1H),3.68(t,J=6.5Hz,2H),3.58(t,J=6.0H z, 2H), 2.63 (t, J = 6.0Hz, 2H), 2.54–2.41 (m, 2H), 1.93 (s, 8H), 1.89 (d, J = 6.8Hz, 2H).

[0050] Step 2: Synthesis of compound 2

[0051] NaH (60%, 446 mg, 11.15 mmol) was placed in a three-necked flask, filled with N2 under an ice bath, anhydrous DMF was added, the system was mixed, phenothiazine (1 g, 4.45 mmol) was added, stirred for 1 h, and then the prepared compound 1-1 was added, and the reaction was carried out at room temperature for 3-4 h. After confirming that the reaction was complete, water was slowly added under an ice bath to quench. It was extracted with water and ethyl acetate, washed with saturated NaCl, dried over anhydrous sodium sulfate, concentrated by rotary evaporation, sanded, and purified by column chromatography to obtain a white solid 2 (300 mg, yield 15%). 1 H NMR(300MHz,Chloroform-d)δ7.23–7.12(m,4H),7.02–6.83(m,4H),3.97(t,J=6.8Hz,2H), 3.66(t,J=5.4Hz,2H),2.57(dt,J=18.1,6.4Hz,12H),2.09–1.92(m,2H).HRMS(ESI):calcd forC 21 H 28 N3OS + [M+H] + 370.1947, found 370.1942.Purity:99.94% by HPLC(t R =2.86min, MeOH / H2O=80:20).

[0052] Example 2: Preparation of Compound 3

[0053]

[0054] The synthesis method was the same as that of compound 2 in Example 1, except that phenothiazine was replaced by 2-carboxyphenothiazine.

[0055] The synthesis gave 53 mg of a light yellow solid (yield 21%). 1 H NMR(300MHz,Chloroform-d)δ7.53–7.45(m,2H),7.25–7.12(m,3H),7.00–6.90(m,2H),4.02(t,J= 6.8Hz,2H),3.71(t,2H),2.81–2.64(m,6H),2.59(d,J=11.8Hz,9H),2.02(m,2H).HRMS(ESI):calcd for C 23 H 30 N3O2S + [M+H] + 412.2053, found 412.2046.Purity:95.08% by HPLC(t R =4.10min, MeOH / H2O=80:20).

[0056] Example 3: Preparation of Compound 4

[0057]

[0058] The synthesis method was the same as that of Compound 2 in Example 1, except that 2-methoxyphenothiazine was used instead of phenothiazine.

[0059] The synthesis gave 34 mg of a light yellow solid (yield 16%). 1 H NMR(300MHz,Chloroform-d)δ7.22–7.14(m,2H),7.09–7.03(m,1H),6.99–6.88(m,2H),6.56–6.49(m,2H),3.94(t,J=6.7Hz, 2H),3.82(s,3H),3.76–3.70(m,2H),2.80–2.66(m,6H),2.60(m,J=13.0,5.9Hz,6H),2.03(m,J=2.3Hz,2H).HRMS(ESI):calcd for C 22 H 29 N3O2S + [M+H] + 400.2053,found400.2050.Purity:99.55% by HPLC(t R =3.29min, MeOH / H2O=80:20).

[0060] Example 4: Preparation of Compound 5

[0061]

[0062] Step 1: Synthesis of compound 5-1

[0063] Place NaH (60%, 7g, 27mmol) in a three-necked flask, fill with N2 under ice bath, add anhydrous DMF, mix the system, add 2-cyano phenothiazine (5g, 22mmol), stir for 1h, then add 1-bromo-3-chloropropane, and react at room temperature for 3-4h. After confirming that the reaction is complete, slowly add water under ice bath to quench. Extract with water and ethyl acetate, wash with saturated NaCl, dry with anhydrous sodium sulfate, concentrate with rotary evaporation, sand making, and purify with column chromatography to obtain a colorless oil (4.3g, yield 65%).

[0064] Step 2: Synthesis of compound 5

[0065] Compound 5-1 (1 g, 3.32 mmol) was dissolved in DMF, K2CO3 (0.918 g, 6.65 mmol), hydroxyethylpiperazine (0.519 g, 3.99 mmol), sodium iodide (0.498 g, 3.32 mmol) were added, and the temperature was raised to 90°C for 8 h. After the reaction was complete, the mixture was extracted with water and ethyl acetate, washed with saturated NaCl, dried over anhydrous sodium sulfate, concentrated by rotary evaporation, sanded, and purified by column chromatography to obtain 350 mg of a light yellow solid (yield 26.68%). 1 H NMR(300MHz,Chloroform-d)δ7.26–7.17(m,3H),7.16–7.07(m,2H),7.05–6.89(m,2H),3.95(t,J=6.7 Hz,2H),3.79–3.73(t,2H),2.84–2.71(m,6H),2.68–2.51(m,6H),2.01–1.92(m,2H).HRMS(ESI):calcd for C 20 H 28 N4OS + [M+H] + 395.1876,found395.1895.Purity:98.77%by HPLC(t R =6.09min, MeOH / H2O=80:20).

[0066] Example 5: Preparation of Compound 6

[0067]

[0068] The synthesis method was the same as that of compound 5 in Example 4, except that 2-methylthiophenothiazine was used instead of 2-cyanphenothiazine.

[0069] The synthesis yielded 62 mg of yellow powder solid (yield 53.24%). 1 H NMR(300MHz,Chloroform-d)δ7.15(t,J=7.6Hz,2H),7.05(d,J=7.8Hz,1H),6.96–6.85(m,2H),6.85–6.78(m,2H),3.92(t,J =6.7Hz,2H),3.67(t,J=5.2Hz,2H),2.76–2.58(m,6H),2.58–2.49(m,6H),2.47(s,3H),1.99–1.92(m,2H).HRMS(ESI):calcd for C 22 H 30 N3OS2 + [M+H] + 416.1824, found416.1823.Purity:95.67% by HPLC(t R =3.29min, MeOH / H2O=80:20).

[0070] Example 6: Preparation of Compound 7

[0071]

[0072] Step 1: Synthesis of compound 5-1 (see preparation step 1 of compound 5).

[0073] Step 2: Synthesis of compound 7-1

[0074] Compound 5-1 (1.0 g, 3.33 mmol) was dissolved in EtOH / DMSO. Under ice bath conditions, sodium hydroxide aqueous solution (1.33 g) was added. After stirring for 5 minutes, 30% hydrogen peroxide (4 ml) was added and the mixture was returned to room temperature for 3 hours. After the reaction was complete as monitored by TLC, the reaction system was poured into ice water, solid precipitated, and 0.56 g of solid was obtained by drying (yield 52.84%). 1 H NMR(300MHz, DMSO-d6)δ8.04(s,1H),7.51(d,J=7.8Hz,2H),7.43(s,1H),7.31–7.17(m,3H),7.12(dd,J=8.3, 1.2Hz, 1H), 7.00 (td, J = 7.4, 1.2Hz, 1H), 4.12 (t, J = 6.6Hz, 2H), 3.75 (t, J = 6.3Hz, 2H), 2.15 (p, J = 6.4Hz, 2H).

[0075] Step 3: Synthesis of compound 7

[0076] The synthesis method was the same as that of compound 5 in Example 4, except that 2-formamidophenothiazine was used instead of 2-cyanphenothiazine.

[0077] The synthesis gave 43 mg of a yellow solid (yield 23.6%). 1 H NMR(300MHz,Chloroform-d)δ7.44(s,1H),7.25–7.06(m,4H),6.94(dd,J=11.1,7.7Hz,2H),4.00(t,J= 6.9Hz,2H),3.61(t,J=5.4Hz,2H),2.54(dd,J=11.9,6.7Hz,12H),2.04–1.89(m,2H).HRMS(ESI):calcd forC 22 H 29 N4O2S + [M+H] + 413.2005, found 413.1999.Purity:95.09% by HPLC(t R =2.34min, MeOH / H2O=80:20).

[0078] Example 7: Preparation of Compound 8

[0079]

[0080] Step 1 and step 2 are the same as the synthesis of compounds 5-1 and 7-1.

[0081] Step 3: Synthesis of compound 8-1

[0082] Dissolve compound 7-1 (600 mg, 1.89 mmol) in DNF-DMA solution, heat to 100°C, and stir for 1 h. Cool to room temperature and concentrate in vacuo. Add ethanol and hydrazine acetate in sequence, react at 50°C for 30 minutes. Concentrate in vacuo, dilute with water and filter, wash the filter residue with ethanol, and dry to obtain 213 mg of off-white solid (yield 33.01%), which is reserved for the next step.

[0083] Step 4: Synthesis of compound 8

[0084] The synthesis method is the same as the synthesis of compound 5 in Example 4, except that 2-triazole phenothiazine is used to replace 2-cyano phenothiazine.

[0085] The synthesis yielded 26 mg (yield 10.21%). 1H NMR(300MHz,Chloroform-d)δ8.19(s,1H),7.61(d,J=8.9Hz,2H),7.24–7.13(m,3H),7.01–6.88(m,2H),4.00( t,J=6.9Hz,2H),3.67(t,J=6.1,5.5Hz,2H),2.62–2.46(m,12H),2.06(p,J=8.1,7.2Hz,2H).HRMS(ESI):calcd forC 23 H 29 N6OS + [M+H] + 437.2118, found437.2110.Purity:96.24% by HPLC(t R =3.56min, MeOH / H2O=80:20).

[0086] Example 8: Preparation of Compound 9

[0087]

[0088] Step 1: Synthesis of compound 9-1

[0089] Under ice bath, 2-Cl phenothiazine (1g, 4.27mmol) was placed in a round-bottom flask, 20ml of glacial acetic acid was added, 30% hydrogen peroxide (0.75ml, 6.5mmol) was added, the temperature was restored to room temperature, and the reaction was stirred overnight. After TLC monitoring, the reaction was completed, vacuum concentrated, EA, water extraction, the organic phase was dried over anhydrous sodium sulfate, and concentrated to obtain 0.96g of off-white solid (yield 89.85%). 1 HNMR (300MHz, DMSO-d6) δ11.09(s,1H),8.02-7.87(m,2H),7.64(s,1H),7.43-7.34(m,2H),7.30-7.18(m,2H).

[0090] Step 2: Synthesis of compound 9-2

[0091] The synthesis method was the same as that of compound 5-1 in Example 4, except that 2-chlorophenothiazine-5-oxide was used to replace 2-cyanophenothiazine.

[0092] 0.75 g of oil was synthesized (yield 71.76%). 1H NMR(300MHz,Chloroform-d)δ7.97(dd,J=7.7,1.7Hz,1H),7.90(d,J=8.3Hz,1H),7.69(ddd,J=8.7,7.1,1.6Hz,1H),7.58–7.50(m,2 H), 7.35 (d, J = 7.1Hz, 1H), 7.27 (dd, J = 8.3, 1.8Hz, 1H), 4.52 (t, J = 8.3, 6.4Hz, 2H), 3.75 (t, J = 5.8Hz, 2H), 2.42 (p, J = 6.0, 2.1Hz, 2H).

[0093] Step 3: Synthesis of compound 9

[0094] The synthesis method was the same as that of compound 5 in Example 4, except that 2-chlorophenothiazine-5-oxide was used to replace 2-cyanophorheothiazine.

[0095] The synthesis yielded 54 mg of a white solid (yield 13.98%). 1 H NMR(300MHz,Chloroform-d)δ8.09(d,J=7.7Hz,1H),8.02(d,J=8.3Hz,1H),7.83–7.74(m,1H),7.73–7.64(m,2H),7.47–7.42(m,1H) ,7.39–7.31(m,1H),4.50(t,J=7.6Hz,2H),3.78(t,J=4.6,3.9Hz,2H),2.83–2.56(m,12H),2.22(p,J=7.3Hz,2H).HRMS(ESI):calcd for C 21 H 27 ClN3O2S + [M+H] + 420.1507, found420.1504.Purity:96.35% by HPLC(t R =4.68min, MeOH / H2O=80:20).

[0096] Example 9: Preparation of Compound 10

[0097]

[0098] Step 1: Synthesis of compound 10-2

[0099] Compound 10-1 (1 g, 5.46 mmol) and NaH (262 mg, 6.55 mol) were placed in a three-necked flask, nitrogen was released three times, anhydrous DMF was added, and after stirring for half an hour, 1-bromo-3-chloropropane was added and reacted at room temperature for 3-4 hours. After confirming that the reaction was complete, water was slowly added under an ice bath to quench. The mixture was extracted with water and ethyl acetate, washed with saturated NaCl, dried over anhydrous sodium sulfate, and concentrated by rotary evaporation to obtain a colorless crude oil, which was not purified and was carried out to the next step.

[0100] Step 2: Synthesis of compound 10

[0101] The synthesis method was the same as that of compound 5 in Example 4, except that phenoxazine was used instead of 2-cyanophenothiazine.

[0102] The synthesis gave 79 mg of solid (yield 36.78%). 1 H NMR(300MHz,Chloroform-d)δ6.87–6.78(m,2H),6.70–6.65(m,4H),6.62(dd,2H),3.70(t,J=5.4Hz,2 H),3.63(t,2H),3.10(s,1H),2.72–2.58(m,8H),2.50(t,J=6.8Hz,4H),1.88(p,2H).HRMS(ESI):calcd for C 21 H 27 N3O2 + [M+H] + 354.2176, found 354.2169.Purity:97.35% by HPLC(t R =2.68min, MeOH / H2O=80:20).

[0103] Example 10: Preparation of Compound 11

[0104]

[0105] Step 1: Synthesis of compound 11-2

[0106] The synthesis method was the same as that of compound 10-2 in Example 9, except that 9,10-dihydroacridine was used instead of phenoxazine.

[0107] Step 2: Synthesis of compound 11

[0108] The synthesis method was the same as that of compound 5 in Example 4, except that 9,10-dihydroacridine was used to replace 2-cyanophenothiazine.

[0109] The synthesis gave 54 mg of a white solid (yield 46.23%). 1H NMR(300MHz,Chloroform-d)δ7.23–7.10(m,4H),6.94(dd,J=12.1,7.7Hz,4H),3.97(s,2H),3.95(t,2H),3 .66(t,J=5.4Hz,2H),2.73–2.56(m,8H),2.51(t,J=7.1Hz,4H),2.01(q,J=7.4Hz,2H).HRMS(ESI):calcdfor C 22 H 30 N3O + [M+H] + 352.2383,found352.2383.Purity:98.65%by HPLC(t R =2.96min, MeOH / H2O=80:20).

[0110] Example 11: Preparation of Compound 12

[0111]

[0112] Step 1: Synthesis of compound 12-2

[0113] The synthesis method was the same as that of compound 10-2 in Example 9, except that 2-chloro-9H-carbazole was used instead of phenoxazine.

[0114] Step 2: Synthesis of compound 12

[0115] The synthesis method was the same as that of compound 5 in Example 4, except that 2-chloro-9H-carbazole was used instead of 2-cyanophenothiazine.

[0116] The synthesis gave 46 mg of a white solid (yield 33.35%). 1 H NMR(300MHz,Chloroform-d)δ8.09(dt,J=7.8,1.1Hz,1H),8.01(d,J=8.3Hz,1H ),7.59(d,J=1.8Hz,1H),7.52–7.46(m,2H),7.29–7.25(m,1H),7.21(dd,J=8.3, 1.8Hz,1H),4.41(t,J=6.3Hz,2H),3.70(t,J=5.3Hz,2H),3.02(s,1H),2.67(t,J =5.4Hz,6H),2.50(s,4H),2.31(d,J=6.6Hz,2H),2.06(p,2H).HRMS(ESI):calcd for C 21 H 27 ClN3O +[M+H] + 372.1837,found 372.1833.Purity:98.85%byHPLC(t R =3.66min, MeOH / H2O=80:20).

[0117] Example 12: Preparation of Compound 13

[0118]

[0119] Step 1: Synthesis of compound 13-2

[0120] The synthesis method was the same as that of compound 10-2 in Example 9, except that carbazole was used instead of phenoxazine.

[0121] Step 2: Synthesis of compound 14

[0122] The synthesis method was the same as that of compound 5 in Example 4, except that carbazole was used instead of 2-cyanophenothiazine.

[0123] The synthesis yielded 95 mg of a white solid (yield 43.69%). 1 H NMR(300MHz,Chloroform-d)δ8.16(d,J=7.8Hz,2H),7.58–7.47(m,4H),7.34–7.25(m,2H),4.47(t,J=6.6Hz,2H ),3.69(t,J=5.4Hz,2H),2.64(t,J=5.4Hz,10H),2.38(t,J=6.8Hz,2H),2.11(p,J=6.7Hz,2H).HRMS(ESI):calcd for C 21 H 28 N3O + [M+H] + 338.2226, found 338.2223.Purity:95.34% by HPLC(t R =4.68min, MeOH / H2O=80:20).

[0124] Example 13: Preparation of Compound 14

[0125]

[0126] Step 1: Synthesis of compound 14-2

[0127] The synthesis method was the same as that of compound 10-2 in Example 9, except that 2-bromo-9H-carbazole was used instead of phenoxazine.

[0128] Step 2: Synthesis of compound 14

[0129] The synthesis method was the same as that of compound 5 in Example 4, except that 2-bromo-9H-carbazole was used instead of 2-cyanophenothiazine.

[0130] The synthesis gave 57 mg of a white solid (yield 26.78%). 1 H NMR(300MHz,Chloroform-d)δ8.07(d,J=7.8Hz,1H),7.94(d,J=8.2Hz,1H),7.74(d,J=1.8Hz,1H),7.49(d,J=6.3Hz,2H),7.34(dd,J=8.3,1.7Hz,1H),7.29 –7.21(m,1H),4.39(t,J=6.3Hz,2H),3.67(t,J=5.4Hz,2H),2.64(q,J=5.3Hz, 6H),2.46(s,4H),2.28(t,J=6.5Hz,2H),2.10–1.97(m,2H).HRMS(ESI):calcd for C 21 H 27 BrN3O + [M+H] + 416.1332, found416.1326.Purity:99.06% by HPLC(t R =2.98min, MeOH / H2O=80:20).

[0131] Example 14: Preparation of Compound 15

[0132]

[0133] Step 1: Synthesis of compound 15-3

[0134] 15-1 (5 g, 27 mmol) and 15-2 (6.01 g, 27 mmol) were dissolved in an appropriate amount of DMSO solution, anhydrous K2CO3 (11.2 g, 81 mmol) was added, the temperature was raised to 100°C, and the reaction was carried out for 8 hours. The reaction was monitored by TLC plate, diluted with water, extracted with EA, and the organic phase was dried with anhydrous sodium sulfate, concentrated in vacuo, and separated and purified by column chromatography to obtain 8.36 g of compound 15-3 (yield 83.37%). 1H NMR(300MHz,DMSO-d6)δ8.73(d,J=2.1Hz,1H),8.09(dd,J=8.8,2.1Hz,1H),8.02(dd,J=7.9,1.6Hz, 1H), 7.56 (td, 1H), 7.37 (dd, J = 8.1, 1.5Hz, 1H), 7.18 (td, J = 7.6, 1.5Hz, 1H), 6.95 (d, J = 8.8Hz, 1H).

[0135] Step 2: Synthesis of compound 15-4

[0136] Compound 15-3 (3 g, 8.20 mmol) was placed in an eggplant-shaped reaction bottle, 20 ml of water / ethanol (1:3) was added, NH4Cl (219.309 mg, 4.1 mmol) was added, stirring was started, reduced iron powder (1.813 g, 32.8 mmol) was added, the temperature was raised to 80°C, and the reaction was continued for 1 h. The reaction was monitored by TLC to be complete, the mixture was filtered while hot, the filtrate was concentrated in vacuo, water and ethyl acetate were added for extraction, the organic phase was dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain 2.13 of compound 16-4 (yield 77.33%). 1 HNMR(300MHz,DMSO-d6)δ8.00–7.87(m,1H),7.50–7.35(m,1H),7.13(d,J=2.1Hz,1H), 7.04 (t, J = 6.9 Hz, 2H), 6.91 (dd, J = 8.3, 2.1 Hz, 1H), 6.52 (d, J = 8.3 Hz, 1H), 5.59 (s, 2H).

[0137] Step 3: Synthesis of compound 15-5

[0138] Compound 15-4 (1 g, 3.0 mmol) was dissolved in toluene, and Pd2(dba)3 (140 mg, 0.15 mmol), t-BuONa (404 mg, 4.2 mmol), and DPPF (166.32 mg, 0.3 mmol) were added. The mixture was protected by nitrogen and reacted at 130°C for 20 h. The reaction was complete after TLC monitoring, and the mixture was cooled to room temperature, filtered through diatomaceous earth, and the residue was washed with DCM and EA. The filtrate was collected and concentrated in vacuo. The mixture was diluted with water, extracted with ethyl acetate, washed with saturated NaCl, concentrated in vacuo, and purified by column chromatography to obtain 0.4 g (yield 64.57%). 1H NMR (300MHz, DMSO-d6) δ8.55(s,1H),7.02(dd,J=8.2,1.8Hz,1H),6.77(d,J=1.9Hz,1H),6. 72(d,J=8.3Hz,1H), 6.68(d,J=2.0Hz,1H), 6.58–6.65(m,2H), 6.50(dd,J=8.3,1.6Hz,1H).

[0139] Step 4: Synthesis of compound 15-6

[0140] The synthesis method was the same as that of compound 10-2 in Example 9, except that phenoxazine was replaced by 2-cyano-phenoxazine.

[0141] Step 2: Synthesis of compound 15

[0142] The synthesis method was the same as that of compound 5 in Example 4, except that 2-cyano-phenoxazine was used instead of 2-cyanophenothiazine.

[0143] The synthesis gave 46 mg of a light yellow solid (yield 13.98%). 1 H NMR(300MHz,Chloroform-d)δ7.06–6.96(m,3H),6.80(d,J=3.1Hz,1H),6.72(d,J=3.7Hz,3H),3.71(q ,J=4.2,2.9Hz,4H),2.86–2.58(m,9H),2.53(d,J=6.3Hz,3H),1.91(t,J=6.7Hz,2H).HRMS(ESI):calcd forC 22 H 27 N4O2 + [M+H] + 379.2128, found 379.2128.Purity:93.86% by HPLC(t R =6.38min, MeOH / H2O=80:20).

[0144] Example 15: Preparation of Compound 16

[0145]

[0146] Step 1: Synthesis of compound 16-3

[0147] Compound 16-1 (2 g, 18.32 mmol) and 16-2 (2.54 g, 18.32 mmol) were dissolved in DMF, anhydrous K2CO3 (7.6 g, 54.96 mmol) was added, and the mixture was reacted at 130°C for 3 h. After the reaction was completed as monitored by TLC, the mixture was diluted with water, extracted with ethyl acetate, washed with saturated NaCl, concentrated in vacuo, and purified by column chromatography to obtain 1.6 g (yield 41.93%). 1 H NMR (300MHz, DMSO-d6) δ8.94(s,1H),7.18(dd,J=8.2,1.8Hz,1H),6.99(d,J=1.9Hz,1 H), 6.78 (ddd, J=7.7, 6.2, 2.8Hz, 1H), 6.70–6.61 (m, 2H), 6.50 (dd, J=8.3, 1.6Hz, 2H).

[0148] Step 2: Synthesis of compound 16-4

[0149] The synthesis method was the same as that of compound 10-2 in Example 9, except that phenoxazine was replaced by 3-cyano-phenoxazine.

[0150] Step 3: Preparation of compound 16

[0151] The synthesis method was the same as that of compound 5 in Example 4, except that 3-cyano-phenoxazine was used instead of 2-cyanophenothiazine.

[0152] The synthesis gave 32 mg of a light yellow solid (yield 36.54%). 1 H NMR(300MHz,Chloroform-d)δ7.11(dd,J=8.4,2.0Hz,1H),6.90–6.73(m,3H),6.72–6.58(m,3H),3.70(t,J=5.4Hz,2H),3 .65(t,2H),2.82(s,1H),2.69–2.62(m,5H),2.58(s,4H),2.48(t,J=6.5Hz,3H),1.85(p,J=6.8Hz,2H).HRMS(ESI):calcd for C 22 H 27 N4O2 + [M+H] + 379.2128, found 379.2126.Purity:93.86% by HPLC(t R =5.35min, MeOH / H2O=80:20).

[0153] Example 16: Preparation of Compound 17

[0154]

[0155] Step 1: Synthesis of compound 17-2

[0156] The synthesis method was the same as that of compound 7-1 in Example 6, except that 3-cyano-phenoxazine was used instead of 2-cyanophenothiazine.

[0157] The resulting product was a yellow solid (300 mg, yield 63.96%). 1 H NMR (300MHz, DMSO-d6) δ7.74(s,1H),7.42(d,J=8.5Hz,1H),7.17(d,J=2.0Hz,2H),6.89(t,J=6.9Hz,1H), 6.84–6.76(m,2H), 6.75–6.66(m,2H), 3.84(t,J=6.3Hz,2H), 3.75(t,J=7.9Hz,2H), 2.03(p,J=7.4Hz,2H).

[0158] Step 2: Synthesis of compound 17

[0159] The synthesis method was the same as that of compound 5 in Example 4, except that 3-cyano-phenoxazine was used instead of 2-cyanophenothiazine.

[0160] The synthesis gave 23 mg of a light yellow solid (yield 16.35%). 1 H NMR(300MHz, DMSO-d6)δ7.75(s,1H),7.41(dd,J=8.4,2.1Hz,1H),7.16(d,J=2.1Hz,2H),6.91–6.76(m,3H),4.67(s, 1H),3.65(t,J=7.4Hz,2H),3.59(s,2H),2.62(s,7H),2.51(d,J=2.3Hz,5H),1.73(p,J=7.2Hz,2H).HRMS(ESI):calcd for C 22 H 29 N4O3 + [M+H] + 397.2234, found 397.2230.Purity:97.86% by HPLC(t R =4.56min, MeOH / H2O=80:20).

[0161] Example 17: Preparation of Compound 18

[0162]

[0163] Step 1: Synthesis of compound 18-3

[0164] Compound 18-1 (500 mg, 3.73 mmol), 18-2 (520 mg, 3.73 mmol) and KOH (420 mg, 7.46 mmol) were placed in a three-necked flask, nitrogen was protected, DMSO was added while stirring, and the temperature was raised to 100°C for 3 h. After the reaction was complete as monitored by TLC, water was added to dilute, solid precipitated, filtered and dried to obtain 560 mg of dark green solid (yield 64.41%). 1H NMR (300 MHz, DMSO-d6) δ9.25 (s, 1H), 7.23 (dd, J = 8.2, 1.8 Hz, 1H), 7.13 (dd, J = 8.3, 2.0 Hz, 1H), 7.08 (d, J = 1.8 Hz, 1H), 6.84–6.73 (m, 2H), 6.54 (d, J = 8.1 Hz, 1H).

[0165] Step 2: Synthesis of compound 18-4

[0166] The synthesis method is the same as the synthesis of compound 7-1 in Example 6, except that 3,7-dicyano-phenoxazine is used to replace 2-cyanophenothiazine.

[0167] Step 3: Preparation of compound 18,

[0168] The synthesis method was the same as that of compound 5 in Example 4, except that 3,7-dicyano-phenoxazine was used instead of 2-cyanophenothiazine.

[0169] The synthesis gave 216 mg of off-white solid (yield 41.46%). 1 H NMR(300MHz,Deuterium Oxide)δ7.12(dd,J=8.4,1.9Hz,1H),7.02(dd,J=8.2,1.7Hz,1H),6.95(d,J=1.8Hz,1H),6.81(d,J=1.9Hz,1H),6.64(d,J=8.3Hz,2H) ,3.66(t,J=5.3Hz,2H),3.60(t,2H),2.72–2.60(m,7H),2.54(s,3H),2.43(t,J=6.2Hz,2H),1.78(p,J=6.7Hz,2H).HRMS(ESI):calcd forC 23 H 26 N5O2 + [M+H] + 404.2081, found 404.2076.Purity:96.38% by HPLC(t R =2.35min, MeOH / H2O=80:20).

[0170] Example 18: Preparation of Compound 19

[0171]

[0172] Step 1: Synthesis of compound 19

[0173] The synthesis method is the same as the synthesis of compound 7-1 in Example 6, except that 3,7-dicyano-phenoxazine is used to replace 2-cyanophenothiazine.

[0174] The synthesis gave 36 mg of a white solid (yield 33.05%). 1 H NMR (300MHz, DMSO-d6) δ7.87(s,1H),7.75(s,1H),7.41(dd,J=8.4,2.1Hz,1H),7.34–7.22(m,2H),7.17(t,J=2.4Hz,3H),6.83(d,J=8.5Hz,1H),6.7 1(d,J=8.2Hz,1H),4.37(t,J=5.1Hz,1H),3.69(t,J=7.3Hz,2H),3.50(t,J=5.9Hz,2H),2.51–2.21(m,12H),1.72(t,J=7.1Hz,2H).HRMS(ESI):calcd forC 23 H 30 N5O4 + [M+H] + 440.2292, found 440.2285.Purity:93.36% by HPLC(t R =4.38min, MeOH / H2O=80:20).

[0175] Example 19: Preparation of Compound 20

[0176]

[0177] The synthesis method is the same as the synthesis of compound 5 in Example 4, except that N-ethylpiperazine is used instead of hydroxyethylpiperazine.

[0178] The synthesis yielded 268 mg of a white solid (yield 76.36%). 1H NMR(300MHz,Chloroform-d)δ7.16(ddd,J=15.2,7.5,1.5Hz,2H),7.03(d,J=8.0Hz,1H),6.99–6.85(m,4H),3.91(t, J=6.8Hz,2H),2.83–2.48(m,8H),2.48–2.23(m,4H),1.96(p,J=7.0Hz,2H),1.11(t,J=7.2Hz,3H).HRMS(ESI):calcd for C 21 H 27 ClN3S + [M+H] + 388.1608, found 388.1600.Purity:96.46% by HPLC(t R =3.19min, MeOH / H2O=80:20).

[0179] Example 20: Preparation of Compound 21

[0180]

[0181] Step 1: Synthesis of compound 21-2

[0182] Dissolve 21-1 (2.0 g, 8.56 mmol) in toluene, slowly add chloroacetyl chloride (1.5 g, 12.84 mmol) dropwise in an ice bath, raise the temperature to 80°C, and react for 6-8 hours. Dilute with water, extract with EA, wash with saturated NaCl, concentrate the organic phase, separate and purify by column chromatography, and obtain 1.89 g of a white solid (yield 71.20%). 1 H NMR(300MHz,Chloroform-d)δ7.61(dd,J=6.9,1.4Hz,1H),7.55(d,J=2.2Hz,1H),7.43(dd,J=7 .1,1.3Hz,1H),7.40–7.34(m,2H),7.28–7.24(m,1H),7.20(dd,J=8.1,2.3Hz,1H),4.21(s,2H).

[0183] Step 2: Synthesis of compound 21-3

[0184] Under ice bath, add 3 ml BH3-THF to 21-2 (800 mg, 2.58 mmol), add BF3-Et2O (3.66 g, 25.8 mmol), and stir overnight to react. After TLC monitoring, water was slowly added dropwise under ice bath to quench, EA was extracted, saturated NaCl was washed, the organic phase was concentrated, and column chromatography was used for separation and purification to obtain 0.43 g of white solid (yield 56.29%).

[0185] Step 3: Synthesis of compound 21

[0186] The synthesis method was the same as that of Compound 5 in Example 4, except that 2-chloro-10-(2-chloroethyl)-10H-phenothiazine was used instead of 2-chloro-10-(3-chloropropyl)-10H-phenothiazine.

[0187] The synthesis yielded 95 mg of a white solid (yield 36.08%). 1 H NMR(300MHz,Chloroform-d)δ7.26–7.14(m,2H),7.07(d,J=8.1Hz,1H),7.02–6.89(m,4H), 4.03(t,2H),3.87(t,J=5.1Hz,2H),3.15–2.99(m,6H),2.91–2.78(m,6H).HRMS(ESI):calcd for C 20 H 25 ClN3OS + [M+H] + 390.1401, found390.1397.Purity:95.66% by HPLC(t R =4.82min, MeOH / H2O=80:20).

[0188] Example 21: Preparation of Compound 22

[0189]

[0190] Step 1: Synthesis of compound 22-2, same as the synthesis of compound 21-2

[0191] Step 2: Synthesis of compound 22

[0192] The synthesis method was the same as that of Compound 5 in Example 4, except that 2-chloro-10-chloroacetyl-10H-phenothiazine was used instead of 2-chloro-10-(3-chloropropyl)-10H-phenothiazine.

[0193] 22-1 (500 mg, 1.62 mmol) and hydroxyethylpiperazine (252.6 mg, 1.94 mmol) were dissolved in acetonitrile, and anhydrous K2CO3 (448 mg, 3.24 mmol) was added to obtain 365 mg of a white solid (yield 56.06%). 1 H NMR(300MHz,Chloroform-d)δ7.70(d,J=2.2Hz,1H),7.57(dd,J=7.9,1.4Hz,1H),7.48(dd,J=7.6,1.6Hz,1H),7.37(td,J =8.2,2.6Hz,2H),7.29–7.22(m,2H),3.62(t,J=5.4Hz,2H),3.33(d,J=4.8Hz,2H),2.64–2.39(m,10H).HRMS(ESI):calcd for C 20 H 23 ClN3O2S + [M+H] + 404.1194, found404.1187.Purity:96.29% by HPLC(t R =3.33min, MeOH / H2O=80:20).

[0194] Example 22: Preparation of Compound 23

[0195]

[0196] 23-1 (2.0 g, 8.56 mmol) and triphosgene (1.52 g, 5.136 mmol) were placed in a three-necked flask, protected by nitrogen, and 1,2-dichloroethane and 1 ml of pyridine were added, and the temperature was raised to 75°C for 3 h. The temperature was lowered to room temperature, and after TLC monitoring the reaction was complete, hydroxyethylpiperazine (1.12 g, 8.56 mmol) was added, and the temperature was raised to 50°C for 2-3 h. After TLC monitoring the reaction was complete, water was slowly added dropwise under an ice bath to quench, and the mixture was extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain 56 mg of a white solid (two-step yield 1.5%). 1H NMR(300MHz,Chloroform-d)δ7.89(d,J=2.1Hz,1H),7.47(dd,J=8.1,1.3Hz,1H),7.35–7.20(m,3H),7.14(m,J=7.9,1.7 Hz,2H),3.65(t,J=5.3Hz,2H),3.48(t,J=5.0Hz,4H),2.58(t,J=5.3Hz,2H),2.49(t,J=5.0Hz,4H).HRMS(ESI):calcdfor C 19 H 21 ClN3O2S + [M+H] + 390.1037, found390.1038.Purity:96.44% by HPLC(t R =3.21min, MeOH / H2O=80:20).

[0197] Example 23: Preparation of Compound 24

[0198]

[0199] The synthesis method was the same as that of Compound 5 in Example 4, except that 2-chloro-10-(4-chlorobutyl)-10H-phenothiazine was used instead of 2-chloro-10-(3-chloropropyl)-10H-phenothiazine.

[0200] The synthesis yielded 106 mg (yield 41.12%). 1 H NMR(300MHz,Chloroform-d)δ7.44–7.33(m,2H),7.27(d,J=8.1Hz,1H),7.22–7.04(m,4H),4.10(t,J=6.9Hz,2H),3. 86(t,J=5.4Hz,2H),2.96(s,1H),2.85–2.55(m,12H),2.08(p,J=7.2Hz,2H),1.87(p,J=7.3Hz,2H).HRMS(ESI):calcd for C 22 H 29 ClN3OS + [M+H] + 418.1714,found 418.1708.Purity:95.38%byHPLC(t R =3.34min, MeOH / H2O=80:20).

[0201] Example 24: Preparation of Compound 25

[0202]

[0203] Step 1: Preparation of compound 25-2

[0204] The synthesis method was the same as that of compound 21-2 in Example 21, except that 2-cyanopheothiazine was used instead of 2-chlorophenothiazine.

[0205] Step 2: Preparation of compound 25-3

[0206] The synthesis method was the same as that of compound 21-3 in Example 20, except that 2-cyanophenothiazine was used instead of 2-chlorophenothiazine and the reaction time was adjusted to 10 min.

[0207] Step 3: Preparation of compound 25-4

[0208] The synthesis method was the same as that of compound 7-1 in Example 6, except that 2-cyano-10-(2-chloroethyl)-10H-phenothiazine was used instead of 2-cyano-10-(3-chloropropyl)-10H-phenothiazine.

[0209] Step 4: Preparation of compound 25

[0210] The synthesis method was the same as that of Compound 5 in Example 4, except that 2-carboxamide-10-(2-chloroethyl)-10H-phenothiazine was used instead of 2-carboxamide-10-(3-chloropropyl)-10H-phenothiazine.

[0211] The synthesis yielded 16 mg of a light yellow solid (yield 36.68%). 1 H NMR(300MHz,Chloroform-d)δ7.76(dd,J=7.5,1.5Hz,1H),7.54(s,2H),7.54(s,1H),7.21–7.17(m,2H),7.14–7.11(m,1H),7.09–7.03( m,2H),4.03(t,J=7.1Hz,2H),3.99(t,J=7.5Hz,1H),3.54(q,J=7.2Hz,2H),2.95(t,J=7.1Hz,2H),2.65–2.49(m,10H).HRMS(ESI):calcd for C 21 H 27 N4O2S + [M+H] + 399.1849, found 399.1846.Purity:98.35% by HPLC(t R =2.68min, MeOH / H2O=80:20).

[0212] Examples 25 and 26: Preparation of Compounds 26 and 27

[0213]

[0214] Step 1, 2: The synthesis of compounds 26-2 and 26-3 is the same as that of compound 5, except that hydroxyethylpiperazine is replaced by anhydrous piperazine.

[0215] Step 3: Synthesis of compound 26-4

[0216] Compound 26-3 (500 mg, 1.39 mmol) and bromoacetonitrile (331.2 mg, 2.78 mmol) were dissolved in acetonitrile, anhydrous K2CO3 was added, and the mixture was reacted at room temperature for 16 h. After the reaction was completed as monitored by TLC, the inorganic salt was removed by suction filtration, and the mixture was concentrated in vacuo and purified by sand column chromatography to obtain 536 mg of a white solid (yield 96.71%).

[0217] Step 4: Synthesis of compound 26

[0218] The synthesis method was the same as that of compound 7-1 in Example 6, except that 2-cyanophenothiazine was replaced by 26-4.

[0219] The synthesis yielded 32 mg of white solid (yield 30.62%) 1 H NMR(300MHz,Chloroform-d)δ7.22(d,J=8.0Hz,1H),7.23–7.16(m,2H),7.16–7.07 (m,3H),7.05(d,J=2.2Hz,1H),6.78(d,J=7.7Hz,1H),6.64(d,J=7.5Hz,1H),3.93(t ,J=6.5Hz,2H),3.13(s,2H),2.67(t,J=4.6Hz,2H),2.61(dd,J=5.0,4.3Hz,2H),2. 54(t,J=4.6Hz,4H),2.45(t,J=6.2Hz,2H),1.82(q,J=6.4Hz,2H).HRMS(ESI):calcd for C 21 H 26 C1N4OS + [M+H] + 417.1510, found417.1511.Purity:96.36% by HPLC(t R =3.69min, MeOH / H2O=80:20).

[0220] Step 5: Preparation of compound 27

[0221] Under ice bath, add LiAlH4 ether solution to the ether solution of 27-4, react at room temperature for 2 h after the addition is complete, monitor the reaction by TLC, slowly add saturated NaHCO3 solution to the reaction solution under ice bath to quench, extract with EA, separate and purify by column chromatography to obtain 68 mg white solid (yield 33.66%). 1 H NMR(300MHz,Chloroform-d)δ7.18(m,2H),7.05(d,J=8.1Hz,1H),7.01–6.84(m,4H),3.93(t,J=6.9Hz,2H), 3.55(t,J=29.1Hz,2H),2.66–2.20(m,12H),1.97(p,J=7.0Hz,2H),1.31(d,J=8.8Hz,2H).HRMS(ESI):calcd forC 21 H 28 C1N4S + [M+H] + 403.1717,found403.1719.Purity:95.86% by HPLC(t R =2.36min, MeOH / H2O=80:20).

[0222] Example 27: Preparation of Compound 28

[0223]

[0224] The preparation process of compound 28 is the same as the synthesis of compound 5 in Example 4, except that 1-bromo-3-chloro-2-methylpropane is used to replace 1-bromo-3-chloropropane.

[0225] The synthesis yielded 68 mg of a white solid (yield 68.56%). 1 H NMR(300MHz,Chloroform-d)δ7.03(dd,J=7.9,5.7Hz,2H),6.92(d,J=8.7Hz,1H),6.85–6.73(m,4H),3.95(dd,J=13.3,3.9Hz,1H),3.52(t,J=5.3Hz,2H), 3.37(dd,J=13.4,8.2Hz,1H),3.05(s,2H),2.52–2.44(m,8H),2.35–2.25(m, 2H),2.21–2.15(m,1H),2.12(s,2H),0.83(d,J=6.2Hz,3H).HRMS(ESI):calcd for C 22 H 29 ClN3OS + [M+H]+ 418.1714,found 418.1714.Purity:98.62%byHPLC(t R =4.33min, MeOH / H2O=80:20).

[0226] Example 28: Preparation of Compound 29

[0227]

[0228] Step 1: Preparation of compound 29-2

[0229] 29-1 (1.5 g, 6.42 mmol) was dissolved in DMF, and epibromopropane (2.64 g, 19.25 mmol) and Cs2CO3 (8.37 g, 25.68 mmol) were added, and the reaction was allowed to proceed overnight at room temperature. The reaction was monitored by TLC, diluted with water, extracted with EA, and the organic phase was collected and dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain 1.68 g of an oil (yield 90.33%). 1 H NMR (300MHz, Chloroform-d) δ7.25–7.06(m,6H),7.04(d,J=2.2Hz,1H),4.16(dd,J=11.9,3.1Hz,2H),3.91–3.85(m,1H),2.82(dd,J=12.5,2.6Hz,2H).

[0230] Step 2: Preparation of compound 29

[0231] 29-2 (200 mg, 0.69 mmol) was added to DMF, hydroxyethylpiperazine (108 mg, 0.83 mmol) was added, and anhydrous K2CO3 (286 mg, 2.07 mmol) was added, and the mixture was reacted at 80°C for 10 h. After the reaction was completed as monitored by TLC, the mixture was diluted with water, extracted with EA, and the organic phase was collected, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain 89 mg of a white solid (yield 30.79%). 1 HNMR(300MHz,Chloroform-d)δ7.23(dd,J=8.7,7.1Hz,2H),7.11(d,J=8.0Hz,1H),7.07–6.94(m,4H),4.21(ddt,J=9. 4,7.0,3.4Hz,1H),4.15–3.87(m,2H),3.72(t,J=5.2Hz,2H),2.69(ddt,J=29.2,21.6,12.0Hz,12H).HRMS(ESI):calcd for C 21 H 27 ClN3O2S+ [M+H] + 420.1507, found 420.1506.Purity:98.11% by HPLC(t R =4.27min, MeOH / H2O=80:20).

[0232] Example 29: Preparation of Compound 30

[0233]

[0234] The preparation process of compound 30 is the same as that of compound 29, except that phenoxazine is used to replace 2-chlorophenothiazine.

[0235] The synthesis yielded 132 mg of a white solid (yield 42.74%). 1 H NMR(300MHz,Chloroform-d)δ6.83–6.73(m,2H),6.70–6.57(m,6H),4.12–4.01(m,1H),3.71– 3.50(m,4H),3.30–2.86(m,2H),2.70(d,J=9.7Hz,2H),2.65–2.40(m,10H).HRMS(ESI):calcd for C 21 H 28 N3O3 + [M+H] + 370.2125, found 370.2120.Purity:97.72% by HPLC(t R =2.27min, MeOH / H2O=80:20).

[0236] Example 30: Preparation of Compound 31

[0237]

[0238] The preparation of compound 31 was the same as that of compound 30 except that 4-piperidinylethanol was used in place of hydroxyethylpiperazine.

[0239] 57 mg (yield 37.01%) of compound 31 was obtained as a white solid. 1H NMR(300MHz,Chloroform-d)δ6.80(td,J=7.2,6.7,2.1Hz,2H),6.73–6.56(m, 6H),4.11(m,1H),3.71(t,J=6.3Hz,2H),3.59(td,J=15.4,5.6Hz,2H),2.96(dd ,J=32.8,11.4Hz,2H),2.63–2.43(m,2H),2.36(td,J=11.5,2.5Hz,1H),2.05(t d,J=11.8,2.6Hz,1H),1.84–1.66(m,2H),1.62–1.29(m,5H).HRMS(ESI):calcd for C 22 H 29 N2O3 + [M+H] + 369.2172, found 369.2172.Purity:99.03% by HPLC(t R =2.35min, MeOH / H2O=80:20).

[0240] Example 31: Preparation of Compound 32

[0241]

[0242] The preparation process of compound 32 is the same as that of compound 29, except that 2-cyanophenoxazine is used to replace phenoxazine.

[0243] The synthesis gave 26 mg of a white solid (yield 21.77%). 1 H NMR(300MHz,Chloroform-d)δ7.51(dd,J=8.6,2.2Hz,1H),7.42(d,J=2.2Hz,1H),7.18–7.07(m,3H),6.90(d,J=8.6Hz ,1H),6.88–6.81(m,1H),4.10–3.98(m,1H),3.63(td,J=13.9,12.4,6.8Hz,4H),2.80–2.39(m,12H).HRMS(ESI):calcd for C 22 H 27 N4O3 + [M+H] + 395.2078,found395.2081.Purity:98.11%by HPLC(t R =4.17min, MeOH / H2O=80:20).

[0244] Examples 32 and 33: Preparation of Compounds 33 and 34

[0245]

[0246] The preparation process of compound 34 is the same as that of compound 29 except that phenoxazine is replaced by 3-cyanophenoxazine.

[0247] The synthesis yielded 136 mg of a white solid (yield 45.56%). 1 H NMR(300MHz,Chloroform-d)δ7.08(d,J=8.4Hz,1H),6.86–6.71(m,4H),6.65(s,2H),4.10–3.98(m,1 H),3.63(td,J=13.9,12.4,6.8Hz,4H),2.77(d,J=7.5Hz,2H),2.70–2.44(m,10H).HRMS(ESI):calcd forC 22 H 27 N4O3 + [M+H] + 395.2078, found395.2075.Purity:97.55% by HPLC(t R =3.88min, MeOH / H2O=80:20).

[0248] The preparation process of compound 33 is the same as that of compound 7-1 except that 2-cyanophenothiazine is replaced by compound 33.

[0249] The synthesis gave 26 mg of a white solid (yield 31.08%). 1 H NMR(300MHz,Chloroform-d)δ7.74(dd,J=8.1,1.9Hz,1H),7.34–7.29(m,2H),7.18–7.09(m,3H),6.86–6.79(m,1H), 4.10–3.98(m,1H),3.63(td,J=13.9,12.4,6.8Hz,4H),2.77(d,J=7.5Hz,2H),2.70–2.44(m,10H).HRMS(ESI):calcd for C 22 H 28 N4O4 + [M+H] + 413.2183, found 413.2180.Purity:98.11% by HPLC(t R =4.27min, MeOH / H2O=80:20).

[0250] Example 34: Preparation of Compound 35

[0251]

[0252] The preparation process of compound 35 was the same as that of compound 229 except that 2-chlorocarbazole was used instead of phenoxazine.

[0253] The synthesis yielded 165 mg of a white solid (yield 62.23%). 1 H NMR(300MHz,Chloroform-d)δ8.06(d,J=7.8Hz,1H),8.00(d,J=8.3Hz,1H),7.5 3(d,J=1.8Hz,1H),7.49(d,J=4.0Hz,2H),7.28(d,J=2.3Hz,1H),7.26–7.18(m, 1H), 4.35 (dd, J=5.1, 2.7Hz, 2H), 4.22 (dt, J=8.4, 5.1Hz, 1H), 3.63 (t, J=5.3Hz ,2H),2.67(s,2H),2.56(t,J=5.4Hz,5H),2.51–2.37(m,5H).HRMS(ESI):calcd for C 21 H 26 ClN3O2 + [M+H] + 388.1786,found388.1788.Purity:98.11%byHPLC(t R =4.27min, MeOH / H2O=80:20).

[0254] Example 35: Evaluation of the binding ability of compound 1 to STING by isothermal titration calorimetry (ITC)

[0255] Compound 1 was purchased from commercial sources, CAS number: 58-39-9, purity: 99.72 wt%.

[0256] The ITC experiment uses the MicroCal ITC 200 instrument to measure the binding affinity between proteins and ligands. The ITC experiment can fit and quantitatively calculate the binding thermodynamic parameters, including the number of binding sites (n), binding constant (Ka), reaction enthalpy change (ΔH), entropy change (ΔS), etc., by detecting the heat change (endothermic or exothermic) when the protein solution and the small molecule (ligand) solution interact.

[0257] Extraction and purification of STING protein: DNA-encoded STING (residues 137-375 at the C-terminus) gene was cloned into the pET28a vector and transfected into competent BL21 (DE3) cells and cultured overnight on solid medium. After picking a single clone for amplification in liquid medium, IPTG (1mM) was added and cultured for 16h at low temperature (16°C) to induce protein expression. Cells were lysed by ultrasound for 30min using lysis buffer [20mM Tris-HCl (pH 7.4), 200mM NaCl, and 0.02mM β-mercaptoethanol], centrifuged at 12000rpm for 20min at 4°C, and the supernatant was purified in AKTA (balance solution: 300mM NaCl, 20mMTris-HCl, 5mM imidazole, pH=7.4; elution solution: 300mM NaCl, 20mM Tris-HCl, 400mM imidazole, pH=7.4). The obtained protein was dialyzed against PBS buffer (0.2 mM KH2PO4, 1 mM Na2HPO4, 20 mM NaCl, 0.3 mM, pH = 7.4) overnight.

[0258] The protein used in this experiment is STING extracted and purified by ourselves. WT Protein, buffer is 20mM Tris and 200mM NaCl (pH 8.2). Use Tris buffer to prepare 100ul of 100μM compound. Since the mother solution of the compound is 10mM, the DMSO content is 1% (molar ratio); prepare 5μM STING WT The protein solution is 500 μl. It is important to ensure that the DMSO content in the protein and the compound is consistent (1%). Then slowly inject the protein into the cleaned sample pool (cell), and then absorb the compound into the titration needle (syringe) according to the instrument instructions. Set the instrument parameters, total number of drops 19 drops, each titration volume 2 μl, balance 600 s, sample pool temperature 25 ° C, first drop delay 60 s, first drop volume 0.5 μl, stirring speed 750 rpm, interval time 120 s. After the titration is completed, use Origin software to fit and analyze to obtain enthalpy change (ΔH), entropy change (ΔS), number of binding sites (n), and binding constant (Ka).

[0259] The compound 1 tested showed binding activity to STING. Figure 1 As shown, the binding affinity constant K of compound 1 d is 1 μM.

[0260] Example 36: The binding of compound 1 to STING was verified by pulse sequence spin echo (CPMG) and saturation transfer difference nuclear magnetic resonance (STD-NMR) experiments.

[0261] First, STING WT The protein was replaced with heavy water (D2O), and then 100 μM compound (2wt% DMSO) and a mixed solution of 100 μM compound and 2 μM protein (2wt% DMSO) were measured using a 600 MHz nuclear magnetic resonance spectrometer (Bruker), and the data were analyzed using MestReNova software.

[0262] like Figure 2 As shown, CPMG result analysis, blue is the NMR spectrum of compound 1, red is STING WT The NMR spectra of the STING protein after incubation with the compound. After the two images are superimposed, the characteristic peaks of compound 1 are significantly reduced, indicating that compound 1 and STING WT The STD-NMR results showed that the characteristic peaks of compound 1 were present in the difference spectrum, which also proved its binding to STING protein.

[0263] Example 37: RT-qPCR assay to detect the effect of compound 1 on STING downstream cytokines

[0264] THP1 cells (Human acute monocytic leukemia, InvivoGen) were cultured in RPMI 1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2 until the density reached 80%-90%. The cells were collected by centrifugation at 1000 rpm and diluted to 1×10 6 Cells were seeded into 6-well transparent cell culture plates and treated with different concentrations of the test compound (DMSO group, 10 μM, 20 μM, 30 μM) for 24 h. After incubation, cells were collected, the culture medium was removed as much as possible, and RNA was extracted using an RNA extraction kit (Tiangen Biotechnology, Catalog No. DP419) according to the instructions. RNA was reverse transcribed into cDNA using a HiScript III RTSuperMix (gDNA wiper) kit (Vazyme, Catalog No. R323-01), and RT-qPCR analysis was performed using ChamQSYBR qPCR Master Mix (Vazyme, Q341-02 / 03) and primers (GAPDH as an internal reference), and 2 -ΔΔCt The expression levels of IFN-β and CXCL10 mRNA were analyzed by the method.

[0265] like Figure 3As shown, in the RT-qPCR experiment, the administration concentration of compound 1 was 10 μM, 20 μM, and 30 μM, and the administration time was 24 h. The results showed that compound 1 could induce the expression of downstream cytokines CXCL10 and IFN-β mRNA in a concentration-dependent manner when the administration time was 24 h.

[0266] The primer sequences are as follows: GAPDH-F: AAGGCTGTGGGCAAGGTCATC, GAPDH-R: AGGTGGAGGAGTGGGTGTCG; CXCL10-F: ATTTGCTGCCTTATCTTTCTG, CXCL10-R: CTTGATGGCCTTCGATTCTG; IFNβ-F: CATTACCTGAAGGCCAAGGA, IFNβ-R: AGCAATTGTCCAGTCCCAGA.

[0267] Example 38: Western-Blot experiment to investigate the effect of compound 1 on STING and downstream proteins

[0268] First, a time-dependent Western-Blot experiment was performed: THP-1 cells were treated with compound 1 (10 μM) for 1 h, 3 h, 6 h, and 12 h, and then centrifuged at 1000 rpm to collect the cells. After washing with PBS three times, RIPA lysis buffer, protease inhibitors, and phosphatase inhibitors were added, and the cells were lysed on ice for 15 min. After lysis, the cells were centrifuged at 12000 rpm for 10 min, and the supernatant was taken. The protein concentration was determined using a BCA (Thermo, Waltham, MA) kit. 5× Loading Buffer (volume ratio (4:1)) was added to the supernatant, mixed well, and boiled at 100°C for 10 min. The prepared samples can be stored in a -20 refrigerator. 40 ug of the sample was added to 15-well SDS-PAGE gels, and the gel was run at 60 V isobaric pressure for 30 min and then switched to 120 V. After the gel was run, it was transferred to a PVDF membrane (PerkinElmer, Northwalk, CT, USA), and the membrane transfer instrument was run at an isobaric pressure of 0.3 A. The PVDF membrane was then blocked with 1% BSA for 1 h, and then incubated with the corresponding antibodies at 4°C overnight as required. After the incubation, the PVDF membrane was washed three times with TBST, and then incubated with the secondary antibody labeled with DyLight800 at room temperature for 1 h. After the incubation, the PVDF membrane was washed three times with TBST again, and finally developed with ECL luminescent liquid, and the bands were scanned, stored and analyzed using the Odyssey Infrared Imaging System (LI-COR; Lincoln, NE).

[0269] Dose-effect Western-Blot experiment: THP-1 cells were treated with compound 1 (10 μM, 20 μM, 30 μM) for 3 h, washed with PBS, and lysed on ice with RIPA lysis buffer. The rest of the operation steps were the same as those of the simultaneous WB experiment.

[0270] like Figure 4 As shown, in the time-effect Western-Blot experiment, the administration time was 1h, 3h, 6h, and 12h, and the administration concentration was 20μM. The results showed that compound 1 significantly induced the phosphorylation of STING, IRF3, and TBK1 when the administration time was 3h, so the administration time was selected as 3h.

[0271] In the dose-effect Western-Blot experiment, the administration concentration of compound 1 was 10μM, 20μM, and 30μM, and the administration time was 3h. The results showed that compound 1 could induce the phosphorylation of downstream STING, IRF3, and TBK1 in a concentration-dependent manner. Therefore, compound 1 was confirmed to be a STING agonist, which could induce the expression of downstream proteins by activating the STING-TBK1-IRF signaling pathway.

[0272] The information of antibodies used in the experiment is as follows:

[0273] GAPDH (ProteinTech, 1E6D9), STING (Cell Signaling Technology, 13647S), P-STING (Cell Signaling Technology, 19781S), IRF3 (ProteinTech, 11312-1-AP), p-IRF3 (ser386) (Abcam, ab76493), TBK1 (ProteinTech, 2D7B1), p-TBK1 (Abcam, ab109272).

[0274] Example 39: Based on 293-Dual TM hSTING R232 cells were used to determine the agonist activity of compounds on the STING signaling pathway.

[0275] Experimental principle: This experiment evaluates the activation of the compound on the STING signaling pathway by detecting the activation of the compound on IRF, the binding of the compound to the interferon stimulated response element (ISRE), and the expression of interferon β. TM hSTING-R232 cells (Invivogen: 293d-r232) were generated by TMNull (ISG / KI-IFNβ) cells were stably transfected with the R232 subtype of hSTING. It can stably express two inducible reporter genes: the secreted embryonic alkaline phosphatase (SEAP) reporter gene and the secreted Lucia luciferase reporter gene, which can be expressed by using QUANTI-Blue TM The level of SEAP was measured by reading the optical density (OD) at 620 nm using the reagent (Invivogen: rep-qbs, rep-qbs2) to evaluate the induction of interferon regulatory factor (IRF3); the activation of SEAP can also be assessed by using QUANTI-Luc TM Relative light units (RLU) were read using the Invivogen reagent (Invivogen: rep-qlc1, rep-qlc2) to measure the level of Lucia luciferase and further evaluate the induction of IFN-β expression.

[0276] Experimental steps: 293-Dual TM hSTING-R232 cells were treated with penicillin, streptomycin, and normocin TM , blasticidin, hygromycin and Zeocin TM DMEM medium containing antibiotics (plus 10% fetal bovine serum FBS) was cultured in an incubator at 37°C and 5% CO2 until the density reached 80%-90%, digested and collected by centrifugation (1000 rpm), and then diluted with DMEM medium containing 10% fetal bovine serum, and then 100 μL / well, 1×10 5 Cells were inoculated into a 96-well transparent cell culture plate and incubated at 37°C for 18-24h. After the cells reached 60-70% adhesion, the remaining culture medium was aspirated, and the gradient dilution solution of the test compound (10 concentrations were diluted according to the experimental requirements, and 3 replicate wells were set) was added at 100μL / well and incubated at 37°C for 24h. Then 10μL of cell supernatant was aspirated into each well of a new 96-well cell culture plate, and 90μL of QUANTI-Blue was added in a dark place. TM The solution was incubated at 37°C for 3 h, and the optical density (OD value) at 620 nm was read using a microplate reader to measure the level of SEAP, thereby evaluating the induction and activation of interferon regulatory factor (IRF3); in addition, 20 μL of cell supernatant was aspirated into each well of a white 96-well cell culture plate, and then 50 μL of QUANTI-Luc was added to the well in the dark. TM The solution was immediately diluted to 4% luciferase and the relative light units (RLU) were read using a luminometer to measure the level of Lucia luciferase, thereby evaluating the induction of interferon-β (IFN-β) expression. The half-maximal effect concentration (EC 50) Calculated by Graphpad Prism software log(agonist) vs response-variable slope fitting.

[0277] The experimental results are shown in Table 1:

[0278] Table 1. Agonist activity of some compounds of the present invention on STING signaling pathway

[0279]

[0280] As can be seen from Table 1, some compounds of the present invention can significantly activate the STING signaling pathway.

[0281] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or some technical features can be replaced by equivalents without departing from the spirit of the technical solution of the present invention, which should be included in the scope of the technical solution for protection of the present invention.

Claims

1. A tricyclic compound or a pharmaceutically acceptable salt thereof, characterized in that: Selected from: 。 2. A pharmaceutical composition, characterized in that: It comprises a therapeutically effective amount of the compound according to claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutical excipient and / or a pharmaceutically acceptable carrier.

Images