Composition for reducing pig fecal skatin emission and body deposition and use thereof

Abstract

The present invention discloses a composition for reducing the emission and in vivo deposition of pig skatole and its use as a feed additive, wherein the composition comprises component A and component B in a weight ratio of 1:10-20, wherein component A is a mulberry leaf ethanol extract, and its polyphenol content measured by the Folin phenol method is not less than 55% calculated by gallic acid equivalent, and component B is a mulberry leaf water extract, and its total polysaccharide content measured by the phenol sulfuric acid method is not less than 55% calculated by glucose equivalent. Compared with similar products, the product of the present invention has the dual effects of reducing skatole emission and promoting the decomposition of skatole in vivo, and also has the advantages of being green and natural, simple in preparation process, low in cost, easy to use, and low in addition amount in feed.

Description

Technical Field

[0001] The invention relates to the field of feed additives, and in particular to a composition for reducing the emission and in vivo deposition of pig skatole and a use thereof. Background Art

[0002] Skatole, chemically known as 3-methylindole, is produced by intestinal microorganisms and has a strong fecal odor. Its odor threshold is less than 0.003 mg / m 3 , which can still be perceived by humans even at extremely low concentrations. It is one of the main odorous substances discharged from manure during pig farming, and is also the main substance that causes the mutton smell of pork. Part of the skatole produced in the intestines of animals is excreted from the body through feces, and part is absorbed by the intestines and reaches the liver through the portal vein. The skatole that enters the liver can be rapidly metabolized by the cytochrome P450 enzyme system (CYP450) and excreted through urine. The skatole that is not metabolized is transported to the peripheral blood and deposited in the body, especially in adipose tissue, causing the meat to have a mutton smell and reducing the quality of the meat. In boars, hormones such as androstenone can inhibit the activity of CYP450 enzymes, resulting in higher skatole content and heavier mutton smell. Therefore, reducing the production and deposition of animal skatole is of great significance to reducing environmental pollution around farms and improving meat quality.

[0003] Methods used in production to reduce skatole in pigs include nutritional control methods such as adding beneficial bacteria, oligosaccharides, enzyme preparations or preparing amino acid balanced feed, as well as hormone control methods such as castration and vaccination for boars. The above nutritional control methods only regulate the production and absorption of skatole in the intestines, and cannot promote the decomposition of already absorbed skatole; while hormone control methods only activate CYP450 enzymes in boars to promote the decomposition of skatole in the body, and cannot reduce the production and emission of skatole in the intestines. Summary of the invention

[0004] In response to the above technical problems, the present application provides a composition for reducing the emission and in vivo deposition of skatole in pigs.

[0005] The composition comprises component A and component B in a weight ratio of 1:10-20, wherein component A is an ethanol extract of mulberry leaves, and its polyphenol content measured by the Folin phenol method is not less than 55% calculated on the basis of gallic acid equivalent, and component B is an aqueous extract of mulberry leaves, and its total polysaccharide content measured by the phenol-sulfuric acid method is not less than 55% calculated on the basis of glucose equivalent.

[0006] Optionally, the 1-deoxynojirimycin (DNJ) content of the component A measured by liquid chromatography is less than 5%; and the DNJ content of the mulberry component B measured by liquid chromatography is less than 1%.

[0007] Optionally, the preparation method of component A comprises the following steps:

[0008] (1) Grinding and sieving the dried mulberry leaves to obtain mulberry leaf powder;

[0009] (2) dissolving the mulberry leaf powder in ethanol for extraction to obtain an extract and a residue;

[0010] (3) The extract is purified and dried to obtain component A.

[0011] Optionally, the purification in step (3) includes adsorption and column chromatography.

[0012] Optionally, the preparation method of component B comprises the following steps:

[0013] (4) adding the residue into water and boiling it for a period of time to obtain a water extract;

[0014] (5) The aqueous extract is purified and dried to obtain component B.

[0015] Optionally, the mulberry leaves are picked in spring or autumn.

[0016] The application also provides use of the composition as a feed additive.

[0017] The feed additive is used for stimulating the gene expression of skatole decomposing enzyme CYP1A1, reducing the emission and in vivo deposition of pig skatole, and reducing the relative abundance of intestinal skatole-producing bacteria.

[0018] The present application provides a pig feed, comprising the composition, wherein the addition amount of the composition is 0.05%-0.2%.

[0019] Compared with similar products, the product of the present invention has the dual functions of reducing skatole emissions and promoting the decomposition of skatole in the body. In addition, it has the advantages of being green and natural, simple in preparation process, low in cost, easy to use, low in amount added to feed, and can be used cumulatively with other skatole-reducing feed formulas or measures without affecting nutritional balance. DETAILED DESCRIPTION

[0020] 1. Preparation of component A and component B

[0021] a) picking mulberry leaves and drying them naturally or in an oven, crushing them in a grinder and sieving them to obtain mulberry leaf powder;

[0022] b) adding the mulberry leaf powder in step a) into 70% ethanol at a solid-liquid ratio of 1:20, extracting overnight, and filtering to remove the residue.

[0023] c) The ethanol extract is adsorbed overnight with cation exchange resin 732, and the unadsorbed ethanol extract is collected. This step can remove substances such as DNJ that inhibit CYP450 expression and affect animal growth.

[0024] d) The non-adsorbed ethanol effluent collected in step c is evaporated with a rotary evaporator to remove the solvent and fully dissolved with water. The aqueous extract is adsorbed with a macroporous resin HPD600, and then the macroporous resin is washed with 3-5 column volumes of water. This step can further remove substances such as DNJ that inhibit CYP450 expression and affect animal growth.

[0025] e) The macroporous resin washed in step d is eluted with 95% ethanol for 2 column bed volumes, and then eluted with ethyl acetate for 2 column bed volumes. The eluate is collected and the solvent is evaporated using a rotary evaporator to obtain component A.

[0026] f) adding water to the mulberry leaf powder residue in step b) at a solid-liquid ratio of 1:20 and boiling for 2-4 hours, filtering to remove the residue, concentrating the extract to a small volume, slowly adding ethanol until the ethanol concentration reaches 50%, and centrifuging to obtain a precipitate. The precipitate is completely dissolved in hot water, transferred to a blender to be fully dissolved and mixed, and spray-dried into a powder at 150° C. by a spray drying method, which is component B.

[0027] The total polyphenol content of component A was 63.23% (calculated as gallic acid equivalent) as determined by the Folin phenol method, and the DNJ content was 3.92% as determined by liquid chromatography.

[0028] The total polysaccharide content of component B was 59.34% (calculated as glucose equivalent) as determined by the phenol-sulfuric acid method, and the DNJ content was 0.75% as determined by liquid chromatography.

[0029] 2. In vitro validation study on regulating the expression of skatole degrading enzyme CYP1A1

[0030] Experimental methods: Human hepatocyte cell line LO2 was inoculated in a 12-well plate at a density of 1×105 cells / ml, with 500 μl per well. Different doses (50, 100 μg / mL) of substance A, substance B or DNJ were added to the experimental group, and the same volume of DMEM complete culture medium was added to the blank control group. Three replicates were set up in each group. After 24 hours of culture in a 5% carbon dioxide incubator at 37°C, total RNA was extracted from the cells using a kit, and the mRNA expression of the target gene CYP1A1 and the internal reference gene GAPDH was determined by fluorescence quantitative PCR after reverse transcription. The upstream and downstream primer sequences of CYP1A1 were CAAGGGGCGTTGTGTCTTTG and GTCGATAGCACCATCAGGGG, respectively. The upstream and downstream primer sequences of GAPDH were CCACTAGGCGCTCACTGTTC and CGCCCAATACGACCAAATCC, respectively.

[0031] Data analysis: Using 2 -△△ct The difference in expression of the target protein was calculated by the method. Eexel software was used for statistical analysis, and the data were expressed as mean ± SEM. The test results were evaluated by t test, and P < 0.05 indicated a statistically significant difference.

[0032] Results: As shown in Table 1, substance A significantly stimulated the expression of skatole-degrading enzyme CYP1A1 in hepatocytes, substance B had no significant stimulatory effect, and DNJ significantly inhibited the expression of CYP1A1; mulberry leaf crude extract also had a certain promoting effect on the expression of CYP1A1, but it only reached a significant level at a dose of 100 μg / mL.

[0033] Table 1. Effects of Substance A, Substance B, and DNJ on the Expression of CYP1A1, a Skatole-Degrading Enzyme in Hepatocytes

[0034]

[0035] ** indicates that P<0.01 is significantly different from the control group. The crude extract of mulberry leaves is prepared by boiling mulberry leaf powder and water in a ratio of 1:10 for 30 minutes, filtering and concentrating.

[0036] 3. In vitro validation test for inhibition of skatole production

[0037] Experimental method: Take 2 g of fresh feces from fattening pigs and add 10 times sterile saline, shake and mix thoroughly, and after settling for 1 minute, take 1 mL of the upper bacterial liquid and add it to 9 mL of LB medium, add component A, component B or DNJ to make the final concentration of 1 mg / mL, and culture in an anaerobic environment for 24 hours, with 3 replicates for each treatment. The culture medium was tested for bacterial flora using 16S rRNA sequencing technology, and the skatole concentration was determined by HPLC.

[0038] Results: As shown in Table 2, in the in vitro culture test of fattening pig feces, substance B could significantly inhibit the relative abundance of skatole-producing bacteria Megasphaera and Olsenella in fecal culture, and could significantly reduce the concentration of skatole, while mulberry leaf crude extract, substance A and DNJ had no significant effect on this.

[0039] Table 2. Effects of Substance A, Substance B, and DNJ on skatole-producing bacteria and skatole content in in vitro culture of fattening pig feces

[0040]

[0041] * indicates P<0.05, which is significantly different from the control group. The crude extract of mulberry leaves was prepared by boiling mulberry leaf powder and water in a ratio of 1:10 for 30 minutes, followed by filtration and concentration.

[0042] 4. Evaluation of the effect of mulberry leaf-derived feed additives on reducing skatin emission and deposition in pigs

[0043] Substance A and substance B were mixed in the ratio of 1:5, 1:10, 1:20 and 1:30 according to the method to prepare mulberry leaf source feed additives I, II, III and IV, respectively, and skatole evaluation tests were carried out on fattening pigs.

[0044] Experimental animals and experimental design: Twenty fattening pigs were selected for the experiment and divided into two treatment pens, with 10 pigs in each pen (5 castrated boars and 5 sows), and were fed with a basic diet or a group with 0.2% mulberry leaf source feed additive for 5 weeks. The diet was formulated in accordance with the nutritional requirements of pigs (meat-type pigs) recommended by the National Standard of the People's Republic of China (GB / T 39235-2020). During the experiment, pigs were allowed to eat and drink freely and were vaccinated according to the requirements of the farm. The Osborne FIRE performance test feeding system was used to automatically record the weight and feed intake of pigs. The average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR) were calculated, with n=10 for each treatment.

[0045] Sample collection and determination index: At the end of the experiment, rectal feces, blood, liver, and back fat were collected. The skatole content in feces, blood, and back fat was determined by HPLC.

[0046] qRT-PCR was used to detect the gene expression level of CYP1A1, a CYP450 enzyme that promotes the decomposition of skatole in the liver. The upstream and downstream primer sequences of CYP1A1 were GGGAAGCCACTCCCATCTAC and CCCTTCGTCCTCCCACAGTA, respectively. The upstream and downstream primer sequences of the internal reference gene 18S rRNA were CCCACGGAATCGAGAAAGAG and TTGACGGAAGGGCACCA, respectively.

[0047] Fecal flora was detected using 16S rRNA sequencing technology.

[0048] Data analysis: SPSS16 software was used for statistical analysis. Data were expressed as mean ± SEM or median with interquartile range (IQR). The t-test was used to evaluate the experimental results.

[0049] The results showed that the addition of substance A and substance B in a 1:5 combination (basal diet + group I) could significantly reduce the skatole content in feces, blood, and backfat, increase the gene expression of CYP450 enzyme CYP1A1 in the liver that promotes the decomposition of skatole in vivo, and reduce the relative abundance of skatole-producing bacteria Megasphaera in feces, but had a significant adverse effect on daily weight gain and feed conversion rate in production performance, and the effect of reducing skatole in feces was weaker than other combinations. The combination of substance A and substance B in a 1:10 and 1:20 ratio (basal diet + group II, basal diet + group III) did not affect the production performance of fattening pigs, and significantly reduced the skatole content in feces, blood, and backfat of fattening pigs, significantly increased the gene expression of CYP1A1, and significantly reduced the relative abundance of skatole-producing bacteria Megasphaera and Olsenella in feces. Although the combination of substance A and substance B at a ratio of 1:30 (basic diet + IV group) did not affect the productivity of fattening pigs, its effect of reducing the concentration of skatole in backfat was greatly weakened, and its stimulating effect on the CYP1A1 gene was also the weakest compared with other combinations. Therefore, considering the growth performance, reduction of skatole emission and deposition efficiency, it was determined that the combination of substance A and substance B at a ratio of 1:10-20 could be used as a mulberry leaf feed additive for production.

[0050] The above results show that the mulberry leaf-derived feed additive made by combining substance A and substance B in a ratio of 1:10-20 produced by this process can effectively reduce the production and emission of skatole in fattening pig feces and promote the decomposition of skatole in the liver without affecting production performance, thereby reducing the deposition of skatole in fattening pigs in two ways.

[0051] Table 3. Effects of mulberry leaf-derived feed additives prepared by this process on production performance, skatole content, skatole-degrading enzyme gene expression, and skatole-producing bacteria in fattening pigs.

[0052]

[0053] *Indicates P<0.05, significant difference compared with the control group.

Claims

1. A composition, characterized in that The invention comprises component A and component B in a weight ratio of 1:10-20, wherein component A is an ethanol extract of mulberry leaves, and calculated on the basis of gallic acid equivalent, its polyphenol content measured by the Folin phenol method is not less than 55%, and its 1-deoxynojirimycin content measured by liquid chromatography is less than 5%; component B is an aqueous extract of mulberry leaves, and calculated on the basis of glucose equivalent, its total polysaccharide content measured by the phenol-sulfuric acid method is not less than 55%, and its 1-deoxynojirimycin content measured by liquid chromatography is less than 1%.

2. The composition according to claim 1, characterized in that The preparation method of component A comprises the following steps: (1) Grinding and sieving the dried mulberry leaves to obtain mulberry leaf powder; (2) dissolving the mulberry leaf powder in ethanol for extraction to obtain an extract and a residue; (3) The extract is purified and dried to obtain component A.

3. The composition according to claim 2, characterized in that The purification in step (3) includes adsorption and column chromatography.

4. The composition according to claim 2, characterized in that The preparation method of component B comprises the following steps: (4) adding the residue into water and boiling it for a period of time to obtain a water extract; (5) The aqueous extract is purified and dried to obtain component B.

5. The composition according to claim 4, characterized in that The purification in step (5) comprises extraction.

6. The composition according to claim 2, characterized in that The mulberry leaves are picked in spring or autumn.

7. Use of the composition according to claim 1 as a feed additive, wherein the feed additive is used to stimulate the gene expression of skatole decomposing enzyme CYP1A1, reduce the emission and deposition of skatole in pigs, and reduce the relative abundance of intestinal skatole-producing bacteria.

8. Pig feed, comprising the composition according to claim 1, wherein the addition amount of the composition is 0.05%-0.2%.

Images