Soybean GmTFL1b gene and its application in regulating seed size

Abstract

The present invention discloses a soybean GmTFL1b gene and its application in regulating seed size. The soybean seed size regulating GmTFL1b protein has an amino acid sequence as shown in SEQ ID No.2. The present invention transfers the GmTFL1b gene into the cultivated soybean Kariyutaka, and the soybean seeds into which the gene is transferred are significantly smaller than the control Kariyutaka, and the 100-grain weight is significantly reduced. This indicates that the GmTFL1b gene can inhibit seed size. The present invention discloses for the first time the biological function of the soybean GmTFL1b gene in controlling soybean seed size.

Description

Technical field:

[0001] The invention belongs to the field of plant molecular biology, and particularly relates to application of soybean GmTFL1b gene in regulating seed size. Background technology:

[0002] Soybean (Glycine max) is an important grain and oil crop in the world. It is not only an important source of oil nutrients and edible plant protein required by humans and animal husbandry, but also has a good health care effect. This makes soybeans have very important economic value in agriculture, food processing, pharmaceutical and other industries. In agricultural production, the size and weight of soybean seeds are important factors in soybean yield and are important goals of breeding. With the development of the economy and the improvement of living standards, my country's demand for soybeans has increased dramatically in recent years. It has now become the world's largest soybean importer, which has put forward an urgent need to cultivate high-yield and high-quality soybean varieties. Therefore, precise genetic improvement of soybean varieties is of great significance to increasing soybean yield, accelerating the selection and breeding of excellent soybean varieties, and promoting soybean quality.

[0003] In recent years, using genetics and molecular biology methods, researchers have cloned and identified some genes that control soybean seed size and have conducted preliminary verification and regulatory mechanism analysis. For example, the natural variation of GmST05 affects soybean seed size and quality, making it an important gene resource for soybean molecular breeding. There are also sugar transport-related genes such as GmSWEET10a and GmSWEET10b, cytochrome-related genes such as GmCYP78A72 and GmCYP78A5, and GmKIX8-1, PP2C-1, GmWRKY15a and GmFAD3 that have been verified in soybeans to regulate soybean seed size. However, so far, the main effect locus genes that regulate soybean seed size still need to be further explored and analyzed, which is of great significance for promoting people's theoretical understanding of the mechanism of soybean seed development and improving the efficiency of high-yield and high-quality molecular breeding of soybeans. Summary of the invention:

[0004] The purpose of the present invention is to provide a seed size regulating gene GmTFL1b gene isolated from soybean and the use of the protein encoded thereby in increasing soybean seed size to solve the problems existing in the above-mentioned prior art. The gene is a key regulating gene for soybean seed size, and the protein encoded thereby can be used for the cultivation of soybean varieties with different seed sizes.

[0005] The first object of the present invention is to provide a soybean seed size regulating GmTFL1b protein, whose amino acid sequence is shown as SEQ ID No.2.

[0006] The second object of the present invention is to provide a gene encoding the soybean seed size regulating GmTFL1b protein - soybean seed size regulating gene GmTFL1b.

[0007] Preferably, the nucleotide sequence of the soybean seed size regulating gene GmTFL1b is as shown in SEQ ID No.1.

[0008] The third object of the present invention is to provide the application of soybean seed size regulating GmTFL1b protein, soybean seed size regulating gene GmTFL1b or related biological materials in soybean breeding.

[0009] The soybean breeding is an application of regulating the size of soybean seeds. The regulating the size of soybean seeds can be applied to breeding new varieties of soybeans or identifying and screening soybean varieties.

[0010] Furthermore, the soybean seed size is regulated by increasing the expression level and / or activity of the GmTFL1b protein in the soybean to reduce the soybean seeds; or by reducing the expression level and / or activity of the GmTFL1b protein in the soybean to increase the soybean seeds.

[0011] A fourth object of the present invention is to provide a method for changing soybean seed size, comprising the following steps:

[0012] The GmTFL1b gene is transferred into soybean cells, the soybean cells are regenerated into plants, and transgenic homozygous plants are screened to obtain transgenic soybeans with smaller seeds.

[0013] Preferably, the specific steps are:

[0014] a. Transform the GmTFL1b gene into soybean cells;

[0015] b. Regenerating the soybean cells in step a into plants;

[0016] c. Screening for herbicide-resistant and transgenic homozygous plants starting from the T0 generation to obtain transgenic soybeans with smaller seeds.

[0017] The present invention discloses the following technical effects:

[0018] The present invention transfers the GmTFL1b gene into the cultivated soybean Kariyutaka, and the soybean seeds into which the gene is transferred are significantly smaller than the control Kariyutaka, and the 100-grain weight is significantly reduced, indicating that the GmTFL1b gene can inhibit seed size. The present invention first reveals the biological function of the soybean GmTFL1b gene in controlling soybean seed size.

[0019] The invention provides valuable gene resources for crop breeding, and the soybean GmTFL1b gene can be widely used in soybean breeding. Description of the drawings:

[0020] Figure 1 It is the expression vector of the soybean GmTFL1b gene of the present invention.

[0021] Figure 2 The expression of GmTFL1b gene in the leaves of the control plant Kariyutaka and the T2 generation plants (GmTFL1b#1 and GmTFL1b#2) after the GmTFL1b gene was transferred.

[0022] Figure 3 This is the size phenotype of the control plant Kariyutaka and the T2 generation seeds (GmTFL1b#1, GmTFL1b#2) after the GmTFL1b gene was introduced. The scale bar is 5 mm.

[0023] Figure 4 The bar graphs are for the 100-grain weight of the control plant Kariyutaka and the T2 seeds (GmTFL1b#1, GmTFL1b#2) after the GmTFL1b gene was introduced. The error represents the standard error (n=10). One-tailed T test was used for significant difference analysis. Specific implementation method:

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents.

[0026] The methods used in the following examples are conventional methods unless otherwise specified, and the primer synthesis and sequencing can be completed independently or entrusted to a third-party genetic company.

[0027] The nucleotide sequence of the soybean seed size regulating gene GmTFL1b in this embodiment is shown in SEQ ID No.1.

[0028] The nuclear amino acid sequence of the protein encoded by the soybean seed size regulating gene GmTFL1b in this embodiment is shown in SEQ ID No.2.

[0029] The soybean seed size regulating gene GmTFL1b of this embodiment is used for increasing or decreasing 100-grain weight.

[0030] Plant material: The soybean variety used for the test was Kariyutaka.

[0031] Example 1: Isolation and structural analysis of GmTFL1b gene

[0032] 1. Gene separation

[0033] mRNA was extracted from the seeds of soybean variety Williams82 and used as template to synthesize the first strand of cDNA with Oligo(T)17 as primer. Then, PCR amplification was performed with primers TFL1b-F: TAGCTAATCTAATTAGTATTGC and TFL1b-R: GCCTACCAAACCTCTTATTTCT using this strand as template. The reaction system was 40 μl and consisted of the following components:

[0034]

[0035]

[0036] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 40 sec, 40 cycles, and extension reaction at 72°C for 5 min.

[0037] The target band was recovered by electrophoresis gel cutting and connected to the pMD18-T vector (TaKaRa). E. coli Top10 competent cells were transformed, and single clones were picked and shaken after plating, and plasmids were extracted. After enzyme digestion verification, sequencing was performed. The sequencing results showed that the cDNA fragment of the GmTFL1b gene was 1026 bp long, of which the CDS coding region was 522 bp in size. The nucleotide sequence was shown in SEQ ID No. 1, and the sequence encoding 172 amino acids was shown in SEQ ID No. 2.

[0038] 2. Structural analysis of genes

[0039] Using young leaves of soybean variety Williams82 as material, genomic DNA was extracted and used as a template to perform PCR amplification using the above TFL1b-F and TFL1b-R primers to obtain a fragment of the GmTFL1b genome and clone it into the pMD18-T vector. The nucleotide sequence of the GmTFL1b gene is shown in SEQ ID No. 3, a total of 1633 bp, which contains 3 introns and 4 exons.

[0040] Example 2: Construction of GmTFL1b positive expression vector

[0041] Using the genomic DNA of young leaves of soybean variety Williams82 as a template, the recombination primer pro-F of the promoter: CTGCAGGCATGCAAGCTT AAGTTGGTTCACAAGGAGAG and pro-R: CGTCCTAGGCTTAAGTCTAGA TGTAAGAGGAGGAACAAGGAAGAG. Amplify the 3 kb promoter using the following 40 μl PCR system:

[0042] PCR Mix (GenStar cat#A012-101) 20μL Template 0.01 μg / μl cDNA 2μL Primer pro-F 1.5μL Primer pro-R 1.5μL <![CDATA[ddH2O]]> 15μL

[0043] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 3 min, 40 cycles, and extension reaction at 72°C for 5 min.

[0044] The genomic fragment of GmTFL1b (3 kb promoter, exons, introns and UTR regions) was constructed together into the vector pTF101.1 (BioVector, 0134768). The vector map is shown in Figure 1 As shown. First, after the vector is double-digested with Hind III and Xbal I, the promoter fragment of the gene is amplified with the previous pro-F and pro-R primers, and then inserted into the vector by recombination using ClonExpressUltra One Step Cloning Kit (Vazyme, C115-01). The enzyme digestion reaction system is as follows:

[0045] Buffer(Thermo Fisher) 5μL Template pTF101.1 250ng / μl 10μL FastDigest XbaI (Thermo Fisher, FD0685) 1.5μL FastDigest Hind III (Thermo Fisher, FD0504) 1.5μL <![CDATA[ddH2O]]> 32μL

[0046] Then, the vector constructed in the previous step was double-digested with Mlu I (Thermo Fisher, FD0685) and Smal I (Thermo Fisher, FD0663) using the same reaction system, and the same homologous recombination method was used with primers 1b-F: AGACTTAAGCCTAGGACGCGT ATGGCAAAAATGCCTTTAGAGC and Primer 1b-R: GGGAAATTCGAGCTC CCCGGG After amplifying the 1633 bp gene fragment of GmTFL1b by GCCTACCAAACCTCTTATTTC, the fragment was inserted into the vector after restriction digestion. The resistance of the vector in Escherichia coli is spectinomycin resistance, and glufosinate-ammonium is used for screening in plants.

[0047] Example 3: Agrobacterium-mediated transformation of soybean

[0048] 1. Obtaining soybean explants

[0049] Select Kariyutaka mature soybean seeds with smooth surface, no cracks, no disease spots, and no mold, and sterilize them with chlorine for 10-14 hours. Soak the sterilized seeds in sterile water and keep them in the dark for 16 hours. After germination, cut the two cotyledons along the midline axis on the clean bench, remove the two original leaf buds, and form a wound about 3 mm long at the junction of the cotyledon and the hypocotyl.

[0050] 2. Genetic transformation of soybean cotyledon

[0051] The vector containing GmTFL1b was introduced into soybean callus tissue by genetic transformation mediated by Agrobacterium EHA101 strain to obtain plants transformed from the callus tissue.

[0052] 3. Screening of heritable transgenic plants

[0053] The positive transgenic plants of the T0 generation were screened with glufosinate (160 mg / L), and the genome was identified by PCR, and then the pure transgenic plants of the T1 generation were propagated. The mRNA of the leaves of the pure transgenic plants of the T2 generation was extracted, reverse transcribed into cDNA, and then subjected to fluorescence quantitative PCR. The primers used were QF: ATATGAGGTCCTTCTTTACACTGATC and QR: TTCCAATATTAGGCTTTGGGACCT. The expression of the GmTFL1b gene was significantly higher than that of the control plant Kariyutaka. The results are as follows Figure 2 The seeds of the homozygous plants were observed and photographed for seed size phenotype. The results are shown in Figure 3 As shown, the weight of 100 grains was measured using an analytical balance, and the result was as follows Figure 4 shown.

[0054] In summary, the soybean GmTFL1b gene can participate in the regulation of soybean seed size and 100-grain weight. The size and 100-grain weight of soybean seeds can be changed through genetic modification, thereby achieving the purpose of changing the 100-grain weight and yield of soybean seeds.

[0055] CDS sequence of soybean seed size regulating gene GmTFL1b (SEQ ID NO.1)

[0056] ATGGCAAAAA TGCCTTTAGA GCCTCTAATA GTGGGGAGAG TCATAGGAGA 50

[0057] AGTTCTTGAT TCTTTCACCA CAAGCACAAA AATGACTGTG AGTTACAACA 100

[0058] AGAAGCAAGT TTACAATGGC CATGAGCTCT TCCCTTCCAC TGTCAACACC 150

[0059] AAGCCCAAGG TTGAGATTGA GGGTGGTGAT ATGAGGTCCT TCTTTACACT 200

[0060] GATCATGACT GACCCTGATG TTCCTGGCCC TAGTGACCCT TATCTGAGAG 250

[0061] AGCACTTGCA CTGGATAGTG ACAGATATTC CAGGCACAAC AGATGCCACA 300

[0062] TTTGGGAAAG AGTTGGTGAG CTATGAGGTC CCAAAGCCTA ATATTGGAAT 350

[0063] CCATAGGTTT GTGTTTGTCC TGTTCAAGCA AAAGCGTAGA CAGTGTGTTA 400

[0064] CTCCACCCAC TTCAAGGGAC CACTTCAACA CACGCAAATT CGCAGCAGAG 450

[0065] AACGACCTTG GCCTCCCTGT GGCTGCTGTC TACTTCAATG CACAGAGGGA 500

[0066] AACGGCTGCA AGAAGACGCTAG 522

[0067] Soybean seed size regulatory gene GmTFL1b encoded protein (SEQ ID NO.2)

[0068] MAKMP LEPLI VGRVI GEVLD SFTTS TKMTV SYNKK QVYNG HELFP STVNT 50

[0069] KPKVE IEGGD MRSFF TLIMT DPDVP GPSDP YLREH LHWIV TDIPG TTDAT 100

[0070] FGKEL VSYEV PKPNI GIHRF VFVLF KQKRR QCVTP PTSRD HFNTR KFAAE 150NDLGLPVAAV YFNAQ RETAA RR 172

[0071] Genomic nucleotide sequence of soybean seed size regulating gene GmTFL1b (SEQ ID NO.3)

[0072]

[0073]

[0074]

[0075] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims in the present invention group.

Claims

1. Application of GmTFL1b protein or its encoding gene in inhibiting the seed size and reducing the 100-grain weight of soybean Kariyutaka, wherein the amino acid sequence of the GmTFL1b protein is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown as SEQ ID No.

1.

3. The use according to claim 1, characterized in that: The application of inhibiting the seed size of soybean Kariyutaka is to breed new soybean varieties or identify and screen soybean varieties.

4. The use according to claim 1, characterized in that: The application is to reduce the seed size and 100-grain weight of soybeans by increasing the expression amount and / or activity of the GmTFL1b protein in the soybeans.

5. A method for changing soybean seed size, characterized in that: The following steps are involved: Will GmTFL1b The gene is transferred into the cultivated soybean Kariyutaka cells, and the soybean cells are regenerated into plants. The soybean GmTFL1b gene inhibits the seed size of soybeans and reduces the 100-grain weight. GmTFL1b The gene encodes an amino acid sequence as shown in SEQ ID NO.

2.

6. The method according to claim 5, characterized in that The GmTFL1b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that The specific steps are: a. GmTFL1b The gene is transferred into soybean cells; b. The soybean cells in step a are regenerated into plants; c. Screening herbicide-resistant and transgenic homozygous plants from the T0 generation to obtain transgenic soybeans with smaller seeds.

Images