Kit, method and application thereof for detecting monkeypox virus nucleic acid and typing in the same tube

Abstract

The present invention discloses a kit, method and application for detecting monkeypox virus nucleic acid and typing in the same tube. The present invention uses a highly selective front primer for monkeypox virus and a Taqman-LNA probe for specific mutations of monkeypox virus type I and type II nucleic acid, and realizes PCR one-tube detection and typing by modifying different fluorescent groups at the 5' end of the typing probe. The primer-probe composition can be used with a reaction liquid system to achieve long-term stable storage of the fully premixed reaction liquid, greatly simplifying the experimental operation of the end user. The present invention verifies oropharyngeal swab samples, serum samples and pustule samples, and the detection sensitivity can reach 175 copies / mL. The reagent can support a rapid PCR program, and can achieve nucleic acid amplification in as fast as 23 minutes when used with a rapid PCR instrument. The detection reagent of the present invention provides great convenience for community screening, disease course monitoring, etc. of monkeypox virus.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and specifically relates to a kit, a method and an application thereof for detecting monkeypox virus nucleic acid and typing in the same tube. Background Art

[0002] Monkeypox is a zoonosis caused by infection with the monkeypox virus. Monkeypox virus (MPXV) is a double-stranded DNA virus with a genome of nearly 200kbp. It belongs to the genus Orthopoxvirus (OPXV) of the Poxviridae family. Common viruses in the same genus include smallpox virus and cowpox virus. Smallpox was eradicated in 1980 and smallpox vaccination was gradually stopped. Monkeypox has become the most serious virus threatening human life and health.

[0003] Monkeypox virus can be divided into two branches: evolutionary branch I (traditionally called Congo type or Central African type) and evolutionary branch II (traditionally called West African type). Among them, type I monkeypox virus has a long incubation period and a mortality risk of up to 10.6%. The monkeypox outbreak since May 2022 is mainly caused by type II monkeypox virus, with a mortality rate of 3.6%. Confirmation of MPXV infection is based on nucleic acid amplification testing (NAAT) using real-time or conventional polymerase chain reaction (PCR) to detect unique sequences of viral DNA. PCR can be used alone or in combination with sequencing. Several groups have developed validated PCR protocols for detecting OPXV and more specifically MPXV, some of which include differentiation between the Congo branch and the West African branch. Some protocols include two steps, the first step is to detect OPXV with a PCR reaction, and then a second step is performed to specifically detect MPXV using a PCR reaction or a sequencer. 1-5 . Although the results of viral gene sequencing are more accurate, its detection cycle is long, the cost is high, and the laboratory requirements are high, making it difficult to use on a large scale in clinical practice. Therefore, the qPCR method is more suitable for large-scale clinical testing. Compared with gene sequencing, the qPCR method has the advantages of being fast, simple, and low-cost. Patents have reported the use of a multi-channel fluorescent PCR method to detect and type monkeypox virus nucleic acid in one tube, using a composition formed by universal upstream and downstream primers and probes for monkeypox virus, upstream and downstream primers and probes for the Congolese branch of monkeypox virus, and upstream and downstream primers and probes for the West African branch of monkeypox virus to complete the detection. However, the primer and probe design regions for the detection of monkeypox virus nucleic acid lack good selectivity for other viruses in the genus Orthopoxvirus, and there is a certain risk of false positives; the use of four sets of primers and probes not only increases the cost of reagents, but also makes the interpretation of results more complicated; oropharyngeal swab samples were not tested, and oropharyngeal swab sampling has important practical value in community screening for virus prevention and control. 6 .

[0004] The technical upgrade of multi-channel fluorescent PCR is also important for improving detection efficiency. Most of the PCR detection reagents currently used in clinical practice are stored separately from the PCR buffer and enzyme solution. They need to be mixed and used immediately at the terminal, which is not only complicated to operate, but also easy to introduce contamination. Rapid PCR detection technology is also an important development direction of current molecular diagnosis. Completing PCR amplification within half an hour can greatly improve detection efficiency. Therefore, providing a fast, highly specific, highly sensitive, easy-to-use and low-cost fluorescent quantitative PCR detection method for rapid diagnosis of monkeypox virus and typing of West African and Congolese branches is of great significance for epidemic prevention and control.

[0005] 1.Li Y, Zhao H, Wilkins K, Hughes C, Damon IK. Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strainDNA. Journal of Virological Methods. 2010Oct; 169(1):223–7.

[0006] 2.Schroeder K, Nitsche A.Multicolour, multiplex real-time PCR assay for the detection of human-pathogenic poxviruses. Molecular and CellularProbes. 2010Apr; 24(2):110–3.

[0007] 3. Maksyutov RA, Gavrilova EV, Shchelkunov SN. Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay. Journal of Virological Methods. 2016 Oct; 236: 215–20.

[0008] 4. Ropp SL, Jin Q, Knight JC, Massung RF, Esposito JJ. PCR strategy for identification and differentiation of small pox and other orthopoxviruses. JClin Microbiol. 1995 Aug; 33(8): 2069–76.

[0009] 5. Espy MJ, Cockerill III FR, Meyer RF, Bowen MD, Poland GA, Hadfield TL, et al. Detection of smallpox virus DNA by LightCycler PCR. J ClinMicrobiol. 2002Jun; 40(6):1985–8.

[0010] 6. CN114752711A Composition, kit, method and use thereof for detecting and typing monkeypox virus. Summary of the invention

[0011] The object of the present invention is to provide primers, probes, reaction solutions, detection methods and kits for rapid, simple and highly specific fluorescent PCR detection of monkeypox virus nucleic acid and typing in the same tube in view of the current status and existing deficiencies of the prior art. The present invention 1) uses a highly selective front primer for monkeypox virus to achieve high selectivity with other orthopoxviruses, 2) uses a Taqman-LNA probe for specific mutations of monkeypox virus type I and type II nucleic acid to achieve specific detection of two subtypes, and realizes PCR one-tube detection and typing by modifying different fluorescent groups at the 5' end of the typing probe, 3) the concise primer probe design with a new reaction solution system can achieve long-term stability after the PCR buffer and enzyme solution are premixed, greatly simplifying the experimental operation of the end user, 4) the detection reagent can support a fast PCR program, and can achieve nucleic acid amplification in as fast as 23 minutes with the Zhongyuan Huiji EXP160R fast PCR instrument, greatly improving the PCR detection efficiency.

[0012] To achieve the above object, the present invention adopts the following technical solutions:

[0013] In a first aspect, the present invention provides a composition for detecting monkeypox virus nucleic acid and typing by fluorescent quantitative PCR in one tube based on Taqman probe, the composition comprising:

[0014] The monkeypox virus selective primer MPV-F is as shown in SEQ ID NO.1 in the sequence list: 5'-AATCTGTAGGCCGTGTATCAGCA-3'; or a group of sequences having extended nucleotide fragments at the 5' end and / or 3' end of SEQ ID NO.1; or a group of sequences having a homology greater than 85% with SEQ ID NO.1; or a group of sequences complementary to the bases of SEQ ID NO.1;

[0015] The paired reverse primer MPV-R is as shown in SEQ ID NO.2 in the sequence list: 5'-ATAAAGCTCTGTATGATCTTCAACGT-3'; or a group of sequences having extended nucleotide fragments at the 5' end and / or 3' end of SEQ ID NO.2; or a group of sequences having a homology greater than 85% with SEQ ID NO.2; or a group of sequences complementary to the bases of SEQ ID NO.2;

[0016] And, Taqman-LNA probes for PCR fluorescence detection for detecting monkeypox virus nucleic acid and typing, including probes for monkeypox virus type I and type II:

[0017] The monkeypox virus type I fluorescent probe MPV-P1 is shown in SEQ ID NO.3 in the sequence table: 5'-TCGTcGGAaCTGTAcACCATAGtACT-3', wherein the lowercase bases in the probe are non-natural bases modified with locked nucleic acid; or a group of sequences having extended nucleotide fragments at the 5' end and / or 3' end of the probe sequence, or a group of sequences having a homology greater than 85% with the above sequence; or a group of sequences complementary to the bases of the above sequence;

[0018] The monkeypox virus type II fluorescent probe MPV-P2 is shown in SEQ ID NO.4 in the sequence list: 5'-TCGTtGGAgCTGTAaACCATAGcACT-3', wherein the lowercase bases in the probe are non-natural bases modified with locked nucleic acids; or a group of sequences with extended nucleotide fragments at the 5' end and / or 3' end of the probe sequence, or a group of sequences with a homology greater than 85% with the above sequence; or a group of sequences that are complementary to the bases of the above sequence.

[0019] In a preferred embodiment of the present invention, the composition of the present invention further comprises primers and probes for detecting human internal standard genes.

[0020] In a specific embodiment, the primers and probes of the human internal standard gene Actin are as follows:

[0021] Actin-F:5'-TGAGTGGCCCGCTACCTC-3';

[0022] Actin-R:5'-CCAGTGAGAAAGGGCGCA-3';

[0023] Actin-P:5'-CCTCCCTCCTTCCTGGCCTCCCG-3'.

[0024] In a preferred embodiment of the present invention, the fluorescent dye modified at the 5' end of the fluorescent probe is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; the fluorescent dye modified at the 3' end is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, and the fluorescent dyes modified at the 5' end of each probe are different and do not interfere with each other.

[0025] In a specific embodiment, the fluorescent dye modified at the 5' end of the monkeypox virus type I fluorescent probe MPV-P1 is FAM, and the fluorescent dye modified at the 3' end is BHQ1; the fluorescent dye modified at the 5' end of the monkeypox virus type II fluorescent probe MPV-P2 is ROX, and the fluorescent dye modified at the 3' end is BHQ2; the fluorescent dye modified at the 5' end of the human internal standard gene Actin fluorescent probe Actin-P is VIC, and the fluorescent dye modified at the 3' end is BHQ2.

[0026] In a second aspect, the present invention provides use of the composition described in the first aspect in preparing a kit for detecting and typing monkeypox virus.

[0027] In a third aspect, the present invention provides a kit for detecting and typing monkeypox virus nucleic acid in one tube by fluorescent quantitative PCR based on Taqman probes, wherein the kit includes the composition described in the first aspect.

[0028] In a preferred embodiment of the present invention, the kit also includes a nucleic acid releasing reagent, a nucleic acid extraction reagent, and a "one-tube method" reaction solution, the reaction solution components are Tris-HCl buffer (pH 8.0-9.0, 10-100mM), KCl (20-100mM), MgCl2 (1-10mM), dNTPs (N=A / U / G / C, 0.1-1mM), Taq polymerase (0.5-5U), Taq enzyme blocking agent (0.5-15U), uracil-N-glycosylase (UNG enzyme, 0.5-10U), and the composition described in the first aspect.

[0029] In some specific embodiments, the kit further comprises:

[0030] (1) Negative control: pure water.

[0031] (2) Positive control: including 2E5 copies / mL of plasmids or pseudoviruses containing the F3L gene sequences of monkeypox virus type I and type II, and 2E5 copies / mL of plasmids containing the human internal standard Actin gene sequence.

[0032] In a specific embodiment, the positive control monkeypox virus type I plasmid sequence is as shown in the sequence table SEQ IDNO.8:5'-TCAGAATCTAATGATGACATAACTAAGAAGTTTATCTACAGCCAATTTAGCTGCATTATTTTTAGCATCTCGTTTAGATTTTCCATCTGCCTTATCGAATACTCTTCCGTCAATGTCTACACAGGCATAAAATGTAGGAGAGTTACTAGGCCCCACTGATTCAATACGAAAAGACCAATCTCTCCTAGTTATTTGGCAGTACTCATTAATAACGGTGACAGGGTTAAC ACCTTTCCAATAAATAATTTTTTTAACCGGAATAACATCATCAAAAGACTTATTATCCTCTCATTGATTTTTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACCAACGAGGAGGAGTATCGTCGGAACTGTACACCATAGTACTACGTTGAAGATCATACAGAGCTTTATTAACTTCTCGCTTCTCCAT-3';

[0033] The positive control monkeypox virus type II plasmid sequence is shown in the sequence list SEQ ID NO.9:5'-TCAGAATCTAATGATGACATAACTAAGAAGTTTATCTACAGCCAATTTAGCTGCATTATTTTTAGCATCTCGTTTAGATTTTCCATCTGCCTTATCGAATACTCTTCCGTCAATGTCTACACAGGCATAAAATGTAGGAGTTACTAGGCCCCACTGATTCAATACGAAAAGACCAATCTCTCCTAGTTATTTGACAGTACTCATTAATAACGGTGACAGGGTTAACA CCTTTCCAATAAATAATTTTTTTAACCGGAATAACATCATCAAAAGACTTATGATCCTCTCATTGATTTTTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACCAACGAGGAGGAGTATCGTTGGAGCTGTAAACCATAGCACTACGTTGAAGATCATACAGAGCTTTATTAACTTCTCGCTTCTCCAT-3'.

[0034] In a fourth aspect, a method for detecting and typing monkeypox virus for non-diagnostic purposes is provided, the method comprising the following steps:

[0035] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0036] 2) performing fluorescent quantitative PCR analysis on the nucleic acid obtained in step 1) using the composition described in the first aspect or the kit described in the third aspect;

[0037] 3) Obtain and analyze the results.

[0038] In a specific embodiment, the sample described in step 1) of the above method is an oropharyngeal swab sample, a blood sample, and a skin lesion sample.

[0039] In this context, the term "non-diagnostic purpose" means not intended to obtain information on whether an individual is infected with monkeypox virus. For example, the method can be used to detect and type monkeypox virus in a test culture in an experiment for scientific research purposes.

[0040] Beneficial effects of the present invention:

[0041] 1) The present invention uses a highly selective front primer for monkeypox virus and a specific Taqman-LNA probe for monkeypox virus type I and type II, respectively, and by modifying the 5' end of the probe with different fluorescent dyes, it is possible to complete the nucleic acid detection and same-tube typing of monkeypox virus type I and type II with only one pair of primers and two probes. Figure 1 As shown in the figure, the front primer design region has 9 or more point mutations in other orthopoxvirus homologous regions, ensuring high selectivity for monkeypox virus detection. Figure 2 As shown, the Taqman-LNA probe adds locked nucleic acid LNA modification at the characteristic mutation sites of monkeypox virus type I and type II, effectively distinguishing the two subtypes of monkeypox virus. At the same time, the primer and probe design of the present invention greatly simplifies the result interpretation. FAM channel positive is monkeypox virus type I, and ROX channel positive is monkeypox virus type II.

[0042] 2) The PCR reaction solution of the present invention supports long-term storage after premixing of PCR buffer, primer probe and PCR enzyme components, which can be stored for one week at 37°C and for half a year at 2-8°C. The long-term stability of the PCR reaction solution benefits from the optimized PCR buffer formula and the simple primer probe design. The terminal use method is to mix the PCR reaction solution with the nucleic acid extraction product or the nucleic acid release product in a 1:1 ratio and then perform PCR amplification, which greatly simplifies the experimental operation.

[0043] 3) The PCR reaction solution of the present invention supports rapid PCR detection. When used with the Zhongyuan Huiji EXP160R rapid PCR instrument, nucleic acid amplification can be completed in as fast as 23 minutes. The recommended amplification program is as follows:

[0044]

[0045] 4) The primer-probe combination and detection kit of the present invention can be applied to oropharyngeal swab samples, serum samples and skin lesion tissue samples, and a pseudovirus containing the monkeypox virus sequence is used as a simulated sample for testing, with a sensitivity of 175 copies / mL. The present invention can be applied to oropharyngeal swab samples and has a high sensitivity, meeting the needs of community screening of monkeypox virus, disease course monitoring, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 .Design region map of highly selective forward primer for monkeypox virus.

[0047] The first and second lanes are the sequences of monkeypox virus type II and type I, respectively, and the third and following lanes are the sequences of other viruses in the genus Orthopoxvirus. The red box represents the region where the forward primer is located.

[0048] Figure 2 .Map of the design region of monkeypox virus typing probes.

[0049] The red box represents the region where the typing probe is located.

[0050] Figure 3 .Thermal stability test results of the fully premixed reaction solution.

[0051] Figure 4 .The fluorescence curve morphology of MPV-P1, MPV-P2 probes and alternative probes. DETAILED DESCRIPTION

[0052] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0053] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0054] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs.

[0055] Example 1. Design of primers and probes for detection and typing of monkeypox virus type I and type II nucleic acid

[0056] 1. Design of highly selective front primer for monkeypox virus

[0057] Download the genome sequences of monkeypox virus (type I and II), smallpox virus, cowpox virus, vaccinia virus, camelpox virus, horsepox virus, volepox virus, raccoonpox virus, skunkpox virus, gerbilpox virus, and mouse foot disease virus from NCBI_Nucleotide, and then use MAFFT v7.037b program for sequence alignment. The 325-374 interval of the F3L gene (sequence length 462bp) is a highly selective sequence region for monkeypox virus. Designing primers in this region can achieve high selectivity of monkeypox virus detection for other viruses of the orthopoxvirus genus. Figure 1 In the region covered by primer SEQ ID NO.1 shown, other orthopoxvirus viruses have 9 or more point mutations, and complete off-target can be achieved in the PCR reaction.

[0058] 2. Design of monkeypox virus typing probe

[0059] Monkeypox virus types I and II have different characteristic mutation patterns of nucleic acids. Probes with different fluorescent groups are designed to selectively bind to the characteristic mutations of the two subtypes, so that both subtypes can be detected in the same tube. The greater the difference in mutation patterns, the better the selectivity for different subtypes. There are a total of 6 characteristic point mutations between the F3L genes of monkeypox virus types I and II, of which the last 4 point mutations are concentrated in the 396-414 interval of the F3L gene and are adjacent to the monkeypox virus high selectivity region of the F3L gene. The design of the typing probe makes full use of these 4 characteristic mutations on the type I and type II F3L genes. At the same time, the introduction of locked nucleic acid (LNA) modification at the mutation site can further enhance the difference and achieve single detection of the two subtypes. The type I monkeypox virus probe MPV-P1 is shown in SEQ ID NO.3 in the sequence list: 5'-TCGTcGGAaCTGTAcACCATAGtACT-3', wherein the lowercase letters represent LNA modification; the type II monkeypox virus probe MPV-P2 is shown in SEQ ID NO.4 in the sequence list: 5'-TCGTtGGAgCTGTAaACCATAGcACT-3', wherein the lowercase letters represent LNA modification.

[0060] 3. Design of Paired Reverse Primers for Monkeypox Virus

[0061] The design region of the reverse primer MPV-R is the 418-443 interval of the F3L gene, as shown in SEQ ID NO.2 in the sequence table: 5'-ATAAAGCTCTGTATGATCTTCAACGT-3'. The length of the amplified product is 105 bp. The shorter amplified product is beneficial to improving the anti-inhibition performance of the amplification reaction and the adaptability of rapid PCR.

[0062] Example 2. Monkeypox virus type I and type II nucleic acid detection and typing kit

[0063] 1. Fully premixed reaction solution

[0064] The PCR reaction solution of the present invention is a fully premixed reaction solution, which supports long-term storage after premixing of PCR buffer, primer probe and PCR enzyme components. In a specific embodiment, the reaction solution includes: primers MPV-F 0.4μM, MPV-R 0.4μM, Actin-F 0.2μM, Actin-R 0.2μM, probe MPV-P1 (5'-FAM, 3'-BHQ1) 0.1μM, MPV-P2 (5'-ROX, 3'-BHQ2) 0.1μM, Actin-P (5'-VIC, 3'-BHQ2) 0.1μM, Tris-HCl buffer 40mM pH 8.8, potassium chloride 40mM, magnesium chloride 4.0mM, dATP, dGTP, dCTP 0.3mM each, dUTP 0.6mM, Taq polymerase 2.5U, Taq enzyme blocking agent 5U, UNG enzyme 2U.

[0065] 2. Negative and positive controls

[0066] The negative control was pure water, and the positive control was pUC57 plasmid containing the F3L gene sequences of monkeypox virus type I and type II, respectively, with the insertion site between 450-451, and the F3L gene sequences were shown in SEQ ID NO.8 and SEQ ID NO.9. The actual concentration of the plasmid was determined using the digital PCR method. Plasmid synthesis was completed by General Bio (Anhui) Co., Ltd., and digital PCR quantification was completed by Beijing Xinyi Biotechnology Co., Ltd.

[0067] 3. Thermal stability test of the fully premixed reaction solution

[0068] The monkeypox virus type I and type II positive controls were diluted to 2E4 copies / mL using the virus preservation solution (Cat. No.: SRR-1, Batch No. 5209001) of Zhongyuan Huiji Biotechnology Co., Ltd., and then the nucleic acid samples were extracted according to the instructions using the nucleic acid extraction reagent (Cat. No.: RT-B-200, Batch No. 5205013) of Zhongyuan Huiji Biotechnology Co., Ltd. The nucleic acid extraction products were added to the fully premixed reaction solution heated at 37°C for 7 days and the newly prepared reaction solution, respectively. The volume ratio of the nucleic acid extraction product to the reaction solution was 1:1, and the total volume of the PCR single-well reaction system was 20 μL. The results are as follows Figure 3 As shown, the full premixed reaction solution was still able to detect the positive control normally after being heated at 37°C for 7 days, showing only a slight decrease in the fluorescence curve increment, while the Ct value did not change significantly.

[0069] Example 3. PCR nucleic acid and typing detection method for monkeypox virus type I and type II

[0070] (1) Sample preparation: Use nucleic acid extraction reagent (Cat. No. RT-B-200, Batch No. 5205013) to extract viral nucleic acid, or use sample release agent (Cat. No. SRR-1, Batch No. 5209001) to release nucleic acid. The recommended reagent loading ratio is the full premixed reaction solution described in Example 2: nucleic acid sample = 1:1, and the total volume of the PCR single-well reaction system is 20-100 μL.

[0071] (2) Fluorescence quantitative PCR instrument and program settings

[0072] The general amplification program of fluorescent quantitative PCR instrument is:

[0073]

[0074] The amplification procedure for the EXP160 and EXP160R fluorescence quantitative PCR instruments of Zhongyuan Huiji Biotechnology Co., Ltd. is as follows:

[0075]

[0076] The total amplification time of the EXP160 fluorescence quantitative PCR instrument is about 31 minutes, and the amplification time of the EXP160R fluorescence quantitative PCR instrument is about 23 minutes.

[0077] (3) The method for interpreting the test results is as follows:

[0078] Positive for monkeypox virus type I: Positive for FAM channel

[0079] Positive for monkeypox virus type II: ROX channel positive

[0080] Monkeypox virus negative: FAM channel and ROX channel are negative, and VIC channel is positive

[0081] Invalid result: FAM channel, VIC channel and ROX channel are all negative.

[0082] Note: The standard for positive fluorescence channel is that the fluorescence curve is an S-shaped curve and Ct≤42; the standard for negative is NoCt.

[0083] Example 4. Detection sensitivity test of the kit of the present invention

[0084] The monkeypox virus type II positive plasmid was diluted to 250 copies / mL, 175 copies / mL and 100 copies / mL using virus preservation solution (Zhongyuan Huiji Biotechnology Co., Ltd., catalog number Inactivated-1, batch number 5202018) with oropharyngeal swabs, negative serum, and pustule negative samples to simulate clinical oropharyngeal swab samples, blood samples and skin lesion samples. Viral nucleic acid was extracted using nucleic acid extraction reagent (catalog number RT-B-200, batch number 5205013), and each concentration gradient was tested 20 times. Three batches of detection reagents were used for testing, and the detection rate ≥95% was used as the detection sensitivity of this kit. The results are shown in Tables 1 to 3.

[0085] Table 1. Sensitivity results of three batches of test reagents - oropharyngeal swab samples

[0086]

[0087] Table 2. Sensitivity results of three batches of detection reagents - serum samples

[0088]

[0089]

[0090] Table 3. Results of three batches of test reagents to determine sensitivity - pustular samples

[0091]

[0092] Conclusion: It can be seen from the above results that for the three simulated clinical samples of 175 copies / mL, the three batches of detection reagents can achieve a positive detection rate of more than 95%. Therefore, it is determined that the detection sensitivity of the composition of the present invention is 175 copies / mL.

[0093] Example 5. Specificity verification of the composition of the present invention

[0094] 1. Specificity verification of orthopoxvirus

[0095] Synthesize the plasmids of F3L genes of smallpox virus, cowpox virus, vaccinia virus, camelpox virus, horsepox virus, volepox virus, raccoonpox virus, skunkpox virus, gerbilpox virus, mouse foot disease virus, etc. Use digital PCR to determine the actual concentration of the plasmid, dilute the interfering virus plasmid to 1E6 copies / mL with virus preservation solution (Cat. No. Inactivated-1, Batch No. 5202018), extract viral nucleic acid with nucleic acid extraction reagent (Cat. No. RT-B-200, Batch No. 5205013), and then use three batches of detection reagents for cross-reaction test. Mix 175 copies / mL of monkeypox virus type II positive plasmid under the same concentration conditions, extract viral nucleic acid with nucleic acid extraction reagent (Cat. No. RT-B-200, Batch No. 5205013), and then use three batches of detection reagents for competitive interference detection.

[0096] Table 4. Results of three batches of test reagents to determine specificity - Orthopoxvirus

[0097]

[0098] Conclusion: It can be seen from the above results that the three batches of detection reagents do not cross-react with non-monkeypox viruses of the genus Orthopoxvirus, and the primer-probe combination of the present invention shows good selectivity for monkeypox virus.

[0099] 2. Specific verification of pathogens with similar symptoms

[0100] Pathogens with similar clinical symptoms and coexisting sampling sites were selected for specific verification, including: herpes simplex virus type I, herpes simplex virus type II, herpes zoster virus, Staphylococcus aureus, influenza A virus, influenza B virus, new coronavirus, respiratory syncytial virus, parainfluenza virus, adenovirus, hepatitis B virus, hepatitis C virus, HIV, cytomegalovirus, etc. Among them, the source of new coronavirus, hepatitis B virus and HIV samples was the nucleic acid quality control product of Guangzhou Bondeson Biotechnology Co., Ltd., and the source of the remaining pathogen samples was Hainan Medical College, and the digital PCR method was used to determine the true concentration. The sample was diluted to 1E6 copies / mL with virus preservation solution (item number Inactivated-1, batch number 5202018), and the viral nucleic acid was extracted with nucleic acid extraction reagent (item number RT-B-200, batch number 5205013), and then three batches of detection reagents were used for cross-reaction testing. Under the same concentration conditions, 175 copies / mL of monkeypox virus type II positive plasmid was mixed in, and the viral nucleic acid was extracted using a nucleic acid extraction reagent (catalog number RT-B-200, batch number 5205013), and then competitive interference detection was performed using three batches of detection reagents.

[0101] Table 5. Specificity results of three batches of detection reagents - common pathogens

[0102]

[0103] Conclusion: It can be seen from the above results that the three batches of detection reagents do not cross-react with pathogens with similar symptoms, and the primer-probe combination of the present invention shows good selectivity for monkeypox virus.

[0104] Example 6. Anti-interference performance of the kit of the present invention

[0105] In order to investigate the effect of possible endogenous / exogenous substances on the detection performance, the additives were diluted to the test concentration with virus preservation solution (Cat. No. Inactivated-1, Batch No. 5202018), mixed with 175 copies / mL of monkeypox virus type II positive plasmid, and the viral nucleic acid was extracted with nucleic acid extraction reagent (Cat. No. RT-B-200, Batch No. 5205013). Then, the anti-interference performance was tested with three batches of detection reagents, and each sample was tested twice.

[0106] Table 6. Anti-interference results of three batches of detection reagents

[0107]

[0108]

[0109] Conclusion: From the above results, it can be seen that the three batches of detection reagents can detect positive results normally in the presence of endogenous / exogenous additives, and there is no obvious interference with the test results.

[0110] Comparative Example 1. Comparative test of the composition of the present invention and other alternative primers and probe sequences

[0111] The present invention can detect and type monkeypox virus nucleic acid through a pair of primers and two probes, and then match the primers and probes for detecting human internal standard genes. Overall, the side reactions between the primers and probes in the reaction system are relatively mild. The inventors also designed alternative primers and probes in the 300-462 interval of the F3L gene (sequences not shown). The positive detection rates of the alternative primers for three simulated samples of 175 copies / mL are: 85% for oropharyngeal swab samples, 85% for negative serum, and 80% for pustular negative samples. It can be seen that the detection sensitivity of the alternative primers is worse than that of the primer-probe combination recommended in the present invention. The alternative probe differs from the recommended probe by 2 bases, resulting in the quenching efficiency and increment / background ratio of the alternative fluorescent probe being worse than those of the recommended probe (such as Figure 4 shown).

[0112] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A composition for detecting monkeypox virus nucleic acid and typing by fluorescent quantitative PCR based on Taqman probe, characterized in that: The composition comprises: The monkeypox virus selective primer MPV-F is shown in SEQ ID NO.1 in the sequence list: 5'-AATCTGTAGGCCGTGTATCAGCA-3'; The paired reverse primer MPV-R is shown in SEQ ID NO.2 in the sequence list: 5'-ATAAAGCTCTGTATGATCTTCAACGT-3'; And, Taqman-LNA probes for PCR fluorescence detection for detecting monkeypox virus nucleic acid and typing, including probes for monkeypox virus type I and type II: The monkeypox virus type I fluorescent probe MPV-P1 is shown in SEQ ID NO.3 in the sequence list: 5'-TCGTcGGAaCTGTAcACCATAGtACT-3', wherein the lowercase bases in the probe are non-natural bases modified with locked nucleic acid; The monkeypox virus type II fluorescent probe MPV-P2 is shown in SEQ ID NO.4 in the sequence table: 5'-TCGTtGGAgCTGTAaACCATAGcACT-3', wherein the lowercase bases in the probe are non-natural bases modified with locked nucleic acid.

2. The composition according to claim 1, characterized in that The composition further comprises primers and probes for detecting human internal standard genes.

3. The composition according to claim 2, characterized in that The primers and probes of the human internal standard gene Actin are as follows: Actin-F:5'-TGAGTGGCCCGCTACCTC-3'; Actin-R:5'-CCAGTGAGAAAGGGCGCA-3'; Actin-P:5'-CCTCCCTCCTTCCTGGCCTCCCG-3'.

4. The composition according to claim 3, characterized in that The fluorescent dye modified at the 5' end of the fluorescent probe is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; the fluorescent dye modified at the 3' end is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, and the fluorescent dyes modified at the 5' end of each probe are different and do not interfere with each other.

5. The composition according to claim 4, characterized in that The fluorescent dye modified at the 5' end of the monkeypox virus type I fluorescent probe MPV-P1 is FAM, and the fluorescent dye modified at the 3' end is BHQ1; the fluorescent dye modified at the 5' end of the monkeypox virus type II fluorescent probe MPV-P2 is ROX, and the fluorescent dye modified at the 3' end is BHQ2; the fluorescent dye modified at the 5' end of the human internal standard gene Actin fluorescent probe Actin-P is VIC, and the fluorescent dye modified at the 3' end is BHQ2.

6. Use of the composition according to any one of claims 1 to 5 in the preparation of a kit for detecting and typing monkeypox virus.

7. A kit for detecting monkeypox virus nucleic acid and typing using fluorescent quantitative PCR in one tube based on Taqman probe, characterized in that: The kit comprises the composition according to any one of claims 1 to 5.

8. The kit according to claim 7, characterized in that The kit also includes a nucleic acid release reagent, a nucleic acid extraction reagent, a "one-tube method" reaction solution, and the composition according to any one of claims 1 to 5; the "one-tube method" reaction solution components are: 10-100mM Tris-HCl buffer with a pH of 8.0-9.0, 20-100mM KCl, 1-10mM MgCl2, 0.1-1mM dNTPs, 0.5-5U Taq polymerase, 0.5-15U Taq enzyme blocking agent, 0.5-10U uracil-N-glycosylase, and the concentrations of the components of the "one-tube method" reaction solution are all final concentrations.

9. The kit according to claim 8, characterized in that The kit also includes: (1) Negative control: pure water; (2) Positive controls: 2E5 copies / mL of plasmids or pseudoviruses containing the F3L gene sequences of monkeypox virus type I and II, and 2E5 copies / mL of plasmids containing the human internal standard Actin gene sequence; The nucleotide sequence of the monkeypox virus type I plasmid in the positive control is shown in SEQ ID NO.8; The nucleotide sequence of the positive control monkeypox virus type II plasmid is shown in SEQ ID NO.9.

Images