A method for detecting genotypes of Triplophysa yerqiangensis based on minisatellite DNA marker Trip-yark01

Abstract

A method for detecting the genotype of the Yarkand plateau loach based on the minisatellite DNA marker Trip‑yark01. First, the genomic DNA in the muscle of the Yarkand plateau loach is extracted and diluted for standby use; then, the minisatellite core sequence contained in the DNA sequence of the Yarkand plateau loach is used to design specific primers at both ends of the sequence; then, the primer is used to perform PCR amplification on the genomic DNA of individuals in different geographical groups of the Yarkand plateau loach or the Yarkand plateau loach group, and the PCR product is detected; the bands appearing in the product are analyzed to determine the genotype of each individual, and the genetic polymorphism map of the Yarkand plateau loach is obtained. The present invention is characterized in that the genetic variation map of the Yarkand plateau loach genetic marker Trip‑yark01 can be quickly obtained, and the method is simple. Moreover, compared with other molecular genetic marker technologies, small satellite DNA markers conform to the Mendelian inheritance model and are co-dominantly inherited. The results obtained can intuitively detect the genotype of each individual of the Yarkand Plateau loach; they are used for genetic markers between individuals in different geographical groups or Yarkand Plateau loach groups, pedigree authentication and construction of genetic maps.

Description

Technical Field

[0001] The invention belongs to the Yarkanden loach (Triplophysa yarkandensis) DNA molecular genetic marker technology, and relates to a technical method for detecting the Yarkanden loach minisatellite DNA marker Trip-yark01, and specifically to a genotype detection method for the Yarkanden loach minisatellite DNA marker Trip-yark01. Background Art

[0002] The Yarkanden Loach (Triplophysa yarkandensis) belongs to the genus Triplophysa and the subgenus Hedinichthys. It is widely distributed in the Tarim River system in southern Xinjiang and is a dominant indigenous fish in the Tarim River Basin. The Yarkanden Loach is a benthic cold-water fish with delicate meat, delicious taste, and higher nutritional value than ordinary fish. It is very popular among consumers. The Yarkanden Loach is not only a precious fish endemic to Xinjiang, but also an important aquatic germplasm resource in my country with extremely high economic development value. In recent years, researchers at Tarim University have begun research on artificial breeding, resource value-added, and artificial domestication of the Yarkanden Loach, and have achieved certain research results, which is expected to realize the industrialization of breeding. As an emerging breeding species, the genetic research of the Yarkanden Loach is relatively weak, and there is no report on the development of small satellite DNA markers.

[0003] Minisatellite DNA is a small repetitive DNA sequence with a core sequence of 10 to several hundred nucleotides and a copy number ranging from 10 to 1000. Therefore, minisatellite DNA is also called variable number of tandem repeats (VNTR). Although isozyme markers, RAPD markers and AFLP markers can also be used to study the genetic structure and genetic diversity of the Yarkand plateau loach, since these markers are dominant genetic markers, the detection efficiency is not as high as that of co-dominant markers such as minisatellite DNA markers. In addition, the disadvantages of isozyme markers are low polymorphism, poor stability of RAPD markers, and cumbersome operation of AFLP markers, which greatly limit their application. Minisatellite DNA sequences are widely distributed in the genome of eukaryotes, and are characterized by many types, many alleles, high polymorphism, co-dominance, Mendelian inheritance, and random distribution in the genome, and minisatellite DNA markers have high detection efficiency and stable results. However, the lack of minisatellite DNA markers has limited the development of its molecular genetics research. Therefore, there is an urgent need to obtain minisatellite DNA markers for research and application in genetic diversity, individual identification and pedigree authentication of the Yarkand plateau loach. Summary of the invention

[0004] The purpose of the present invention is to provide a highly polymorphic Yarkand plateau loach DNA molecular genetic marker technology, namely a rapid detection method of Yarkand plateau loach minisatellite DNA marker Trip-yark01, so as to make up for the shortcomings of the existing technology.

[0005] The basic concept of the present invention is to utilize the minisatellite DNA core sequence contained in the DNA sequence of the Yarkand plateau loach, design specific primers at both ends and perform PCR detection, so as to quickly detect the genetic variation of each individual of the Yarkand plateau loach in this minisatellite DNA region, obtain the polymorphism map of the primer (minisatellite DNA marker Trip-yark01) on the Yarkand plateau loach, and intuitively detect the genotype of each individual through the map. Based on the above background status and actual requirements, the present invention obtains a minisatellite DNA marker from the Yarkand plateau loach DNA sequence, named Trip-yark01, and the minisatellite DNA marker Trip-yark01 can be used for the genetic diversity analysis and pedigree authentication of the Yarkand plateau loach.

[0006] The invention is completed according to the following operation technical scheme: firstly, the genomic DNA in the muscle of the Yarkand plateau loach is extracted and diluted for standby use; then, the small satellite DNA core sequence contained in the genomic DNA sequence of the Yarkand plateau loach is used to design specific primers at both ends of the sequence; then, the primers are used to perform PCR amplification on the genomic DNA of individuals in different geographical groups of the Yarkand plateau loach or in the Yarkand plateau loach group, and the PCR products are subjected to denaturing polyacrylamide gel electrophoresis detection, so as to determine the genotype of each individual and obtain the genetic polymorphism map of the Yarkand plateau loach.

[0007] The genomic DNA of Yarkand plateau loach was extracted and diluted to 100 ng / μl. 1 μl was added to each PCR reaction, and the total reaction volume was 25 μl.

[0008] The DNA sequence containing the minisatellite DNA sequence is:

[0009] aaagggtgtttgactatttatgtacaatagatttacaattgaggagtttagggttcctgcatccggcacactggggttgtcccaaaaccctcccgcacttgattagcgccccatttagctggttaattgttatagcatagtattattatcagccttaactttggtcccgtctctagcagcattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctattcagggcattagctctggtggtcgtcaacaaagaacctgtccaaaggcatgcggatgaaacgggtgaagctcaagctgaaggttgttagacagagctgctgctgctgctgctgctgctgctgctgaatacatgatctttcgcctgacgactactctgttccctggggcactgccagcctttagccgctgctgca

[0010] The core sequence of the minisatellite DNA is: ATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGC ATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCTATTCAGGGCATTAGCT.

[0011] The sequence of the Trip-yark01 minisatellite DNA primer is:

[0012] Positive strand 5'- atcagccttaactttggtcccgt -3',

[0013] The negative strand was 5'- atccgcatgcctttggacaggt -3', and the annealing temperature when this primer was used was 55°C.

[0014] The minisatellite DNA core sequence and primer sequence are the core of the present invention, and show high polymorphism in the genetic diversity detection of Yarkand plateau loach.

[0015] The sample loading parameters for PCR amplification were as follows: the total volume of each PCR reaction was 25 μl, including 100 ng of Yerqiang plateau loach genomic DNA; 10× PCR Buffer, 2.5 μl; Mg2+ 1.5mmol / L ; Tag enzyme 1u; dNTP 0.1mmol / L each; the above primers 10pmol each; add ddH2O When using this primer, set the program parameters of the PCR instrument as follows: denaturation at 94°C for 2 min; 94°C for 45 sec, 55°C for 1 min, 72°C for 40 sec, and the reaction is carried out for 35 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0016] Detection steps of PCR products: Separate the PCR products in 8% denaturing polyacrylamide gel by electrophoresis at 15W constant power for 1.5 hours. After the electrophoresis, first soak in 10% glacial acetic acid solution for 30 minutes, then rinse with distilled water for 5 minutes, then soak in 0.1% silver nitrate solution for 30 minutes, develop with 3% sodium carbonate solution for 5 minutes, and finally soak in 10% glacial acetic acid solution for 5 minutes to obtain the polymorphism map of the small satellite DNA marker Trip-yark01 of the Yarkand plateau loach.

[0017] Therefore, the present invention is characterized in that the genetic variation map of Trip-yark01 minisatellite DNA marker of Yarkand plateau loach can be obtained quickly and the method is simple. Moreover, compared with other molecular genetic marker technologies, minisatellite DNA markers conform to Mendel's inheritance model and are co-dominantly inherited. The obtained results can intuitively detect the genotype of each individual of Yarkand plateau loach; and can be applied to genetic markers between individuals in different geographical groups or Yarkand plateau loach groups, pedigree authentication and construction of genetic maps. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a detection spectrum of 26 individuals of Yarkand plateau loach using the small satellite DNA marker Trip-yark01 of the present invention (numbers 1-26 are 26 individuals of Yarkand plateau loach). DETAILED DESCRIPTION

[0019] The following is a detailed description of the DNA molecular genetic marker technology method of the Yarkand plateau loach Trip-yark01 minisatellite DNA core sequence of the present invention through examples. First, the genomic DNA in the muscle of the Yarkand plateau loach is extracted and diluted for standby use; then, the minisatellite DNA core sequence contained in the Yarkand plateau loach DNA sequence is used to design specific primers at both ends of the sequence; then, the primers are used to perform PCR amplification on the genomic DNA of individuals in different geographical groups of the Yarkand plateau loach or in the Yarkand plateau loach group, and the PCR products are subjected to denaturing polyacrylamide gel electrophoresis to determine the genotype of each individual, that is, to obtain the genetic polymorphism map of the Yarkand plateau loach.

[0020] 1. Extraction of genomic DNA from the Yarkand plateau loach: Add 100µg of Yarkand plateau loach muscle to an Eppendorf tube, then add 500µl of cell lysis buffer and 5µl of 20mg / ml proteinase K, shake gently, and store at 37°C overnight. Then add 600µl of a mixture of phenol chloroform: isoamyl alcohol (25:24:1) to the lysed sample, shake for 20 minutes, centrifuge at 12000rpm for 10 minutes, and take the supernatant. Add a mixture of phenol: chloroform: isoamyl alcohol, and repeat the above operation 3 times. Take the supernatant again, add 2 times the volume of cooled anhydrous ethanol and 1 / 10 volume of 3mol / L sodium acetate, centrifuge at 12000rpm for 10 minutes, discard the supernatant, retain the DNA precipitate, and wash the precipitate twice with 70% ethanol. After the ethanol evaporates completely, dissolve the DNA with TE buffer, dilute to 100ng / μl, and store at 4°C.

[0021] 2. Design of minisatellite DNA primers: Based on the DNA sequence of the Yarkand Plateau loach, the sequences on both sides of the minisatellite DNA are highly conservative relative to the core sequence in the same species, and specific primers are designed at both ends to amplify the minisatellite DNA fragment of the site. Since the mutation rate of the minisatellite DNA core sequence is relatively high, the increase or decrease of the number of repetitions of the minisatellite DNA core sequence, that is, the change of the length of the minisatellite DNA sequence, is the source of detecting the polymorphism of the minisatellite DNA. The specific primer sequences at both ends of the core sequence of the minisatellite DNA region of the present invention are: positive chain 5'-atcagccttaactttggtcccgt -3', negative chain 5'- atccgcatgcctttggacaggt -3', and the annealing temperature when using the primer is 55°C.

[0022] 3. PCR amplification: First, add the sample, the sample volume is as follows: Yarkand plateau loach genomic DNA (100ng / L), 1μl; 10×PCR Buffer, 2.5μl; Mg2+ (25mmo1 / L), 1.5μl; Taq enzyme (5u / μl), 0.2μl; dNTP (2.5mmo / L each), 1μl; primers (10pmol / μl each), 1μl; add sterile water to 25μl. Secondly, perform PCR reaction, and the PCR amplification instrument program parameters are: 94℃ 45sec, 55℃ 1min, 72℃ 40sec, 35 cycles; 72℃ extension 5min, 4℃ storage.

[0023] 4. Detection of PCR products: Separate the PCR products by electrophoresis on 8% denaturing polyacrylamide gel, the electrophoresis instrument power is 15W, and the electrophoresis time is about 1.5 hours. After the electrophoresis, first soak in 10% glacial acetic acid solution for 30 minutes, then rinse with distilled water for 5 minutes, soak in 0.1% silver nitrate solution for 30 minutes, develop with 3% sodium carbonate solution for 5 minutes, and finally soak in 10% glacial acetic acid solution for 5 minutes to obtain the polymorphism map of the Trip-yark01 small satellite DNA core sequence of the Yarkand plateau loach, such as Figure 1 shown. Figure 1 The results showed that 15 alleles were amplified from 26 individuals of the Yarkand plateau loach, indicating that the small satellite DNA marker Trip-yark01 has a high polymorphism and is suitable for research and application in genetic diversity and genetic structure analysis, individual identification and pedigree authentication of the Yarkand plateau loach.

Claims

1. A set of primers for detecting the genotype of Yarkand plateau loach using the minisatellite DNA marker Trip-yark01, characterized in that: The primer sequences are: 5'-atcagccttaactttggtcccgt-3', 5'- atccgcatgcctttggacaggt -3', the annealing temperature when using this primer is 55°C.

2. A method for detecting the genotype of Yarkand plateau loach using the minisatellite DNA marker Trip-yark01, characterized in that: First, the genomic DNA in the muscle of the Yarkand plateau loach is extracted and diluted for later use; then, the core sequence of the small satellite DNA marker Trip-yark01 contained in the DNA sequence of the Yarkand plateau loach is used to perform PCR amplification on the genomic DNA of different individuals of the Yarkand plateau loach using specific primers, and the PCR products are subjected to denaturing polyacrylamide gel electrophoresis detection to determine the genotypes of different individuals of the Yarkand plateau loach in the Trip-yark01 core sequence region, wherein the specific primers of the small satellite DNA marker Trip-yark01 of the Yarkand plateau loach are: 5'-atcagccttaactttggtcccgt-3', 5'- atccgcatgcctttggacaggt -3', the annealing temperature when using this primer is 55°C.

3. The method for detecting the genotype of Yarkand plateau loach using the minisatellite DNA marker Trip-yark01 as claimed in claim 2, characterized in that: The PCR amplification of the genomic DNA of different individuals of the Yarkand plateau loach was carried out with the following sample loading parameters: the total volume of each PCR reaction was 25 μl, including 100 ng of the genomic DNA of the Yarkand plateau loach; 10×PCR Buffer, 2.5 μl; Mg 2+ 1.5 mmol / L; Taq enzyme 1u; dNTP 0.1mmol / L; specific primers 10 pmol each; finally add ddH2O to 25μl; set the program parameters of the PCR instrument as follows: denaturation at 94℃ for 2min; 94℃ for 45sec, 55℃ for 1min, 72℃ for 40sec, the reaction is carried out for 35 cycles; extension at 72℃ for 5min, and storage at 4℃.

4. The method for detecting the genotype of Yarkand plateau loach using the minisatellite DNA marker Trip-yark01 as claimed in claim 2, characterized in that: The steps for detecting PCR products by denaturing polyacrylamide gel electrophoresis were as follows: the PCR products were separated in 8% denaturing polyacrylamide gel at a constant power of 15W for 1.5 hours, soaked in 10% glacial acetic acid solution for 30 minutes, then rinsed with distilled water for 5 minutes, soaked in 0.1% silver nitrate solution for 30 minutes, developed with 3% sodium carbonate solution for 5 minutes, and finally soaked in 10% glacial acetic acid solution for 5 minutes.

5. Application of the method according to any one of claims 2 to 4 in constructing a genetic polymorphism map among Yarkand Plateau loach populations.

Images