Codon optimization of NSP15 gene to induce organ development defects in Drosophila, model construction and application in screening of anti-COVID-19 drugs

Abstract

The present invention relates to the field of molecular biology and genetic engineering technology, and specifically provides an application of a codon-optimized NSP15 gene in inducing organ developmental defects in fruit flies, as well as a transgenic fruit fly model for screening anti-new coronavirus drugs based on the organ developmental defects in fruit flies and a method for screening anti-new coronavirus drugs. Through induction, the codon-optimized NSP15 gene can be overexpressed in different organs of fruit flies, resulting in developmental defects visible to the naked eye in fruit fly organs. By rationally selecting transgenic fruit fly strains whose organ developmental defects are easy to observe as models, it is possible to screen or evaluate drugs for treating related diseases caused by overexpression of NSP15 proteins, especially the effects of drugs for treating new coronaviruses, at low cost and quickly, thereby effectively making up for the deficiencies of screening methods based on computational biology and screening methods based on cultured cells.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and genetic engineering technology, and specifically provides an application of a codon-optimized NSP15 gene in inducing organ development defects in fruit flies, as well as a transgenic fruit fly model for screening anti-new coronavirus drugs based on fruit fly organ development defects and a method for screening anti-new coronavirus drugs. Background Art

[0002] COVID-19, caused by the SARS-CoV-2 virus, has become the most serious global infectious disease of this century, with significant impacts on the economy, society, and politics. It is urgent to develop specific drugs against SARS-CoV-2 to block and treat the new coronavirus.

[0003] The SARS-CoV-2 genome is approximately 30kb, containing 4 structural proteins and approximately 15 non-structural proteins, of which non-structural proteins play an important role in the life cycle of SARS-CoV-2. NSP15, as a conservative non-structural protein of the new coronavirus, can hexamerize to form a large protein complex in the form of a hexamer. NSP15-like non-structural proteins are found in all members of the coronavirus family, and this non-structural protein is highly conserved; and NSP15 has endoribonuclease function, which plays an important role in viral genome replication and viral immune escape. It is an effective target for the development of drugs to treat the new coronavirus, so drug development targeting NSP15 is of great significance.

[0004] There are two main methods for drug screening against the SARS-CoV-2 protein NSP15: computational biology-based screening and cultured cell-based screening. Computational biology-based screening has many false positives and requires laboratory verification; while cultured cell-based screening is expensive, and the cells are in vitro during the screening process, making it difficult to simulate the effects of the SARS-CoV-2 protein NSP15 and drugs on multicellular organisms.

[0005] Due to the high level of gene and signal conservation, there are certain similarities between fruit flies and mammals in cell physiological and biochemical processes. Transgenic fruit flies are often used to establish experimental models to study human genes in developmental genetics, signal transduction and cell biology. Practice has proved that using transgenic fruit fly models to study the mechanisms of various diseases has many unique advantages. Summary of the invention

[0006] The present invention designs and constructs a transgenic fruit fly model for screening anti-new coronavirus drugs based on molecular cloning, transgenic, fruit fly Gal4 / UAS system, fruit fly hybridization and other technologies. The model can screen or evaluate drugs for treating related diseases caused by overexpression of NSP15 protein at low cost and quickly, especially the effects of potential new coronavirus therapeutic drugs targeting NSP15 protein, thereby effectively making up for the shortcomings of the above two screening methods.

[0007] First, the present invention optimizes the codons of the base sequence corresponding to the NSP15 protein so that it can be smoothly and stably expressed in fruit flies, and the base sequence of the codon-optimized NSP15 gene is shown in SEQ ID NO.1. Based on the fruit fly Gal4 / UAS system, the codon-optimized NSP15 non-structural protein can be expressed in specific organs of fruit flies. By hybridizing with a series of different types of Gal4 strain fruit flies, the codon-optimized NSP15 gene is overexpressed in different corresponding organs of the corresponding offspring fruit flies, so we can obtain a variety of different types of offspring fruit flies, and these offspring fruit flies all have different visible organ defects. According to the organ defect characteristics of these offspring fruit flies, a variety of different types of transgenic fruit fly models can be established. In addition, we can further screen out several types of trait defects with stronger identifiability, and can establish a stable target strain transgenic fruit fly model that can screen anti-new coronavirus drugs targeting NSP15 protein based on these types of transgenic fruit fly models.

[0008] As a potential auxiliary means, in addition to screening anti-COVID-19 drugs targeting NSP15, this fruit fly model can also be used to screen key signaling pathways and their drugs in the course of diseases related to NSP15 overexpression; or to screen proteins and their drugs that interact with NSP15.

[0009] The present invention provides the following method for completing the construction of a transgenic fruit fly model for screening anti-new coronavirus drugs, which is carried out by the following steps:

[0010] Step (1): Construction of a recombinant vector plasmid: codon-optimizing the base sequence of the non-structural protein NSP15 gene of the novel coronavirus (SARS-CoV-2), synthesizing a codon-optimized NSP15 gene having a base sequence as shown in SEQ ID NO.1, and preparing a recombinant vector plasmid containing the codon-optimized NSP15 gene;

[0011] Step (2): Cultivation of homozygous primary transgenic fruit flies: injecting the recombinant vector plasmid into fruit fly embryos / fertilized eggs, and after developing into adults, further screening and hybridization are performed to obtain homozygous UAS-NSP15 primary transgenic fruit flies with the codon-optimized NSP15 gene inserted into chromosome 3;

[0012] Step (3): Cultivation of transgenic fruit flies of stable target strains: Using the Gal4 / UAS system, the homozygous UAS-NSP15 primary transgenic male fruit flies obtained in step (2) are hybridized with virgin fruit flies of the Gal4 strain, so that the codon-optimized NSP15 gene is overexpressed in the organs of the offspring fruit flies, and several special Gal4 / UAS fruit flies of the offspring fruit flies with visible organ development defects and retained reproductive ability are screened out; various virgin fruit flies of the special Gal4 / UAS strains are hybridized with male fruit flies of the balance strain to obtain recombinant fruit flies; after removing the balance chromosome of chromosome 3 of the recombinant fruit fly, the transgenic fruit flies of the stable target strain are obtained, and the transgenic fruit flies of the stable target strain have visible organ development defects.

[0013] Furthermore, in step (3), the Drosophila Gal4 / UAS system is used to hybridize the selected homozygous UAS-NSP15 first-generation transgenic male fruit flies with virgin fruit flies of different Gal4 strains. Through the induction of different Gal4s, the fruit flies express NSP15 protein in different organs and exert the effect of inducing organ development defects in fruit flies. Through the above hybridization, we obtained a Gal4 / UAS combination that not only has a phenotype of organ development defects that are clearly visible to the naked eye, but also can construct a stable strain. This combination is of great significance in the application of constructing a transgenic fruit fly model for screening anti-new coronavirus drugs. In particular, after selecting the nubbin-Gal4 strain virgin fruit flies as the variety for hybridization with the homozygous UAS-NSP15 first-generation transgenic male fruit flies, the hybrid offspring fruit flies showed wing development defects that were clearly visible to the naked eye, and we labeled them as nubbin-Gal4 / UAS strain fruit flies. Compared with the phenotype of other organ developmental defects in Drosophila, wing defects and the recovery of their traits are easy to observe with the naked eye, and wing defects have no significant effect on the normal activities of Drosophila, such as feeding and reproduction, which facilitates large-scale cultivation and screening;

[0014] On this basis, the present invention has found in experiments that the following method can be used to construct a transgenic fruit fly model for screening anti-new coronavirus drugs, which can more stably obtain a transgenic fruit fly strain that is stable and can be reproduced in large quantities for drug screening against NSP15. Specifically:

[0015] In step (1), the codon-optimized NSP15 gene is inserted into the Drosophila expression vector pUAST-attB, and the recombinant vector plasmid is the pUAST-attB-NSP15 recombinant vector plasmid containing the codon-optimized NSP15 gene;

[0016] In step (2), the pUAST-attB-NSP15 recombinant vector plasmid is injected into white-eyed Drosophila embryos / fertilized eggs. The homozygous UAS-NSP15 primary transgenic Drosophila has a genotype of The homozygous first generation of transgenic fruit flies;

[0017] In step (3), the nubbin-Gal4 strain virgin fruit flies have a genotype of The virgin fruit flies, the nubbin-Gal4 / UAS strain fruit flies have the genotype wing defects in Drosophila;

[0018] The male fruit flies of the balanced line have the genotype The male fruit fly of of recombinant Drosophila;

[0019] The stable target strain transgenic fruit flies have a genotype of Stable target strain of transgenic Drosophila.

[0020] Furthermore, in the step (1), the codon-optimized NSP15 gene and the pUAST-attB vector are digested with EcoRⅠ and XhoⅠ, connected and transferred into DH5α competent bacteria and cultured in large quantities, and the pUAST-attB-NSP15 recombinant vector plasmid is extracted from the DH5α competent bacteria.

[0021] Furthermore, plasmids were extracted from the DH5α competent bacteria and sequenced, and pUAST-attB-NSP15 recombinant vector plasmid was extracted.

[0022] Furthermore, in step (2), the further screening and hybridization steps are as follows. Based on this method, it is easier to determine the target strain to be screened by the phenotype of the hybridized fruit flies:

[0023] The fruit flies that have developed into adults are the G0 generation fruit flies. The G0 generation fruit flies are self-fertilized and the genotypes are screened. The G1 red-eyed yellow-body male fruit flies have the genotype The female fruit flies with hairy shoulders and large balance bars were crossed to obtain the G2 generation fruit flies;

[0024] The genotypes of G2 generation fruit flies were screened. The red-eyed, hairy-shouldered male fruit flies are similar to the genotype The G3 generation fruit flies were obtained by crossing the female fruit flies with hairy shoulders and large balance bars.

[0025] The genotypes of G3 generation fruit flies were screened. The red-eyed, hairy-shouldered male fruit flies are related to the genotype The red-eyed female fruit flies with hairy shoulders were crossed to obtain the G4 generation fruit flies. The fruit flies with hairy shoulders were eliminated and the genotype was screened. Homozygous first generation transgenic fruit flies.

[0026] After obtaining the transgenic fruit flies of the stable target strain, the drug to be screened / feed containing the drug to be screened is fed in a sealed container, and the transgenic fruit flies of the stable target strain are self-fertilized to obtain offspring fruit flies, and the development of the wings of the offspring fruit flies is observed. By observing the recovery of the wings of the newly eclosing offspring fruit flies, drugs for treating related diseases caused by overexpression of NSP15 protein can be screened and evaluated, especially the potential therapeutic effects of drugs targeting NSP15 protein. Through large-scale cultivation, it can be used for in vivo, rapid, large-scale, and low-cost drug screening.

[0027] The present invention has at least the following benefits:

[0028] 1. The present invention optimizes the base sequence of the NSP15 gene, and treats the fertilized eggs or embryos of Drosophila with a recombinant vector plasmid having a codon-optimized NSP15 gene. Through induction, the codon-optimized NSP15 gene can be overexpressed in different organs of transgenic Drosophila, resulting in developmental defects visible to the naked eye in the organs of the transgenic Drosophila. By rationally selecting transgenic Drosophila strains with organ developmental defects that are easy to observe, various types of transgenic Drosophila models can be established;

[0029] 2. Establish genotype The stable target strain transgenic fruit fly model has a wing defect and its trait recovery that is easy to observe with the naked eye compared to the phenotype of other organ developmental defects in fruit flies, and the wing defect has no significant effect on the normal activities of fruit flies, such as feeding and reproduction, making it convenient for large-scale cultivation and screening. After feeding the stable target strain transgenic fruit flies with the drug to be screened / feed containing the drug to be screened, the recovery of the wings of the newly ecloded offspring fruit flies obtained by self-pollination is observed, which can be used to screen and evaluate drugs for the treatment of related diseases caused by overexpression of the NSP15 protein, especially the effect of potential new coronavirus therapeutic drugs targeting the NSP15 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The basic process for constructing a transgenic fruit fly model for screening anti-COVID-19 drugs;

[0031] Figure 2 This is the plasmid map of the pUAST-attB-NSP15 recombinant vector plasmid;

[0032] Figure 3The hybridization process of the transgenic fruit fly model for screening anti-COVID-19 drugs;

[0033] Figure 4 A: Under a stereo microscope 1118 Comparison of the wings of wild-type fruit flies and transgenic fruit flies of the nubbin>UAS-NSP15 stable target strain; B:w 1118 Magnified images of the wings of wild-type flies and transgenic flies of the nubbin>UAS-NSP15 stable target strain; C:w 1118 Comparison of wing imaginal discs of wild-type Drosophila and transgenic Drosophila of the nubbin>UAS-NSP15 stable target strain during the third instar larvae; D:w 1118 Comparison of the third pair of legs of wild-type and nubbin>UAS-NSP15 stable target transgenic flies; E:w 1118 Balance stick comparison of wild-type and nubbin>UAS-NSP15 stable target strain transgenic flies;

[0034] Figure 5 Under stereo microscope 1118 Wild-type flies and flies overexpressing point mutant protein NSP15 K290A Drosophila (nubbin>UAS-NSP15 K290A ) comparison chart. DETAILED DESCRIPTION

[0035] Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terminology used herein is intended only to describe specific embodiments, and is not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. As used herein, the term "about" when used in reference to a specific recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values ​​therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0037] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0038] Through extensive and in-depth research, the inventors have established a method for inducing organ development defects in transgenic fruit flies based on the NSP15 gene, and using this method to screen anti-new coronavirus drugs. In this method, after codon optimization of the NSP15 base sequence, a codon-optimized NSP15 gene with a base sequence as shown in SEQ ID NO.1 is synthesized to ensure that it is suitable for stable expression in transgenic fruit flies. Specifically, the inventors constructed a vector plasmid for codon-optimized NSP15 gene by the following method:

[0039] Example

[0040] Part 1: Establishment of a transgenic fruit fly model for screening anti-COVID-19 drugs

[0041] Step (1): Construction of recombinant vector plasmid

[0042] The NSP15 gene sequence of SARS-CoV-2 (i.e., SEQ ID NO.2) was downloaded from NCBI, and after codon optimization, a DNA fragment of NSP15 suitable for expression in Drosophila was synthesized (i.e., SEQ ID NO.1).

[0043] The synthesized DNA fragment and pUAST-attB vector were digested with EcoRI and XhoI, ligated and transferred into DH5α competent bacteria (provided by Sangon Biotech (Shanghai) Co., Ltd.), the bacteria were cultured in large quantities, and the recombinant vector plasmid was extracted and sequenced. The sequencing primers are as follows:

[0044] pUAST-F (SEQ ID NO.4): GAATCAATTAAAGTAACCAGCAACC;

[0045] pUAST-R (SEQ ID NO. 5): CCTTAGAGCTTTAAATCTCTGTAGGTAG.

[0046] The sequence was confirmed to be correct by sequencing. The plasmid map of the recombinant vector plasmid is as follows Figure 2 shown.

[0047] Step (2): Cultivation of homozygous first-generation transgenic fruit flies

[0048] The obtained recombinant vector plasmid was injected into the fertilized eggs of white-eyed Drosophila. The parental Drosophila was from the Bloomington Drosophila Center, the strain number was BDSC#24749, and the genotype was

[0049] After the recipient white-eyed fruit fly fertilized eggs develop into adults, the genotype obtained is The G0 generation heterozygous transgenic fruit flies were further screened and hybridized by the following methods to obtain the homozygous UAS-NSP15 primary transgenic fruit flies with the codon-optimized NSP15 gene inserted into chromosome 3:

[0050] The G0 generation fruit flies that developed into adults were self-fertilized and the genotypes were screened. The G1 red-eyed yellow-body male fruit flies have the genotype The G2 generation of fruit flies were obtained by hybridization with the hairy female fruit flies with large balance bar shoulders (provided by Shantou University Medical College);

[0051] The genotypes of G2 generation fruit flies were screened. The red-eyed, hairy-shouldered male fruit flies are similar to the genotype The G3 generation of fruit flies were obtained by hybridization with the hairy female fruit flies with large balance bar shoulders (provided by Shantou University Medical College);

[0052] The genotypes of G3 generation fruit flies were screened. The red-eyed, hairy-shouldered male fruit flies are related to the genotype The red-eyed female fruit flies with hairy shoulders were crossed to obtain the G4 generation fruit flies. The fruit flies with hairy shoulders were removed from the G4 generation fruit flies, and the genotype was screened. The fruit flies are homozygous UAS-NSP15 primary transgenic fruit flies with the desired target, codon-optimized NSP15 gene inserted at a specific site on chromosome 3.

[0053] Step (3): Cultivation of stable target strain transgenic fruit flies:

[0054] Using the Gal4 / UAS system, the genotype obtained in step (2) was The homozygous UAS-NSP15 primary transgenic male fruit flies were The offspring of the G5 generation fruit flies were hybridized with virgin fruit flies (provided by the Drosophila Center of Tsinghua University). We can find that all the G5 generation fruit flies have visible wing development defects. The genotypes of these G5 generation fruit flies with wing development defects are

[0055] The genotypes of G5 generation fruit flies were screened. The wing defective virgin fruit flies were crossed with balanced male fruit flies. In this embodiment, the genotype selected was The G6 generation fruit flies were obtained by crossbreeding with male fruit flies of the large balance bar shoulder hairy balance line (provided by Shantou University Medical College), i.e., the genotype is of recombinant Drosophila;

[0056] The balance chromosome of chromosome 3 of the recombinant fruit fly was removed, thereby obtaining the G7 generation fruit fly, i.e., the genotype is We identified this stable target strain of transgenic fruit flies as nubbin>UAS-NSP15. Figure 4 A- Figure 4 E, nubbin>UAS-NSP15 stable target strain transgenic fruit flies and w 1118 Compared with wild-type fruit flies, Figure 4 A shows that the wings of transgenic fruit flies of the nubbin>UAS-NSP15 stable target strain have obvious developmental defects visible to the naked eye. Figure 4 B shows the magnification relative to w 1118 The wings of wild-type fruit flies develop normally, showing wrinkled and messy textures; Figure 4 C shows that the wing imaginal discs of the third instar larvae of the nubbin>UAS-NSP15 stable target strain of transgenic fruit flies have shown irregular shapes and slightly smaller volumes; at the same time, Figure 4 D The dotted line marks the third pair of feet of Drosophila, and the third pair of feet of transgenic Drosophila of nubbin>UAS-NSP15 stable target strain are deformed; Figure 4 E The dotted line marks the area of ​​the Drosophila balance bar. The transgenic Drosophila of the nubbin>UAS-NSP15 stable target strain has a deformed balance bar and is slightly smaller in size.

[0057] The above results indicate that overexpression of NSP15 in the wing imaginal disc leads to developmental defects of the imaginal disc. This result also suggests that the new coronavirus infection can also cause damage to human tissues through the NSP15 protein. Since nubbin-Gal4 is also expressed in the imaginal discs of the third pair of legs and the balance bar, there will be certain phenotypes in the third pair of legs and the balance bar of the adult, but they are not as obvious as in the wings. Based on the stable and significant phenotype of the wings and their fertility, the nubbin>UAS-NSP15 stable target strain transgenic fruit flies are suitable for establishing a model for anti-new coronavirus drugs targeting NSP15.

[0058] Part 2. Screening process of anti-COVID-19 drugs using transgenic fruit fly models. Cultivate a large number of transgenic fruit flies based on the nubbin>UAS-NSP15 stable target strain obtained in Part 1, and use it as a model to screen anti-COVID-19 drugs targeting NSP15. The specific steps are as follows:

[0059] Step (1): Preparation of fruit fly food containing anti-COVID-19 drugs to be screened (2L system)

[0060] ① Weigh 80g sucrose, 50g yeast, 133.65g corn flour, 18.36g soybean flour, 20g agar powder, and 84.8g maltose.

[0061] ② Add 1L of water to the pot, heat to boil, measure 250ml of water and add it to the maltose, stir evenly, and then measure 1L of water for standby use.

[0062] ③ After the water boils, add agar powder in turn and cook until mixed, add sucrose until melted, add yeast powder, corn flour, soybean flour in batches, add maltose water, add all 1L of water into the pot, stirring constantly until it boils.

[0063] ④ After stirring continuously for 10 minutes, turn off the heat. When the mixture cools to 70°C, add 0.5 g of methyl paraben (dissolved in 5 ml of alcohol) and 9 ml of propionic acid, stir evenly, and dispense into fruit fly tubes to prepare fruit fly tube culture medium.

[0064] ⑤ Select an appropriate concentration of the anti-new coronavirus drug to be screened and dissolve it in water or alcohol. Drop an appropriate amount of the drug in the center of the fruit fly tube culture medium and incubate it at 4°C overnight to allow the drug to be screened to penetrate the entire culture medium.

[0065] Step (2): Efficacy verification of the anti-COVID-19 drug to be screened

[0066] The culture medium obtained in step (1) is placed at room temperature, and 10 transgenic male and female fruit flies of the nubbin>UAS-NSP15 stable target strain obtained in the first part are added (the number of fruit flies can be adjusted appropriately), and raised under suitable conditions. After laying eggs, the parent fruit flies are removed and culture is continued to observe whether the wings of the newly eclosing offspring fruit flies have returned to normal. When the drug can inhibit the nuclease activity of NSP15, or inhibit the downstream signaling pathway caused by the nuclease activity of NSP15, the wings of the newly eclosing offspring fruit flies can be restored to normal. At this time, we screen out effective anti-new coronavirus drugs based on the wing development of the offspring fruit flies.

[0067] Part III: Validation of the nubbin>UAS-NSP15 stable target strain transgenic fruit fly model

[0068] In order to further verify the effectiveness of the above model, we refer to the public literature of Guarino Linda A et al. [1], which was the first to conduct a detailed study on the point mutations of the NSP15 protein of SARS-CoV, and reported the effects of various point mutations of the NSP15 protein on its endonuclease activity. After the 289th lysine (Lys, abbreviated as K) mutated to alanine (Ala, abbreviated as A), the endonuclease activity of the NSP15 protein of SARS-CoV was basically lost. The 289th lysine of NSP15 of SARS-CoV corresponds to the 290th lysine of NSP15 of SARS-CoV-2. Therefore, in order to destroy the endonuclease activity of the NSP15 protein of SARS-CoV-2, we performed a point mutation on it, mutating its 290th lysine base codon to an alanine base codon, and recorded it as NSP15. K290A We synthesized NSP15 K290A Based on the DNA fragment (i.e., SEQ ID NO. 3), we obtained NSP15 according to the method provided in steps (1)-(2) of the first part of the example. K290A Homozygous UAS-NSP15 K290A The first generation of transgenic fruit flies, whose genotype is Then homozygous UAS-NSP15 K290A The first generation of transgenic fruit flies and genotypes are The Gal4 strain was crossed to obtain the genotype The hybrid offspring fruit flies are identified as nubbin>UAS-NSP15 K290A .

[0069] like Figure 5 As shown, nubbin>UAS-NSP15 was placed under a stereo microscope K290A Hybrid offspring of Drosophila and w 1118 Comparison with wild-type fruit flies revealed that nubbin>UAS-NSP15 K290A The wings of the hybrid fruit fly are like w 1118 The morphology is similar to that of wild-type fruit flies, and the wings develop completely normally without any wrinkling.

[0070] The experimental results suggest that the wing defect phenotype in the fruit fly model is related to the endonuclease activity of NSP15. The experimental results also suggest that when the drug fed to the fruit fly model with wing defects can inhibit the endonuclease activity of NSP15, or inhibit the downstream signaling pathway caused by the endonuclease activity of NSP15, the wings can return to normal. This result supports the application of the above-mentioned fruit fly model with wing defects in the screening and evaluation of new crown drugs targeting NSP15.

[0071] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0072] References:

[0073] [1]Guarino Linda A, Bhardwaj Kanchan, Dong Wen et al. Mutational analysis of the SARS virus Nsp15 endoribonuclease: identification of residuesaffecting hexamer formation. [J]. J Mol Biol, 2005, 353: 1106-17.

Claims

1. The use of codon-optimized SARS-CoV-2 NSP15 gene in inducing developmental defects in Drosophila wings, balance bars or third pair of legs, characterized in that: The base sequence of the codon-optimized SARS-CoV-2 NSP15 gene is shown in SEQ ID NO.1.

Images