Virus nucleic acid detection reagent, kit, preparation method and application thereof

Abstract

The preparation method of the viral nucleic acid detection reagent provided in the present application, after the ASFV amplicon hybridizes with crRNA, Cas12a cuts MB-ssDNA-ALP to release ALP, and the released ALP catalyzes the hydrolysis of pNPP into pNP, thereby generating a colorimetric signal, and the inner filtration effect of pNP on CdZnSe quantum dots changes the fluorescence signal, and the ASFV gene is detected using this dual-mode method, and the absorption intensity or fluorescence intensity is well linear with the ASFV gene concentration, and the detection limit is a single copy. In addition, the method can detect single-copy ASFV genes with the naked eye, and the detection sensitivity is higher than that of qPCR. Finally, the method can also effectively distinguish single-base mutations in crRNA, and has a good detection effect on viral DNA in serum. Therefore, the method has good sensitivity and specificity, and has a high application potential in the diagnosis of viral infections.

Description

Technical Field

[0001] The present application relates to the field of biological reagent technology, and in particular to a viral nucleic acid detection reagent, a preparation method, a kit and applications thereof. Background Art

[0002] ASFV detection methods can generally be divided into two categories: 1) immunoassays, such as enzyme-linked immunosorbent assay (ELISA) and lateral flow assay (LFA); 2) nucleic acid molecule detection methods, such as polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA). Nucleic acid detection has been recognized as the gold standard for genetic testing because of its good sensitivity and accuracy. However, PCR requires thermal cyclers and skilled operators, which makes PCR difficult to perform under limited resources. Isothermal amplification is not subject to these limitations, so isothermal amplification has become a promising alternative to PCR. Among them, the sensitivity of RPA is slightly lower than that of PCR, and the sensitivity of LAMP is better, but it requires complex primer design. Recently, RPA combined with CRISPR technology has been widely used in the development of genetic diagnostic tools to further improve the detection sensitivity. In the CRISPR / Cas system, some CRISPR-associated proteins (Cas), including Cas12a, Cas13a, and Cas14, exhibit non-specific trans-cleavage activity after being activated after recognizing the target sequence. This property can be used for specific detection of pathogen gene sequences and promote rapid, highly sensitive and low-cost early diagnosis of diseases.

[0003] In order to effectively avoid false positives in detection, a variety of dual-mode sensing strategies have been developed, including SERS (surface enhanced Raman scattering) / fluorescence, SERS / colorimetry, and fluorescence / colorimetry. Fluorescence / colorimetric sensing technology combines the advantages of high sensitivity of fluorescence detection and wide range of colorimetric detection. In addition, this strategy can avoid the interference of fluorescent matrix on fluorescence and the interference of colored matrix on colorimetry, and shows good potential and operability in naked eye detection. The dual-mode strategies based on colorimetry currently developed mainly rely on the colorimetric changes caused by the aggregation of metal nanoparticles, such as gold or silver nanoparticles, but metal nanoparticles may aggregate nonspecifically, thus affecting the accuracy of the detection results. Summary of the invention

[0004] In view of this, it is necessary to provide a viral nucleic acid detection reagent, preparation method, kit and application thereof with good specificity and accuracy to address the defects in the prior art.

[0005] To solve the above problems, this application adopts the following technical solutions:

[0006] One of the purposes of this application is to provide a method for preparing a viral nucleic acid detection reagent, comprising the following steps:

[0007] Synthesize Biotin-ssDNA-ALP;

[0008] MB-ssDNA-ALP was synthesized according to the Biotin-ssDNA-ALP;

[0009] trans-cleavage activity of the MB-ssDNA-ALP;

[0010] Releasing ALP from the MB-ssDNA-ALP after trans-cleavage;

[0011] The ALP catalyzes the hydrolysis of pNPP to generate pNP;

[0012] CdZnSe quantum dots are added to the pNP.

[0013] In some embodiments, the step of synthesizing Biotin-ssDNA-ALP specifically includes the following steps:

[0014] Biotin-ssDNA-N3 and DBCO-ALP were synthesized into Biotin-ssDNA-ALP through chemical click reaction.

[0015] In some embodiments, the step of synthesizing MB-ssDNA-ALP according to the Biotin-ssDNA-ALP specifically includes the following steps:

[0016] The synthesized Biotin-ssDNA-ALP was combined with streptavidin-modified magnetic beads to synthesize MB-ssDNA-ALP.

[0017] In some embodiments, the step of trans-cleaving the activity of the MB-ssDNA-ALP specifically includes the following steps:

[0018] RPA was used to amplify the ASFV double-stranded DNA template to generate amplicons, which hybridized with crRNA to activate the activity of Cas12 in trans-cutting MB-ssDNA-ALP.

[0019] The second purpose of the present application is to provide a viral nucleic acid detection reagent prepared by the above-mentioned preparation method.

[0020] The third purpose of the present application is to provide a viral nucleic acid detection kit, including the viral nucleic acid detection reagent.

[0021] The fourth purpose of the present application is to provide a detection method for a viral nucleic acid detection kit, comprising the following steps: adding a liquid to be detected into the viral nucleic acid detection kit, wherein the absorption intensity or fluorescence intensity of the detection reagent in the viral nucleic acid detection kit is linearly related to the ASFV gene concentration in the liquid to be detected.

[0022] The fifth purpose of the present application is to provide a viral nucleic acid detection kit for detecting ASFV genes or distinguishing single base mutations in crRNA and detecting viral DNA in serum.

[0023] This application adopts the above technical solution, and its beneficial effects are as follows:

[0024] The preparation method of the viral nucleic acid detection reagent provided by the present application, after the ASFV amplicon hybridizes with crRNA, Cas12a cuts MB-ssDNA-ALP to release ALP, and the released ALP catalyzes the hydrolysis of pNPP to pNP, thereby generating a colorimetric signal, and the inner filtration effect of pNP on CdZnSe quantum dots changes the fluorescence signal, and the ASFV gene is detected by this dual-mode method. The absorption intensity or fluorescence intensity has a good linear relationship with the ASFV gene concentration, and the detection limit is a single copy. In addition, the method can detect single-copy ASFV genes with the naked eye, and the detection sensitivity is higher than that of qPCR. Finally, the method can also effectively distinguish single-base mutations in crRNA, and has a good detection effect on viral DNA in serum. Therefore, the method has good sensitivity and specificity, and has a high application potential in the diagnosis of viral infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required for use in the embodiments of the present application or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 A flowchart of the steps of the method for preparing a viral nucleic acid detection reagent provided in an embodiment of the present application.

[0027] Figure 1A This is a schematic diagram of the viral nucleic acid detection reagent provided for the present embodiment.

[0028] Figure 1B To apply the preparation and characterization of biotin-ssDNA-ALP and MB-ssDNA-ALP provided in this example.

[0029] Figure 2A schematic diagram of the electrophoresis analysis of the RPA amplification products of the ASFV gene and the cis-cleavage activity of the CRISPR / Cas12a system provided in this embodiment.

[0030] Figure 3 Schematic diagram of the colorimetric-fluorescence dual-mode detection of ASFV genes based on RPA-CRISPR / Cas12a provided for the application of this embodiment.

[0031] Figure 4 A schematic diagram of selective and complex sample detection provided for the present embodiment of the application.

[0032] Figure 5 A schematic diagram comparing RPA-CRISPR / Cas12a and qPCR provided for the application of this embodiment.

[0033] Figure 6 This is the UV spectrum and standard curve diagram after the pNPP provided in the examples of the present application reacts with different concentrations of ALP.

[0034] Figure 7 This is a schematic diagram of the color and absorbance changes after the reaction of pNPP with ALP or biotin-ssDNA-ALP provided in the examples of the present application.

[0035] Figure 8 Schematic diagram of the response of Cd-based quantum dots with different emission wavelengths to different concentrations of ALP in Tris buffer containing pNPP (500 μM) provided in the examples of the present application.

[0036] Fig. 9 A schematic diagram of the response of the fluorescence intensity of quantum dots provided in the examples of the present application to different concentrations of ALP in Tris buffer containing pNPP (500 μM).

[0037] Fig.10 Schematic diagram of the response of the color and fluorescence intensity of CdZnSe quantum dots to different concentrations of ALP and biotin-ssDNA-ALP in Tris buffer of pNPP (500 μM) provided in the examples of the present application.

[0038] Fig.11 UV spectra of pNPP (a), the reaction product of pNPP and biotin-ssDNA-ALP (b), the reaction product of pNPP and biotin-ssDNA-ALP separated by SA-MB (c), and the reaction product of pNPP and biotin-ssDNA-ALP separated by biotin-blocked SA-MB (d) provided in the examples of the present application; pNPP: 10 μM, biotin-ssDNA-ALP: 1000 U / L, SA-MB: 1 mg / mL, biotin-blocked SA-MB: 1 mg / mL.

[0039] Fig.12 TEM images and particle size distribution statistics of SA-MB and MB-ssDNA-ALP provided in the examples of the present application.

[0040] Fig.13 Schematic diagram of optimization of the ratio of Cas12a to crRNA provided in the embodiments of the present application. DETAILED DESCRIPTION

[0041] The embodiments of the present application are described in detail below, and examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present application, and should not be construed as limiting the present application.

[0042] In the description of the present application, it should be understood that the terms "upper", "lower", "horizontal", "inside", "outside", etc., indicating orientations or positional relationships, are based on the orientations or positional relationships shown in the accompanying drawings, and are only for the convenience of describing the present application and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore should not be understood as a limitation on the present application.

[0043] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the features. In the description of this application, the meaning of "plurality" is two or more, unless otherwise clearly and specifically defined.

[0044] In order to make the objectives, technical solutions and advantages of the present application more clearly understood, the present application is further described in detail below in conjunction with the accompanying drawings and embodiments.

[0045] See also Figure 1 and Figure 1A , a step flow chart of a method for preparing a viral nucleic acid detection reagent provided in one embodiment of the present application includes the following steps S110 to S160, and the implementation method of each step is described in detail below.

[0046] Step S110: Synthesizing Biotin-ssDNA-ALP.

[0047] In this embodiment, the step of synthesizing Biotin-ssDNA-ALP specifically includes the following steps:

[0048] Biotin-ssDNA-N3 and DBCO-ALP were synthesized into Biotin-ssDNA-ALP through chemical click reaction.

[0049] Step S120: synthesizing MB-ssDNA-ALP according to the Biotin-ssDNA-ALP.

[0050] In some of the embodiments, the step of synthesizing MB-ssDNA-ALP according to the Biotin-ssDNA-ALP specifically includes the following steps: combining the synthesized Biotin-ssDNA-ALP with streptavidin-modified magnetic beads (SA-MB) to synthesize MB-ssDNA-ALP.

[0051] Step S130: trans-cleaving the activity of the MB-ssDNA-ALP.

[0052] In some of the embodiments, the step of trans-cutting the activity of MB-ssDNA-ALP specifically includes the following steps: using RPA to amplify the ASFV double-stranded DNA template to produce an amplicon, and the amplicon hybridizes with crRNA to activate the activity of Cas12 trans-cutting MB-ssDNA-ALP.

[0053] Step S140: releasing ALP from the MB-ssDNA-ALP after trans-cleavage.

[0054] Step S150: the ALP catalyzes the hydrolysis of pNPP to generate pNP.

[0055] It can be understood that ALP catalyzes the hydrolysis of pNPP to produce pNP, thereby generating a colorimetric signal, and the ASFV gene concentration is measured based on the pNP production.

[0056] Step S160: adding CdZnSe quantum dots into the pNP.

[0057] It can be understood that when CdZnSe quantum dots are added to the pNP, the internal filtering effect of pNP on the CdZnSe quantum dots changes the fluorescence signal, and the fluorescence quenching effect of CdZnSe quantum dots is good, which can be used for fluorescence detection of ASFV genes.

[0058] The present application also provides a viral nucleic acid detection reagent, which is prepared by the preparation method described above.

[0059] The present application also provides a viral nucleic acid detection kit, comprising the viral nucleic acid detection reagent.

[0060] The present application also provides a detection method for a viral nucleic acid detection kit, comprising the following steps: adding a liquid to be detected into the viral nucleic acid detection kit, and the absorption intensity or fluorescence intensity of the detection reagent in the viral nucleic acid detection kit is linearly related to the ASFV gene concentration in the liquid to be detected.

[0061] The present application also provides a viral nucleic acid detection kit for detecting ASFV genes or distinguishing single-base mutations in crRNA and detecting viral DNA in serum.

[0062] The preparation method of the viral nucleic acid detection reagent provided by the present application, after the ASFV amplicon hybridizes with crRNA, Cas12a cuts MB-ssDNA-ALP to release ALP, and the released ALP catalyzes the hydrolysis of pNPP to pNP, thereby generating a colorimetric signal, and the inner filtration effect of pNP on CdZnSe quantum dots changes the fluorescence signal, and the ASFV gene is detected by this dual-mode method. The absorption intensity or fluorescence intensity has a good linear relationship with the ASFV gene concentration, and the detection limit is a single copy. In addition, the method can detect single-copy ASFV genes with the naked eye, and the detection sensitivity is higher than that of qPCR. Finally, the method can also effectively distinguish single-base mutations in crRNA, and has a good detection effect on viral DNA in serum. Therefore, the method has good sensitivity and specificity, and has a high application potential in the diagnosis of viral infections.

[0063] The above technical solution of the present application is described in detail below in conjunction with specific embodiments.

[0064] Example 1: Preparation and characterization of biotin-ssDNA-ALP and MB-ssDNA-ALP

[0065] Synthesis of Biotin-ssDNA-ALP: ALP (0.1 mg) was dissolved in 500 μL phosphate buffer (PBS) (10 mM, pH 7.4), and DBCO-PEG4-NHS ester (0.25 mg) was dissolved in 10 μL dimethyl sulfoxide. Then DBCO-PEG4-NHS ester was mixed with ALP solution and oscillated for 12 h (400-600 rpm) at room temperature to obtain DBCO-ALP. DBCO-ALP was purified with a 30 kDa ultrafiltration tube and washed three times with PBS (10 mM, pH 7.4). Finally, it was mixed with 362.5 μL biotin-ssDNA-N3 (100 μM) and oscillated for 4 h at room temperature to obtain biotin-ssDNA-ALP. Biotin-ssDNA-ALP was purified with a 30 kDa ultrafiltration tube and washed three times with PBS (10 mM, pH 7.4). The synthesized biotin-ssDNA-ALP was stored at 4 °C for further use.

[0066] Synthesis of MB-ssDNA-ALP: Mix 100 μL SA-MB with 0.4 μL biotin-ssDNA-ALP, react for 30 min, combine and synthesize MB-ssDNA-ALP, wash 5 times with 1 mL PBST (PBS containing 0.05% Tween 20), and resuspend with 100 μL PBS (10 mM, pH 7.4) for use.

[0067] Characterization of Biotin-ssDNA-ALP: ALP was coupled with DBCO-PEG4-NHS ester to prepare DBCO-ALP, and the prepared DBCO-ALP was chemically reacted with biotin-ssDNA-N3 to synthesize Biotin-ssDNA-ALP (DNA sequence is shown in Table 1).

[0068] Table S1 Primers for crRNA in vitro transcription, RPA and qPCR

[0069]

[0070] The synthesized Biotin-ssDNA-ALP was subjected to UV spectroscopy and zeta potential detection, such as Figure 1B In Figure A, Biotin-ssDNA-ALP showed a new absorption peak at 270 nm, indicating that Biotin-ssDNA-N3 and DBCO-ALP were successfully coupled. After DBCO-ALP reacted with biotin-ssDNA-N3, the zeta potential dropped from -2.8 mV to -23.5 mV, further indicating that DNA and ALP were successfully coupled ( Figure 1B ).

[0071] Characterization of MB-ssDNA-ALP: The commercial kit was used to measure the biotin activity on biotin-ssDNA-ALP, which was 50% of the free biotin. After biotin-ssDNA-ALP reacted with SA-MB, the excess biotin-ssDNA-ALP was removed by magnetic separation, and the absorbance of DNA in the separated supernatant decreased significantly ( Figure 1B In addition, pNPP cannot be hydrolyzed by the supernatant after magnetic separation, but SA-MB blocked with biotin has no such effect ( Fig.11 ). In addition, compared with SA-MB, after the reaction of SA-MB with biotin-ssDNA-ALP, the zeta potential of MB-ssDNA-ALP decreased from -32.93 eV to -35.27 eV, and the hydrated particle size increased from 834.7 nm to 892.7 nm ( Figure 1B F). TEM images show that MB-ssDNA-ALP is spherical and slightly larger than SA-MB ( Fig.12 ). The above results prove that MB-ssDNA-ALP is successfully assembled.

[0072] Example 2: Activation of RPA & CRISPR / Cas12a trans-cleavage activity

[0073] RPA primers and T7 transcription primers were synthesized by Sangon Biotechnology (Table S1). The plasmid containing the ASFV gene was constructed by our laboratory, and the ASFV gene was amplified using the TwistDX RPA reaction kit. According to the instructions of the Basic Kit (UK), add 2.4 μL of forward and reverse primers (10 μM each) to 29.5 μL of Primer Free Rehydration buffer. Then, add 13.2 μL of the solution containing the ASFV plasmid to Basic reaction. Finally, add 2.5 μL of 280 mM magnesium acetate to start the amplification reaction. After reacting at 39°C for 20 minutes, store at 4°C for later use. The RPA product was detected by agarose gel electrophoresis.

[0074] In the verification of cis-cleavage activated by CRISPR / Cas12a, HiScribe TM T7 high yield RNAsynthesis kit and RNA clean&concentrator TM -5kit for in vitro transcription and purification of crRNA. The concentration of synthesized RNA was detected on Nanodrop (Thermo Fisher, Waltham, MA, USA). The RPA product was mixed with Cas12a, crRNA and NEBuffer TM r2.1 mixture to activate the cis-cleavage activity of Cas12a, which was verified by agarose gel electrophoresis.

[0075] Example 3: Reaction of ALP or biotin-ssDNA-ALP with pNPP

[0076] Verify the reaction between ALP and pNPP. The results show that as the ALP concentration increases, the absorbance of pNPP at 310nm decreases, while the absorbance of pNP at 400nm increases. The absorption intensity of pNP shows a good linear relationship with the ALP concentration between 5U / L and 40U / L ( Figure 6 ). In the reaction between biotin-ssDNA-ALP and pNPP, the absorption intensity of pNP increases with the increase of biotin-ssDNA-ALP reaction volume ( Figure 1B C). According to Figure 6The biotin-ssDNA-ALP activity was calculated based on the linear relationship of the ALP reaction shown. Figure 6 The linear relationship shown has a good linear relationship between the calculated volumes ( Figure 1B (middle D).

[0077] like Figure 7 In Figures A and B, as the concentration of ALP or biotin-ssDNA-ALP increases, the pNPP solution gradually changes from colorless to yellow, and the absorbance shows a good linear relationship with the concentration of ALP or biotin-ssDNA-ALP. Due to the internal filter effect (IFE) of pNP on Cd-base quantum dots, the fluorescence signals of quantum dots with different emission wavelengths gradually weaken as the concentration of ALP increases. Among them, the blue CdZnSe quantum dots with the best fluorescence quenching efficiency were used in subsequent experiments ( Figure 8 and Fig. 9 In addition, as the concentration of ALP or Biotin-ssDNA-ALP increases, the fluorescence color of the CdZnSe quantum dots / pNPP solution gradually changes from blue to light blue, and the change in fluorescence intensity shows a good linear relationship with the concentration of ALP or biotin-ssDNA-ALP ( Fig.10 ). The above results show that both colorimetric and fluorescent signal modes can achieve ALP or biotin-ssDNA-ALP visualization.

[0078] Embodiment 4:

[0079] Dual-mode detection of ASFV gene: ALP-mediated pNPP hydrolysis and pNP internal filtration of quantum dots are combined with RPA-assisted CRISPR / Cas12a system to perform dual-mode detection of ASFV gene. In the colorimetric detection, ASFV plasmids of different concentrations are first amplified by RPA, and the RPA product is mixed with Cas12a (75nM), crRNA (150nM) and NEBuffer. TM r2.1 mixed, activated the trans-cleavage activity of Cas12a, cut the ssDNA in MB-ssDNA-ALP (10μL), resulting in the release of ALP, which catalyzed the hydrolysis of pNPP to generate pNP. The ASFV gene concentration was determined based on the pNP yield. In the fluorescence detection, CdZnSe quantum dots were added to the colorimetric detection system. pNP had a strong inner filtration effect on the fluorescence of CdZnSe quantum dots, and the fluorescence quenching effect of CdZnSe quantum dots was good, which could be used for the fluorescence detection of ASFV genes.

[0080] Dual-mode detection of ASFV genes: RPA amplifies three different DNA fragments on the ASFV B646L gene ( Figure 2 Middle A and Figure 2Middle B). The amplified ASFV gene amplicon was used as the target gene and added to the CRISPR / Cas12a system. The amplicon was effectively cleaved, indicating the strong cleavage activity of the Cas12a system ( Figure 2 C). Part-3 was selected for subsequent experiments. The MB-ssDNA-ALP complex was non-specifically cleaved by activated Cas12a, releasing ALP, which catalyzed pNPP to generate pNP, resulting in a change in absorbance. In addition, due to the inner filter effect of pNP on quantum dots, the fluorescence intensity of quantum dots changed, thereby achieving dual-mode detection of ASFV genes. After the ratio of Cas12a and crRNA was optimized, Cas12a obtained the best cleavage activity at 1:2 ( Fig.13 ). In the colorimetric assay, the concentration of ASFV gene was positively correlated with the absorbance of pNP at 400 nm, and the linear equation was Abs 400 =0.08264×lgC ASFV基因 +0.1053( Figure 3 Middle A and Figure 3 B). The detection limit reached a single copy. As the number of ASFV genes increased, the color of the solution changed from colorless to yellow ( Figure 3 In the fluorescence detection, the fluorescence intensity change of CdZnSe quantum dots was positively correlated with the ASFV gene concentration, and the linear equation was ΔF 450 =3.936×lgC ASFV基因 +1.404( Figure 3 Middle C and Figure 3 D), the detection limit can also reach the single copy level. As the ASFV gene increases, the fluorescent color of the solution changes from blue to light blue ( Figure 3 Middle F), showing good visual detection performance.

[0081] Example 5: Selectivity, sensitivity and accuracy validation

[0082] Validation of the selectivity of the detection system. TM T7 high yield RNA synthesiskit was used to in vitro transcribe crRNA with different numbers of base mutations (1, 2 and 3 base mutations) (Table S2), and the mutant crRNA was used for ASFV gene detection in the above CRISPR / Cas12a system. Different concentrations of ASFV plasmid (50, 500, 5000, 20000 and 50000 copies) were added to 10% human serum to evaluate the effectiveness of the detection system under complex biological conditions.

[0083] The quantitative PCR (qPCR) detection method was used to compare the sensitivity and accuracy with the CRISPR / Cas12a system. SYBR Green qPCR detection of ASFV B646L gene was performed using Taq pro universal SYBR qPCR master mix (Vazyme) according to the manufacturer's instructions. In brief, a single-tube PCR reaction was added with 10 μL Taq pro universal SYBRqPCR master mix, 0.4 μL forward and reverse primers (10 μM each), 1 μL ASFV plasmid and 8.2 μL H2O. The amplification conditions were: 95°C for 30 s, followed by 95°C for 10 s, 60°C for 30 s, and 45 cycles. Real-time fluorescence signals were collected. A cycle value (Ct) ≤ 40.0 was ASFV positive.

[0084] In order to verify the selectivity of the detection method, the present application constructed different numbers of mutations in crRNA and synthesized the transcription sequence of the mutant crRNA (Table S2).

[0085] Table S2 Primers for in vitro transcription of mutant crRNA

[0086] OLIGO SEQUENCE(5′-3′) Mut-1-F GATCACTAATACGACTCACTATAGGGAATTTCTACTGTTGTAGATCTTTGGTGCCGCTTGTGCAA Mut-1-R TTGCACAAGCGGCACCAAAGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAGTGATC Mut-2-F GATCACTAATACGACTCACTATAGGGAATTTCTACTGTTGTAGATCTTTGCTGCGGCTTCTGCAA Mut-2-R TTGCAGAAGCCGCAGCAAAGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAGTGATC Mut-3-F GATCACTAATACGACTCACTATAGGGAATTTCTACTGTTGTAGATCTTTCGTGCCGCTTCTGCAA Mut-3-R TTGCAGAAGCGGCACGAAAGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAGTGATC

[0087] Note: The underlined bases are mutation sites.

[0088] The wild-type ASFV gene can promote obvious changes in absorption intensity, while the mutant crRNA has little effect, indicating that the method has good selectivity ( Figure 4 In addition, the performance of the sensor in complex biological systems was studied. Similar to the performance in buffer solutions, in 10% serum, the absorbance showed a good linear relationship with the logarithm of the ASFV gene concentration. Figure 4 Finally, the sensitivity of the sensor was compared with the gold standard qPCR. Figure 5 , qPCR cannot detect ASFV genes below 50 copies, while the sensor can obtain obvious signal changes, indicating that the sensor method has good sensitivity.

[0089] In summary, the present application establishes a method for detecting the ASFV gene based on the dual-mode MB-ssDNA-ALP mediated by CRISPR / Cas12a. After the ASFV amplicon hybridizes with crRNA, Cas12a cuts MB-ssDNA-ALP to release ALP. The released ALP catalyzes the hydrolysis of pNPP into pNP, thereby generating a colorimetric signal, and the inner filtration effect of pNP on CdZnSe quantum dots changes the fluorescence signal. Using this dual-mode method to detect the ASFV gene, the absorption intensity or fluorescence intensity has a good linear relationship with the ASFV gene concentration, and the detection limit is a single copy. In addition, this method can detect single-copy ASFV genes with the naked eye, and the detection sensitivity is higher than that of qPCR. Finally, this method can also effectively distinguish single-base mutations in crRNA, and has a good detection effect on viral DNA in serum. Therefore, this method has good sensitivity and specificity, and has a high application potential in the diagnosis of viral infections.

[0090] It can be understood that the technical features of the above-described embodiments can be arbitrarily combined. In order to make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0091] The above are only preferred embodiments of the present application, and only specifically describe the technical principles of the present application. These descriptions are only for explaining the principles of the present application and cannot be interpreted as limiting the scope of protection of the present application in any way. Based on the explanation here, any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application, and other specific implementation methods of the present application that can be associated with the technicians in this field without creative work, should be included in the scope of protection of the present application.

Claims

1. A method for detecting viral nucleic acid for non-diagnostic purposes, characterized in that: The steps include: Synthesize Biotin-ssDNA-ALP; Synthesize magnetic beads MB-ssDNA-ALP according to the Biotin-ssDNA-ALP; trans-cleavage activity of the MB-ssDNA-ALP; Releasing ALP from the MB-ssDNA-ALP after trans-cleavage; The ALP catalyzes the hydrolysis of pNPP to generate pNP, thereby generating a colorimetric signal; CdZnSe quantum dots are added to the pNP, and the inner filtering effect of pNP on the CdZnSe quantum dots changes the fluorescence signal, and the ASFV gene is detected using a colorimetric-fluorescence dual mode; The steps of synthesizing Biotin-ssDNA-ALP specifically include the following steps: Biotin-ssDNA-N3 and DBCO-ALP were synthesized into Biotin-ssDNA-ALP through chemical click reaction; The step of trans-cleaving the activity of the MB-ssDNA-ALP specifically includes the following steps: RPA was used to amplify the ASFV double-stranded DNA template to generate amplicons, which hybridized with crRNA to activate the activity of Cas12 in trans-cutting MB-ssDNA-ALP.

2. The method for detecting viral nucleic acid according to claim 1, wherein: The step of synthesizing MB-ssDNA-ALP according to the Biotin-ssDNA-ALP specifically includes the following steps: The synthesized Biotin-ssDNA-ALP was combined with streptavidin-modified magnetic beads to synthesize MB-ssDNA-ALP.

Images