Nanobodies targeting CD7 and related products and medical uses thereof

Abstract

The present invention discloses a nano antibody targeting CD7 and related products and medical uses thereof. The related products include a humanized anti-CD7 nano antibody, a chimeric antigen receptor based on a single nano antibody, a chimeric antigen receptor based on a double nano antibody, a recombinant expression vector, an engineered host cell, a conjugate, a pharmaceutical composition, a kit, and a reagent for detecting CD7 on the surface of a cell. The nano antibody has a good affinity for CD7, and the CAR-T cells prepared based on the nano antibody have a strong ability to target and recognize tumor antigens and a high killing activity against tumor cells, and have important clinical application value.

Description

[0001] This application is a divisional application of a patent with an application date of March 30, 2022, application number 202210331478.7, and invention name “Anti-CD7 nanoantibodies, derivatives and their applications in tumor treatment”. Technical Field

[0002] The present invention belongs to the field of biomedicine technology, and specifically, the present invention relates to nano antibodies targeting CD7 and related products and medical uses thereof. Background Art

[0003] The CD7 antigen is a single-chain glycoprotein and a signature antigen molecule in the development of T cells. In addition to healthy human thymocytes, T cells and natural killer cells, hematopoietic stem and progenitor cells such as lymphoid and myeloid precursor cells also express CD7. A large number of studies have shown that CD7 molecules are expressed on most human T-lymphocytic leukemias and lymphomas (Karube K, Ohshima K, Tsuchiya T, et al. Non-B, non-T neoplasms with lymphoblast morphology: further clarification and classification [J]. The American journal of surgical pathology, 2003, 27 (10): 1366-1374.; Shiyong Li, Jonathan Juco, Karen P. Mann, et al. Flow Cytometry in the Differential Diagnosis of Lymphocyte-Rich Thymoma From Precursor T-Cell Acute Lymphoblastic Leukemia / Lymphoblastic Lymphoma [J]., American Journal of Clinical Pathology, 2004, 121: 268-274.) and about 10% of acute myeloid leukemia (Acute myeloid leukemia, AML) express CD7 antigen (Foon KA, Todd RF. Immunologic classification of In addition, when CD7 molecules bind to their corresponding antibodies, they will quickly undergo endocytosis. This characteristic makes CD7 a suitable antigen receptor for targeted delivery of various functional molecules to CD7-positive cells. Related studies have also shown that there is a group of CD7-negative T lymphocytes in the human body. This group of cells can maintain the normal immune function of the human body and avoid the loss of immune function caused by the use of CD7 nano-antibody-related immune cells to eliminate all CD7-positive cells. It can be seen that targeting CD7 is a very promising anti-tumor direction.

[0004] Chimeric antigen receptor modified T cells (CAR-T) and chimeric antigen receptor modified NK cells (CAR-NK) immunotherapy are the two most rapidly developing tumor cell immunotherapies. The effective activation of CAR-T / CAR-NK cells depends heavily on the specificity of antibodies that recognize tumor-associated antigens and the affinity of antigen binding. Therefore, under the current situation where the design of the intracellular signal transduction region of CAR-T / CAR-NK cells has become mature, the design of the antigen binding region has become the focus and key to the development of new CAR-T technology. There is a heavy chain antibody (HCAb) that naturally lacks light chains in camelids (camels, alpacas) or sharks. The antibody only contains one heavy chain variable region and two conventional CH2 and CH3 regions. Its heavy chain variable region has stability and antigen binding activity comparable to that of heavy chain antibodies. Its size is only 2.4×4nm, which is the smallest fragment that can bind to antigens. It is called a single domain antibody (VHH) or nanobody. Compared with traditional antibodies, VHH single domain antibodies have small molecular weight and high expression, good chemical stability, high affinity, high homology with human antibodies, and low immunogenicity. The small molecular weight makes it easy to carry out genetic engineering modification to construct a combination of dual or multi-specific single domain antibodies to achieve the effect of multiple targets or multiple functions in one molecule. VHH has good tissue permeability and has the possibility of contacting more hidden targets that cannot be contacted by conventional antibodies during tumor treatment. Because of these advantages, the use of single domain antibodies as the antigen binding region of CAR for CAR modification and CAR-T / CAR-NK cell therapy can provide a new tumor treatment strategy for this field. Summary of the invention

[0005] In view of this, the object of the present invention is to provide the art with nanobodies targeting CD7 and related products and medical uses thereof.

[0006] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0007] A first aspect of the present invention provides an anti-CD7 Nanobody.

[0008] Further, the nanobody is at least one of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 or VHH20;

[0009] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH01 are shown in SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, respectively;

[0010] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH03 are shown in SEQ ID NO: 11, SEQ ID NO: 13, and SEQ ID NO: 15, respectively;

[0011] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH04 are shown as SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 23, respectively;

[0012] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH06 are shown in SEQ ID NO: 27, SEQ ID NO: 29, and SEQ ID NO: 31, respectively;

[0013] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH07 are shown as SEQ ID NO:35, SEQ ID NO:37, and SEQ ID NO:39, respectively;

[0014] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH08 are shown as SEQ ID NO:43, SEQ ID NO:45, and SEQ ID NO:47, respectively;

[0015] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH09 are shown as SEQ ID NO:51, SEQ ID NO:53, and SEQ ID NO:55, respectively;

[0016] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH10 are shown as SEQ ID NO:59, SEQ ID NO:61, and SEQ ID NO:63, respectively;

[0017] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH12 are shown in SEQ ID NO: 67, SEQ ID NO: 69, and SEQ ID NO: 71, respectively;

[0018] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH13 are shown in SEQ ID NO: 75, SEQ ID NO: 77, and SEQ ID NO: 79, respectively;

[0019] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH14 are shown in SEQ ID NO:83, SEQ ID NO:85, and SEQ ID NO:87, respectively;

[0020] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH15 are shown in SEQ ID NO:91, SEQ ID NO:93, and SEQ ID NO:95, respectively;

[0021] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH16 are shown in SEQ ID NO:99, SEQ ID NO:101, and SEQ ID NO:103, respectively;

[0022] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH17 are shown in SEQ ID NO: 107, SEQ ID NO: 109, and SEQ ID NO: 111, respectively;

[0023] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH18 are shown as SEQ ID NO: 115, SEQ ID NO: 117, and SEQ ID NO: 119, respectively;

[0024] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH19 are shown in SEQ ID NO: 123, SEQ ID NO: 125, and SEQ ID NO: 127, respectively;

[0025] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH20 are shown as SEQ ID NO: 131, SEQ ID NO: 133, and SEQ ID NO: 135, respectively;

[0026] The amino acid sequences of CDR1, CDR2 and CDR3 of the nanoantibodies VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 or VHH20 of the present invention further include The amino acid sequences corresponding to Nanobody CDR1, CDR2, and CDR3 have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity.

[0027] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH01 are shown as SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, respectively;

[0028] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH03 are shown as SEQ ID NO: 12, SEQ ID NO: 14, and SEQ ID NO: 16, respectively;

[0029] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH04 are shown as SEQ ID NO: 20, SEQ ID NO: 22, and SEQ ID NO: 24, respectively;

[0030] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH06 are shown as SEQ ID NO:28, SEQ ID NO:30, and SEQ ID NO:32, respectively;

[0031] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH07 are shown as SEQ ID NO:36, SEQ ID NO:38, and SEQ ID NO:40, respectively;

[0032] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH08 are shown as SEQ ID NO:44, SEQ ID NO:46, and SEQ ID NO:48, respectively;

[0033] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH09 are shown as SEQ ID NO:52, SEQ ID NO:54, and SEQ ID NO:56, respectively;

[0034] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH10 are shown as SEQ ID NO:60, SEQ ID NO:62, and SEQ ID NO:64, respectively;

[0035] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH12 are shown in SEQ ID NO:68, SEQ ID NO:70, and SEQ ID NO:72, respectively;

[0036] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH13 are shown in SEQ ID NO:76, SEQ ID NO:78, and SEQ ID NO:80, respectively;

[0037] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH14 are shown in SEQ ID NO:84, SEQ ID NO:86, and SEQ ID NO:88, respectively;

[0038] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH15 are shown in SEQ ID NO:92, SEQ ID NO:94, and SEQ ID NO:96, respectively;

[0039] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH16 are shown as SEQ ID NO: 100, SEQ ID NO: 102, and SEQ ID NO: 104, respectively;

[0040] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH17 are shown as SEQ ID NO: 108, SEQ ID NO: 110, and SEQ ID NO: 112, respectively;

[0041] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH18 are shown as SEQ ID NO: 116, SEQ ID NO: 118, and SEQ ID NO: 120, respectively;

[0042] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH19 are shown as SEQ ID NO: 124, SEQ ID NO: 126, and SEQ ID NO: 128, respectively;

[0043] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH20 are shown as SEQ ID NO: 132, SEQ ID NO: 134, and SEQ ID NO: 136, respectively;

[0044] The nucleotide sequences of CDR1, CDR2 and CDR3 of the nanoantibodies VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 or VHH20 of the present invention further include The nucleotide sequences corresponding to Nanobody CDR1, CDR2, and CDR3 have nucleotide sequences that are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identical.

[0045] Most preferably, the amino acid sequences of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19, and VHH20 are shown in SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 41, SEQ ID NO: 49, SEQ ID NO: 57, SEQ ID NO: 65, SEQ ID NO: 73, SEQ ID NO: 81, SEQ ID NO: 89, SEQ ID NO: 97, SEQ ID NO: 105, SEQ ID NO: 113, SEQ ID NO: 121, and SEQ ID NO: 129, respectively, or are the same as SEQ ID NO: 1, SEQ ID NO: 9 : SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:25, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:49, SEQ ID NO:57, SEQ ID NO:65, SEQ ID NO:73, SEQ ID NO:81, SEQ ID NO:89, SEQ ID NO:97, SEQ ID NO:105, SEQ ID NO:113, SEQ ID NO:121, SEQ ID NO:129 having an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical;

[0046] Most preferably, the nucleotide sequences of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19, and VHH20 are respectively as shown in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122, and SEQ ID NO:130, or are respectively as shown in SEQ ID NO:2, SEQ ID NO:1 NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122, SEQ ID NO:130 have nucleotide sequences that are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.

[0047] Furthermore, Nanobodies obtained by any combination of the amino acid sequences or nucleotide sequences of CDR1, CDR2, and CDR3 of one or more of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19, or VHH20 are also within the scope of protection of the present invention.

[0048] Furthermore, CD7 is a very stable marker on the surface of T cells. Both immature T cells and mature T cells express CD7. Therefore, both patients with immature T cell tumors (T-ALL / LBL / NKT cell leukemia) and patients with mature T cell tumors (peripheral T cell lymphoma, NKT cell lymphoma, anaplastic large cell lymphoma) basically highly express CD7. Therefore, CAR-T treatment of T-lineage blood tumors targeting this target is one of the fastest-growing technologies in clinical practice.

[0049] A second aspect of the present invention provides a humanized anti-CD7 Nanobody.

[0050] Furthermore, the humanized anti-CD7 nanobody is obtained by humanizing the residues at key positions of the nanobody by using the universal humanized framework h-NbBcII10FGLA as a reference and by comparing it with DP-47;

[0051] Preferably, the humanized anti-CD7 Nanobody is at least one of hVHH01, hVHH03, hVHH04, hVHH06, hVHH07, hVHH08, hVHH09, hVHH10, hVHH12, hVHH13, hVHH14, hVHH15, hVHH16, hVHH17, hVHH18, hVHH19 or hVHH20;

[0052] More preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of said hVHH06 are as shown in SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, or amino acid sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, respectively; most preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of said hVHH06 are as shown in SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, or amino acid sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, respectively. nucleotide sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144;

[0053] Most preferably, the amino acid sequence of hVHH06 is as shown in SEQ ID NO: 137 or an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 137; most preferably, the nucleotide sequence of hVHH06 is as shown in SEQ ID NO: 138 or an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 138. NO:138 has a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.

[0054] The third aspect of the present invention provides a chimeric antigen receptor based on a single nanobody.

[0055] Further, the chimeric antigen receptor comprises any one of the Nanobodies described in the first aspect of the invention or the Nanobodies described in the second aspect of the invention;

[0056] Preferably, the chimeric antigen receptor further comprises a transmembrane domain;

[0057] Preferably, the chimeric antigen receptor further comprises an intracellular signaling domain;

[0058] Preferably, the chimeric antigen receptor further comprises a hinge region;

[0059] Preferably, the chimeric antigen receptor further comprises a signal peptide;

[0060] Preferably, the chimeric antigen receptor further comprises a co-stimulatory signaling domain;

[0061] Preferably, the chimeric antigen receptor further comprises a promoter EF1α, a self-cleaving peptide T2A, and a detection tag / auxiliary functional element tEGFR;

[0062] Preferably, the chimeric antigen receptor further comprises a tEGFR signal peptide;

[0063] More preferably, the transmembrane domain includes the transmembrane domains of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor;

[0064] More preferably, the intracellular signaling domain includes the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d;

[0065] More preferably, the hinge region includes the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor;

[0066] More preferably, the signal peptides include signal peptides of the following molecules: α chain and β chain of T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, GM-CSF;

[0067] More preferably, the costimulatory signaling domain includes the costimulatory signaling domains of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226;

[0068] More preferably, the promoter is not limited to the EF1α promoter, but also includes: CMV promoter, EFS promoter, CAG promoter, CBh promoter, SFFV promoter, MSCV promoter, SV40 promoter, mPGK promoter, hPGK promoter, UBC promoter;

[0069] More preferably, the self-cleaving peptide is not limited to T2A, but also includes: P2A, E2A, F2A;

[0070] More preferably, the detection label / auxiliary function element is not limited to tEGFR, and also includes: tCD34, tCD19, tCD20, tCD22, immune checkpoint inhibitors (CTLA-4, PD-1 / PD-L1, LAG-3, TIM-3, TIGIT, CD226, CD155, CD47, B7-H3, B7-H4) nanoantibodies, cytokines and their receptors (IL2, IL2 receptor, IL7, IL7 receptor, IL15, IL15 receptor);

[0071] Most preferably, the transmembrane domain is a CD8α transmembrane domain;

[0072] Most preferably, the intracellular signaling domain is a CD3ζ intracellular signaling domain;

[0073] Most preferably, the hinge region is the CD8α hinge region;

[0074] Most preferably, the costimulatory signaling domain is a 4-1BB costimulatory signaling domain;

[0075] Most preferably, the signal peptide has an amino acid sequence as shown in SEQ ID NO: 145 or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 145;

[0076] Most preferably, the nucleotide sequence of the signal peptide is as shown in SEQ ID NO:146 or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:146;

[0077] Most preferably, the amino acid sequence of the CD8α hinge region is as shown in SEQ ID NO: 147 or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 147;

[0078] Most preferably, the nucleotide sequence of the CD8α hinge region is as shown in SEQ ID NO: 148 or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 148;

[0079] Most preferably, the amino acid sequence of the CD8α transmembrane domain is as shown in SEQ ID NO: 149 or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 149;

[0080] Most preferably, the nucleotide sequence of the CD8α transmembrane domain is as shown in SEQ ID NO: 150 or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 150;

[0081] Most preferably, the amino acid sequence of the 4-1BB costimulatory signaling domain is as shown in SEQ ID NO: 151 or an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 151;

[0082] Most preferably, the nucleotide sequence of the 4-1BB costimulatory signaling domain is as shown in SEQ ID NO: 152 or a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity with SEQ ID NO: 152;

[0083] Most preferably, the amino acid sequence of the CD3 zeta intracellular signaling domain is as shown in SEQ ID NO: 153, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 153;

[0084] Most preferably, the nucleotide sequence of the CD3 zeta intracellular signaling domain is as shown in SEQ ID NO: 154 or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 154;

[0085] Most preferably, the amino acid sequence of T2A is as shown in SEQ ID NO:155, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:155;

[0086] Most preferably, the nucleotide sequence of T2A is as shown in SEQ ID NO: 156 or a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 156;

[0087] Most preferably, the nucleotide sequence of EF1α is as shown in SEQ ID NO:157 or a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO:157;

[0088] Most preferably, the amino acid sequence of the tEGFR signal peptide is as shown in SEQ ID NO:158 or an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO:158;

[0089] Most preferably, the nucleotide sequence of the tEGFR signal peptide is as shown in SEQ ID NO: 159 or a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 159;

[0090] Most preferably, the tEGFR has an amino acid sequence as shown in SEQ ID NO: 160, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 160;

[0091] Most preferably, the nucleotide sequence of tEGFR is as shown in SEQ ID NO: 161 or a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 161;

[0092] Most preferably, the chimeric antigen receptor is EF1α, a signal peptide, any one of the Nanobodies described in the first aspect of the invention or the Nanobodies described in the second aspect of the invention, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide, and tEGFR connected in series.

[0093] A fourth aspect of the present invention provides a chimeric antigen receptor based on a double nanobody.

[0094] Further, the chimeric antigen receptor comprises any two of the Nanobodies described in the first aspect of the invention or the Nanobodies described in the second aspect of the invention;

[0095] Preferably, the chimeric antigen receptor further comprises a transmembrane domain;

[0096] Preferably, the chimeric antigen receptor further comprises an intracellular signaling domain;

[0097] Preferably, the chimeric antigen receptor further comprises a hinge region;

[0098] Preferably, the chimeric antigen receptor further comprises a signal peptide;

[0099] Preferably, the chimeric antigen receptor further comprises a co-stimulatory signaling domain;

[0100] Preferably, the chimeric antigen receptor further comprises a promoter EF1α, a self-cleaving peptide T2A, and a detection tag / auxiliary functional element tEGFR;

[0101] Preferably, the chimeric antigen receptor further comprises a tEGFR signal peptide;

[0102] More preferably, the transmembrane domain includes the transmembrane domains of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor;

[0103] More preferably, the intracellular signaling domain includes the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d;

[0104] More preferably, the hinge region includes the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor;

[0105] More preferably, the signal peptides include signal peptides of the following molecules: α chain and β chain of T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, GM-CSF;

[0106] More preferably, the costimulatory signaling domain includes the costimulatory signaling domains of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226;

[0107] More preferably, the promoter is not limited to the EF1α promoter, but also includes: CMV promoter, EFS promoter, CAG promoter, CBh promoter, SFFV promoter, MSCV promoter, SV40 promoter, mPGK promoter, hPGK promoter, UBC promoter;

[0108] More preferably, the self-cleaving peptide is not limited to T2A, but also includes: P2A, E2A, F2A;

[0109] More preferably, the detection label / auxiliary function element is not limited to tEGFR, and also includes: tCD34, tCD19, tCD20, tCD22, immune checkpoint inhibitors (CTLA-4, PD-1 / PD-L1, LAG-3, TIM-3, TIGIT, CD226, CD155, CD47, B7-H3, B7-H4) nanoantibodies, cytokines and their receptors (IL2, IL2 receptor, IL7, IL7 receptor, IL15, IL15 receptor);

[0110] Most preferably, the transmembrane domain is a CD8α transmembrane domain;

[0111] Most preferably, the intracellular signaling domain is a CD3ζ intracellular signaling domain;

[0112] Most preferably, the hinge region is the CD8α hinge region;

[0113] Most preferably, the costimulatory signaling domain is a 4-1BB costimulatory signaling domain;

[0114] Most preferably, any two of the Nanobodies described in the first aspect of the invention or the Nanobodies described in the second aspect of the invention are connected via a connecting peptide Linker;

[0115] Most preferably, the chimeric antigen receptor is EF1α, a signal peptide, any two of the Nanobody described in the first aspect of the invention or the Nanobody described in the second aspect of the invention, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide, and tEGFR connected in series;

[0116] Most preferably, the chimeric antigen receptor is EF1α, a signal peptide, any one of the Nanoantibodies described in the first aspect of the invention or the Nanoantibodies described in the second aspect of the invention, a Linker, any one of the Nanoantibodies described in the first aspect of the invention or the Nanoantibodies described in the second aspect of the invention, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide, and tEGFR connected in series;

[0117] Most preferably, the chimeric antigen receptor is EF1α, signal peptide, VHH06 described in the first aspect of the present invention, Linker, VHH03 described in the first aspect of the present invention, CD8α hinge region, CD8α transmembrane domain, 4-1BB co-stimulatory signal domain, CD3ζ intracellular signaling domain, T2A, tEGFR signal peptide, and tEGFR connected in series in sequence.

[0118] Most preferably, the signal peptide, CD8α hinge region, CD8α transmembrane domain, 4-1BB co-stimulatory signal domain, CD3ζ intracellular signaling domain, T2A, EF1α, tEGFR signal peptide, amino acid sequence and nucleotide sequence of tEGFR are as described above.

[0119] A fifth aspect of the present invention provides a nucleic acid molecule.

[0120] Further, the nucleic acid molecule comprises a nucleotide sequence encoding the Nanobody described in the first aspect of the invention, the Nanobody described in the second aspect of the invention, the Chimeric Antigen Receptor described in the third aspect of the invention, or the Chimeric Antigen Receptor described in the fourth aspect of the invention;

[0121] Preferably, the nucleotide sequence is as shown in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122, SEQ ID NO:130, or a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity thereto.

[0122] The sixth aspect of the present invention provides a recombinant expression vector.

[0123] Furthermore, the recombinant expression vector comprises the nucleic acid molecule described in the fifth aspect of the present invention;

[0124] Preferably, the expression vector comprises a DNA vector, an RNA vector, a plasmid, a transposon vector, a CRISPR / Cas9 vector, or a viral vector; more preferably, the viral vector comprises a lentiviral vector, an adenoviral vector, or a retroviral vector.

[0125] A seventh aspect of the invention provides an engineered host cell.

[0126] Further, the engineered host cell expresses the Nanobody described in the first aspect of the invention, the Nanobody described in the second aspect of the invention, the Chimeric Antigen Receptor described in the third aspect of the invention, or the Chimeric Antigen Receptor described in the fourth aspect of the invention;

[0127] Preferably, the engineered host cell comprises the recombinant expression vector described in the sixth aspect of the present invention;

[0128] Preferably, the engineered host cells comprise engineered immune cells; more preferably, the engineered immune cells comprise T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, NKT cells.

[0129] The eighth aspect of the present invention provides a conjugate or a pharmaceutical composition or a kit or a reagent for detecting CD7 protein or an antigenic fragment thereof.

[0130] Further, the conjugate comprises the Nanobody described in the first aspect of the invention or the Nanobody described in the second aspect of the invention, and a modified portion connected to the Nanobody, wherein the modified portion comprises a detectable label, a therapeutic agent;

[0131] Preferably, the detectable label comprises an enzyme, a radionuclide, a fluorescent dye, a luminescent substance, or biotin.

[0132] Preferably, the therapeutic agent includes a drug or cytotoxic agent having anti-tumor activity; more preferably, the drug having anti-tumor activity includes a chemotherapeutic drug, an anti-tumor angiogenesis drug, and an immune checkpoint inhibitor; most preferably, the chemotherapeutic drug includes a taxane chemotherapeutic drug, a vinca alkaloid chemotherapeutic drug, a metal platinum chemotherapeutic drug, an anthracycline chemotherapeutic drug, an antifolate chemotherapeutic drug, a nitrogen mustard chemotherapeutic drug, and a podophyllotoxin alkaloid chemotherapeutic drug; most preferably, the taxane chemotherapeutic drug includes paclitaxel, liposome paclitaxel, albumin-bound paclitaxel, polysaccharide Most preferably, the vinca alkaloid chemotherapy drugs include vincristine, vindesine, and vinblastine; Most preferably, the metal platinum chemotherapy drugs include cisplatin, carboplatin, oxaliplatin, nedaplatin, and lobaplatin; Most preferably, the anthracycline chemotherapy drugs include epirubicin, pirarubicin, doxorubicin, and epirubicin; Most preferably, the antifolate chemotherapy drugs include methotrexate and pemetrexed disodium; Most preferably, the nitrogen mustard chemotherapy drugs include cyclophosphamide and bendamustine; Most preferably, the podophyllotoxin alkaloid chemotherapy drugs include etoposide , teniposide; most preferably, the anti-tumor angiogenesis drugs include small molecule multi-target angiogenesis inhibitors, large molecule single-target angiogenesis inhibitors, and endogenous pan-target angiogenesis inhibitors; most preferably, the small molecule multi-target angiogenesis inhibitors include sorafenib, sunitinib, pazopanib, vandetanib, cabozantinib, regorafenib, axitinib, nintedanib, lenvatinib, apatinib, anlotinib, fruquintinib, erdafitinib; most preferably, the large molecule single-target angiogenesis inhibitors include bevacizumab, ramucirumab , aflibercept; most preferably, the endogenous pan-target angiogenesis inhibitor includes endostatin; most preferably, the immune checkpoint inhibitors include ipilimumab, pembrolizumab, nivolumab, atezolizumab, durvalumab, avelumab, sintilimab; more preferably, the cytotoxic agents include alkaloid cytotoxic agents and antibiotic cytotoxic agents; most preferably, the alkaloid cytotoxic agents include scopolamine hydrobromide and homoharringtonine; most preferably, the antibiotic cytotoxic agents include idarubicin and doxorubicin hydrochloride.

[0133] Preferably, the pharmaceutical composition or kit comprises the Nanobody of the first aspect of the invention, the Nanobody of the second aspect of the invention, the Chimeric Antigen Receptor of the third aspect of the invention, the Chimeric Antigen Receptor of the fourth aspect of the invention, the nucleic acid molecule of the fifth aspect of the invention, the recombinant expression vector of the sixth aspect of the invention, the engineered host cell of the seventh aspect of the invention, or the conjugate;

[0134] Preferably, the reagent for detecting CD7 protein or an antigenic fragment thereof comprises the Nanobody described in the first aspect of the invention, the Nanobody described in the second aspect of the invention, or the conjugate.

[0135] Furthermore, the pharmaceutical composition further comprises another pharmaceutically active agent; preferably, the other pharmaceutically active agent comprises another antibody, fusion protein or drug (such as an anti-tumor drug, such as a drug for radiotherapy or a chemotherapy drug).

[0136] Furthermore, the pharmaceutical composition also contains a pharmaceutically acceptable carrier and / or excipient.

[0137] A ninth aspect of the present invention provides any of the following methods:

[0138] (1) A method for detecting CD7 protein or an antigenic fragment thereof for non-diagnostic purposes, the method comprising the following steps:

[0139] ① Obtaining a sample containing CD7 protein or its antigen fragment;

[0140] ② contacting the sample collected in step ① with the Nanobody described in the first aspect of the invention, the Nanobody described in the second aspect of the invention, or the conjugate described in the eighth aspect of the invention;

[0141] ③Detect the presence of antibody-antigen complex;

[0142] (2) A method for preparing the engineered host cell according to the seventh aspect of the present invention, the method comprising the following steps: introducing the recombinant expression vector according to the sixth aspect of the present invention into the host cell;

[0143] Preferably, the introduction method comprises lipofection, microinjection, electroporation, DNA vector, RNA vector, retroviral vector, lentiviral vector, poxvirus vector, herpes simplex virus vector, adenovirus vector, adeno-associated virus vector.

[0144] The tenth aspect of the present invention provides the application of any of the following aspects:

[0145] (1) Use of the Nanobody described in the first aspect of the invention or the Nanobody described in the second aspect of the invention in detecting CD7 protein or an antigenic fragment thereof;

[0146] (2) Use of the Nanobody described in the first aspect of the invention or the Nanobody described in the second aspect of the invention in the preparation of a reagent or kit for detecting CD7 protein or an antigenic fragment thereof;

[0147] (3) Use of the Nanobody of the first aspect of the invention, the Nanobody of the second aspect of the invention, the chimeric antigen receptor of the third aspect of the invention, the chimeric antigen receptor of the fourth aspect of the invention, the nucleic acid molecule of the fifth aspect of the invention, the recombinant expression vector of the sixth aspect of the invention, or the engineered host cell of the seventh aspect of the invention in the preparation of an anti-tumor drug;

[0148] (4) Use of the nucleic acid molecule described in the fifth aspect of the present invention or the recombinant expression vector described in the sixth aspect of the present invention in preparing an engineered host cell, wherein the engineered host cell is the engineered host cell described in the seventh aspect of the present invention;

[0149] Preferably, the anti-tumor drugs include anti-tumor immune cell therapeutic agents and anti-tumor gene therapy drugs;

[0150] Preferably, the tumor is a tumor expressing CD7;

[0151] More preferably, the tumor is a blood tumor of T lymphocyte lineage;

[0152] Most preferably, the tumor comprises acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, anaplastic large cell lymphoma (ALCL).

[0153] The present invention also provides a method for preventing and / or treating a subject suffering from a tumor expressing CD7.

[0154] Furthermore, the method comprises administering to the subject an effective amount of the engineered host cell described in the seventh aspect of the present invention or the pharmaceutical composition described in the eighth aspect of the present invention.

[0155] Further, the engineered host cell comprises an immune cell expressing the single nanobody-based chimeric antigen receptor (CAR) according to the third aspect of the present invention or the double nanobody-based chimeric antigen receptor according to the fourth aspect of the present invention, which is anti-CD7;

[0156] Preferably, the immune cells include T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, and NKT cells; more preferably, the engineered host cells are CAR-T cells.

[0157] Further, the engineered host cell is administered to a subject in an amount selected from the following:

[0158] (1) If the subject weighs less than 100 kilograms (kg) and is less than 18 years old, then the 6 CAR-T cells / kg of the subject's body weight is or is about 5.0×10 7 CAR-T cells / kg body weight of the subject;

[0159] (2) If the subject weighs 100 kg or more or is older than 18 years old, then 6 CAR-T cells / kg of the subject's body weight is or is about 5.0×10 8 CAR-T cells / kg body weight of the subject.

[0160] In some embodiments of the present invention, the CAR-T cell therapy is performed by autologous transfer, wherein cells are separated and / or otherwise prepared from a subject receiving cell therapy or from a sample derived from such a subject. Therefore, in some aspects, cells are derived from a subject (e.g., a patient) in need of treatment, and the cells are administered to the same subject after separation and treatment.

[0161] In other embodiments of the present invention, the CAR-T cell therapy is carried out by allogeneic transfer, wherein the subject (e.g., the first subject) is separated and / or otherwise prepared from a subject other than the subject to be or finally receive cell therapy. In such embodiments, the cells are then administered to different subjects of the same species, such as a second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0162] In a specific embodiment of the present invention, the CAR-T cells can be administered by any suitable means, such as by bolus infusion, by injection such as intravenous or subcutaneous injection, intraocular injection, periocular injection, subretinal injection, intravitreal injection, septal injection, subscleral injection, intrachoroidal injection, anterior chamber injection, subconjunctival (Subconjectval) injection, sub-Tenon injection, retro-ocular injection, periorbital injection or posterior juxtascleral (Posteriorjuxtascleral) delivery. In some embodiments, they are administered by parenteral, intrapulmonary and intranasal and (if necessary for local treatment) intralesional administration. Parenteral infusion includes intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus of the cell. In some embodiments, a given dose is administered by multiple bolus administration of cells, such as within a period of no more than 3 days, or by continuous infusion of cells. In some embodiments, administration of a cell dose or any other therapy (eg, lymphodepletion therapy, intervention therapy, and / or combination therapy) is by outpatient delivery.

[0163] Further, for the prevention or treatment of a disease, the appropriate dosage may depend on the type of disease to be treated, the type of cells, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous treatments, the subject's clinical history and response to the cells, and the discretion of the attending physician. In some embodiments, it is appropriate to administer the pharmaceutical composition and / or CAR-T cells to the subject once or in a series of treatments.

[0164] In some embodiments, the CAR-T cells are administered as part of a combination therapy, such as simultaneously or sequentially with another or additional therapeutic intervention (such as an antibody or engineered cell or receptor or agent, such as a cytotoxic agent or therapeutic agent). In some embodiments, the CAR-T cells are co-administered with one or more additional therapeutic agents or co-administered with another therapeutic intervention (simultaneously or sequentially in any order). In some embodiments, the additional therapeutic agent is any intervention preparation or agent known to those skilled in the art that can be used for tumor intervention therapy, and in some embodiments, the cells are administered before the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents include cytokines such as IL-2, for example, to enhance persistence. In some embodiments, the method includes administering a chemotherapeutic agent. In some embodiments, the method includes administering a chemotherapeutic agent (e.g., a conditioning chemotherapeutic agent) prior to the administration, for example, to reduce tumor load. In some embodiments, preconditioning the subject with immune clearance (e.g., lymphocyte clearance) therapy can improve the effect of cell therapy.

[0165] In some embodiments, all or part of the CAR-T cells or pharmaceutical compositions involved in the methods and applications provided, such as the engineered immune cells expressing the chimeric antigen receptor CAR described in the second aspect of the present invention or the chimeric antigen receptor described in the third aspect of the present invention, in some embodiments, a specific amount or number of cells, or a specific amount of pharmaceutical compositions containing the specific amount or number of cells, are administered to the subject. In some embodiments, one or more cell doses are administered to the subject, containing a specific amount or number of cells or a specific amount of pharmaceutical compositions containing the specific amount or number of cells. In some embodiments, a certain dose of cells is administered to the subject according to the provided method and / or with the provided product or composition. In some embodiments, the size, amount, or timing of the dose is determined according to the age of the subject. In some embodiments, the size, amount, or timing of the dose is determined according to the weight of the subject. In some embodiments, the size, amount, or timing of the dose is determined according to the specific type of tumor of the subject.

[0166] The present invention also provides a method for diagnosing whether a subject has a tumor expressing CD7.

[0167] Further, the method comprises the following steps:

[0168] (1) providing a sample from a subject suspected of having a tumor expressing CD7;

[0169] (2) contacting the sample with the Nanobody described in the first aspect or the Nanobody described in the second aspect of the invention;

[0170] (3) detecting the formation of a complex comprising the Nanobody and the antigen, obtaining the amount of CD7 in the sample from the subject, and comparing the amount of CD7 in the sample from the subject with its amount in a known standard or reference sample, and determining whether the CD7 level in the sample from the subject falls within the CD7 level associated with the tumor;

[0171] Preferably, the sample may be selected from urine, blood, serum, plasma, saliva, ascites, circulating cells, circulating tumor cells, non-tissue associated cells, tissue or histological preparation;

[0172] Preferably, the tumor is a blood tumor of the T lymphocyte lineage; more preferably, the tumor includes acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, anaplastic large cell lymphoma (ALCL).

[0173] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0174] The present invention provides an anti-CD7 nanobody, which has a good affinity for CD7. The nanobody is used as the antigen binding region of a chimeric antigen receptor to modify the chimeric antigen receptor and is used in CAR-T cell therapy. Compared with traditional CAR-T cells constructed based on monoclonal antibodies (scFv), the CAR-T cells constructed based on single nanoantibodies or double nanoantibodies of the present invention have multiple advantages. Not only do they effectively avoid the common defects of traditional CAR-T designed based on scFv, such as difficulty in expression and poor stability, but they also significantly enhance the ability of immune cells to target and recognize tumor antigens, and strengthen the killing activity against tumor cells, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0175] Figure 1 This is the SDS-PAGE result diagram of CD7 antigen purification;

[0176] Figure 2 Flow chart for immunization of alpacas;

[0177] Figure 3 This is the result of the first round of PCR amplification during the construction of the nanobody library;

[0178] Figure 4 This is a diagram showing the results of the second round of PCR amplification during the construction of the nanobody library;

[0179] Figure 5 This is a graph showing the PCR results for the diversity detection of the nanobody library;

[0180] Figure 6 This is the ratio result diagram of the positive group and the negative group after phage panning;

[0181] Figure 7 This is the statistical result diagram of OD value of monoclonal screening;

[0182] Figure 8 This is a statistical result diagram of monoclonal screening and identification;

[0183] Fig. 9 Schematic diagram of the single VHH CAR-T structure;

[0184] Fig.10 Flow chart for lentiviral packaging;

[0185] Fig.11 This is a flow chart for CAR-T cell culture;

[0186] Fig.12 This is a representative result diagram of single VHH CAR-T cell flow cytometry detection;

[0187] Fig.13 This is a statistical graph of the average MFI results of CD7+ of single VHH CAR-T cells;

[0188] Fig.14 This is a statistical result diagram of the killing ratio of single VHH CAR-T cells;

[0189] Fig.15 This is the statistical result graph of the average MFI value of the single VHH K562 cell line;

[0190] Fig.16 This is a graph of single VHH-specific detection results;

[0191] Fig.17 This is a representative result diagram of single VHH CAR-T cell flow cytometry detection;

[0192] Fig.18 This is the average MFI result of CD7+ of single VHH CAR-T cells;

[0193] Fig.19 The figure shows the comparison of the sourced sequence with DP-47, template h-NbBcII10PGLA and the original sequence, where the highlighted sites are mutation sites;

[0194] Fig. 20 Schematic diagram of the dual VHH CAR-T structure;

[0195] Fig.21This is a representative result diagram of dual VHH CAR-T cell flow cytometry detection;

[0196] Fig. 22 The statistical graph shows the average MFI results of CD7+ of single VHH CAR-T cells and dual VHH CAR-T cells;

[0197] Fig.23 This is the result diagram of dVHH-D CAR-T cell expansion curve;

[0198] Fig.24 This is a graph showing the killing results of dVHH-D CAR-T cells;

[0199] Fig.25 This is the result diagram of dVHH-E CAR-T cell expansion curve;

[0200] Fig.26 This is a graph showing the killing results of dVHH-E CAR-T cells. DETAILED DESCRIPTION

[0201] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents. The experimental methods used in the following embodiments are conventional methods unless otherwise specified; the experimental methods used in the following embodiments are conventional methods unless otherwise specified; the reagents, materials, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0202] Example 1 Antigen preparation

[0203] 1. Experimental methods

[0204] RNA extraction kit was used to extract RNA from T cells. TM II ReverseTranscriptase Instructions, reverse transcription was performed using random primers to obtain cDNA. Using cDNA as a template, the extracellular region gene sequence of the antigen CD7 was obtained by PCR. The CD7 extracellular region gene sequence was connected to a protein expression vector for expression, and purified by Ni column to obtain purified CD7-His protein.

[0205] 2. Experimental results

[0206] Results Figure 1The results showed that after SDS-PAGE identification, the present invention successfully prepared a CD7 antigen with a size of 17.2 kDa and a purity of >90%, which could be used for subsequent alpaca immunization.

[0207] Example 2 Construction of Nanobody Library

[0208] 1. Experimental methods

[0209] (1) Alpaca immunization was performed using the CD7-His protein purified independently by the present invention in Example 1. The specific alpaca immunization flow chart is shown in Figure 2 Immunization was performed once a week for a total of 6 consecutive immunizations; (3) 100 mL of peripheral blood was collected 7 days after the last immunization, and peripheral blood mononuclear cells were separated by Ficoll density gradient centrifugation, and RNA was extracted, and cDNA was prepared using a reverse transcription kit; (4) VHH fragments were obtained by SOE-PCR and connected to the pMES4 phage display vector; (5) The ligation product was electroporated into the electroporation competent cell TG1, and the resulting bacterial library was the constructed CD7 single domain heavy chain antibody phage display library, with a library capacity of 3.37×10 8 (6) After the library was constructed, 25 clones were randomly selected to detect the insertion efficiency of the library using primers MP57 and GⅢ for colony PCR, and the PCR products were sequenced by Sanger sequencing.

[0210] 2. Experimental results

[0211] The results of the first round of PCR amplification are shown in Figure Figure 3 The results showed that after the first round of PCR, a DNA fragment of about 700 bp was recovered. The results of the second round of PCR amplification are shown in Figure Figure 4 The results showed that after the second round of PCR, a DNA fragment of about 400 bp was recovered. After the library was constructed, 25 clones were randomly selected to detect the insertion efficiency of the library using primers MP57 and GⅢ for colony PCR, and the PCR products were sequenced by Sanger sequencing. The results showed that the insertion rate was close to 95% (see Figure 5 ).

[0212] Example 3 Enrichment and screening of nanobodies

[0213] 1. Amplification of phage nanoantibody library

[0214] (1) Take the TG1 E. coli nanobody library and transfer it to 2-YT liquid culture medium, culture it at 37°C and 200rpm until the OD value is 0.5, and then add the helper phage VCSM13 to infect the cells. Mix gently and incubate at 37°C for 30 minutes. Centrifuge the bacterial liquid to remove trace glucose, and then resuspend the precipitate in 2-YT culture medium with ampicillin and kanamycin resistance, and shake and culture it at 37°C and 200rpm overnight to amplify the phage displaying nanoantibodies; (2) Transfer the overnight culture to a 50mL centrifuge tube, centrifuge to obtain the supernatant, and add 20% (wt / vol) PEG6000 / 2.5M NaCl solution to precipitate the phage. Centrifuge and discard the supernatant, resuspend the precipitate in PBS, centrifuge and take the supernatant to a new centrifuge tube, add 20% (wt / vol) PEG6000 / 2.5MNaCl solution to reprecipitate the phage. Centrifuge and discard the supernatant, and resuspend the precipitate in 1mL PBS. After centrifugation, the supernatant was transferred to a new centrifuge tube, glycerol was added to a final concentration of 20% and stored at -80°C; (3) The titer of the phage nanoantibody library was determined by diluting the phage in a 10-fold gradient, and the phages with different dilution multiples were used to infect TG1 bacteria in the logarithmic growth phase, and cultured overnight at 37°C. The titer of the phage nanoantibody library was estimated by the number of plaques on the second day.

[0215] 2. Phage enrichment and screening

[0216] (1) The nanoantibodies were selected by ELISA. The recombinant CD7-His protein was coated on the ELISA plate and incubated overnight at 4°C; (2) The ELISA plate was washed three times with 250 μL PBST, 200 μL blocking solution was added, and the ELISA plate was incubated at room temperature for 2 h; (3) The corresponding phage was added to each well and incubated at room temperature for 2 h; (4) The plate was washed 15 times with 250 μL PBST; (5) 100 μL of 0.25 mg / mL trypsin was added to each well and incubated at room temperature at 700 rpm for 0.5 h; (6) The phage was eluted with AEBSF; (7) The eluted phage was titered and the phage infection was amplified; (8) When the number of eluted phages was positive: negative ≥ 100, the selection was stopped.

[0217] 3. Experimental results

[0218] The panning results are shown in Table 1 and Figure 6 After two rounds of panning, the ratio of the positive group to the negative group reached 438 times, which has reached the standard for screening monoclonal clones. Therefore, after two rounds of panning, the panning was stopped and the next step of monoclonal screening and identification was carried out.

[0219] Table 1 Phage panning results

[0220] Screening times CD7 blank Proportion First screening <![CDATA[8×10 6 ]]> <![CDATA[2×10 5 ]]> 40 Second screening <![CDATA[3.51×10 8 ]]> <![CDATA[8×10 5 ]]> 438

[0221] Example 4 Screening and identification of positive monoclonal

[0222] 1. Experimental methods

[0223] (1) Select a single clone from the TG1 E. coli library obtained after 2-3 rounds of screening for expansion culture, and use the helper phage VCSM13 for infection to prepare monoclonal phage. (2) Incubate K562-CD7 positive cells with appropriate amount of nano antibody phage at room temperature for 2 hours; (3) After washing the plate with PBST, add HA-HRP antibody and incubate at room temperature for 1 hour; (4) After washing the plate with PBST, add 100μL TMB single component colorimetric solution, incubate at room temperature for 30 minutes, and then add 100μL stop solution; (5) Use an ELISA reader to detect the absorbance at 450nm; (6) When the OD450 value of the sample well is greater than 2 compared with the blank control, it is judged as a positive clone; (7) Perform bacterial liquid PCR on the positive clone and perform Sanger sequencing; (8) Use the software DNAMAN to compare the sequence of the single clones after Sanger sequencing. And screen out sequence-specific clones.

[0224] 2. Experimental results

[0225] In this example, 9 96-well plates were used to screen a total of 864 monoclonal clones. The OD values ​​of the monoclonal clones were as follows: Figure 7 As shown, according to the calculation principle, 231 positive clones were screened and 17 sequence-specific clones were found. Figure 8As shown, the sequence-specific Nanobodies are numbered as VHH01-VHH20 (excluding VHH02, VHH05 and VHH11), VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19, and VHH20, respectively, and their corresponding variable region amino acid sequences are as shown in SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 41, SEQ ID NO: 49, SEQ ID NO: 57, SEQ ID NO: 65, SEQ ID NO: 73, SEQ ID NO: 81, SEQ ID NO: 89, SEQ ID NO: 97, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105 NO:105, SEQ ID NO:113, SEQ ID NO:121, and SEQ ID NO:129, and their corresponding variable region nucleic acid sequences are shown in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122, and SEQ ID NO:130, respectively.

[0226] Example 5 Preparation and in vitro functional verification of single VHH CAR-T cells

[0227] 1. Single VHH CAR structure construction

[0228] (1) Sequence-specific clones were used to construct a single VHH CAR structure. First, the VHH sequence of the positive clone was amplified using PCR. The first round of PCR primers were:

[0229] NCAR-F1: 5'-CTGCAGGAGTCTGGRGGAGG-3'

[0230] NCAR-R1: 5'-TGAGGAGACGGTGACCTGGG-3'

[0231] After the first round of PCR, the second round of PCR was performed using the first round PCR product as a template. The second round of PCR primers were:

[0232] NCAR-F2: 5'-TTTCTGCTGATCCCCCAGGTGCAGCTGCAGGAGTCTGGRGGAGG-3'

[0233] NCAR-R2: 5'-TAGGAGCCGGGGTGGGCGGCCGCGTCTGGGGTAGTTGAGGAGACGGTGACCTGGG-3'

[0234] (2) The second round of PCR products were connected to the vector Senl-S88BZ by homologous recombination, and the vector was cut with Not I. At this point, the CAR structure containing a single VHH targeting CD7 was successfully constructed. A total of 17 single VHH sequences were constructed, named VHH01 to VHH20 (excluding 02, 05 and 11). The schematic diagram of the constructed single VHH CAR-T structure is shown in the figure Fig. 9 As shown, EF1α is the promoter of elongation factor 1α, leader is the coding sequence of signal peptide, VHH is the coding sequence of anti-CD7 nanobody, CD8H+TM is the hinge region and transmembrane region of CD8, 4-1BB and CD3ζ intracellular signal region are intracellular co-stimulatory domains, and the tEGFR extracellular region is expressed by connecting with T2A peptide so as to detect the expression of CAR after viral transduction.

[0235] 2. Preparation of single VHH CAR-T cells

[0236] Before CAR-T cell preparation, lentivirus packaging was first performed: (1) the target plasmid and three auxiliary plasmids (pMD2.G, pRSV-REV, pMDLg) were co-transfected into 293FT cells under the action of PEI-Pro; (2) the medium was changed 6 hours after packaging; (3) the lentivirus was harvested 48 hours after packaging; (4) the harvested lentivirus stock solution was concentrated by ultracentrifugation, the lentivirus particles were resuspended in DMEM high-glucose medium, and the lentivirus particles were divided for use; the lentivirus packaging process is as follows: Fig.10 As shown;

[0237] After the lentivirus packaging is completed, CAR-T cells are prepared: (1) peripheral blood mononuclear cells (PBMC) are collected from patients or healthy donors; (2) αβT cells are sorted using CD3 magnetic beads; (3) the sorted αβT cells are cultured in TexMACS GMP medium (MACS); (4) lentivirus is transduced after 2 days; (5) CAR-T cells are harvested after 12-14 days of culture to obtain CD7-targeting VHH NS CAR-T cells (named VHH01-VHH20, excluding VHH02, VHH05 and VHH11). The CAR-T cell culture process is as follows: Fig.11 As shown; (6) Flow cytometry was performed during the culture process to determine the proportion of CAR+ cells and the average MFI value of CD7+ cells.

[0238] 3. In vitro functional validation of single VHH CAR-T cells

[0239] In order to verify the in vitro biological activity of the anti-CD7 VHH CAR-T cells prepared in this example, an in vitro killing experiment was performed during the culture process: first, the target cells KG-1a-GFP-Luc were collected, centrifuged at 2000 rpm for 5 min, resuspended in DPBS, and counted. 5 The number of cells / well was added to a 96-well plate. Then, according to E: T = 3: 1, an appropriate amount of effector cells was added to the target cells, mixed and incubated for 4 hours, the corresponding luciferase substrate was added, and the 96-well plate was read with an electrochemiluminescence microplate reader for luciferase values. According to the change in value, the killing ratio was calculated. In addition, on the 12th day of the culture of 17 single VHH CAR-T cells, 17 single VHH CAR-T cells and blank T cells were taken and the CD7 expression positive cell line KG-1a-GFP-Luc was used for cell killing experiments at a ratio of E: T = 3: 1.

[0240] 4. Experimental results

[0241] Representative results of single VHH CAR-T cell flow cytometry detection and their CD7+ average MFI results are shown in Fig.12 and Fig.13 The results showed that the CAR positivity rates of VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11) were 61.04%, 96.2%, 78.9%, 83%, 85%, 72.72%, 89%, 95.6%, 90.98%, 68.38%, 65%, 84.1%, 79.6%, 54.4%, 89.2%, 72.6% and 62.15%, respectively; the blank T cell C The average MFI value of D7-positive cells was 2588, and the average MFI values ​​of CD7-positive cells of CAR-T cells from VHH01 to VHH20 (excluding VHH02, VHH05, and VHH11) were: 2257, 694, 1281, 498, 1566, 2362, 841, 197, 190, 2010, 1473, 1077, 1300, 2054, 1117, 1391, 2041;

[0242] The results of in vitro functional validation are shown in Fig.14The results showed that the killing ratio of blank T cells was 13.65%, and the killing ratios of CAR-T cells from VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11) were 4.79%, 75.7%, 57%, 62.19%, 61.63%, 68.52%, 71.47%, 91.36%, 78.18%, 1.18%, 60.44%, 56.77%, 72.87%, 8.58%, 74.52%, 61.71% and 9.38%, respectively.

[0243] Example 6 Detection of Nanobody Affinity and Specificity

[0244] 1. Affinity detection

[0245] The VHH CAR structures corresponding to the 17 single VHHs screened and identified in Example 4 were transduced into the human myeloid leukemia cell line K562, and on the 4th day after transduction, flow cytometry was performed using CD7-His protein to count the average MFI value of positive cells. Depending on the affinity of each VHH to CD7, the average MFI value of positive cells will be different. The higher the MFI value, the higher the affinity of the corresponding nanobody to the antigen CD7. A total of three parallel experiments were performed.

[0246] 2. Specificity testing

[0247] (1) The VHH fragments of different clones obtained by sequencing were cloned into the prokaryotic expression vector PET-28a-SUMO; (2) After correct sequencing, the plasmid was extracted and then transformed into the Escherichia coli strain BL21, and protein expression was carried out under IPTG induction; (3) The bacteria were ultrasonically lysed to obtain crude protein; (4) The nanoantibodies were purified by nickel column ion affinity chromatography; (5) The purified nanoantibodies were used as primary antibodies and HIS-FITC antibodies were used as secondary antibodies to detect the binding of 17 nanoantibodies to K562 and K562-CD7 cell lines by flow cytometry.

[0248] 3. Experimental results

[0249] The results of the nanobody affinity test are shown in Fig.15 The results showed that all 17 single VHH structures specifically bound to CD7-His, among which VHH03, VHH06, VHH10, and VHH12 had stronger affinity, indicating that the 17 single VHHs screened and identified in Example 4 of the present invention all had good affinity to CD7;

[0250] The results of the specificity test of nanobodies are shown in Fig.16 The results showed that all 17 VHHs could specifically bind to CD7, indicating that the 17 single VHHs screened and identified in Example 4 of the present invention had good specificity.

[0251] Example 7 Construction of humanized nanobody (hVHH06)

[0252] 1. Experimental methods

[0253] (1) The universal humanized framework h-NbBcII10FGLA reported in the literature was used as a reference (for details, see the literature: Vincke, C., et al., General strategy to humanize a camelid single-domain antibody and identification of a universal humanized nanobody scaffold. J Biol Chem, 2009. 284(5): p. 3273-3284), and the residues at the key positions of VHH06 were humanized by comparison with DP-47. The modified nanobody was named hVHH06. The sequence comparison of the three structures (humanized sequence and DP-47, template h-NbBcII10PGLA and original sequence) is shown in Figure 2. Fig.19 As shown, the amino acid sequences of CDR1, CDR2 and CDR3 of the hVHH06 are shown as SEQ ID NO: 139, SEQ ID NO: 141 and SEQ ID NO: 143, respectively, the nucleotide sequences of CDR1, CDR2 and CDR3 are shown as SEQ ID NO: 140, SEQ ID NO: 142 and SEQ ID NO: 144, respectively, the amino acid sequence of the hVHH06 is shown as SEQ ID NO: 137, and the nucleotide sequence is shown as SEQ ID NO: 138; (2) hVHH06 and VHH06 are simultaneously packaged with lentivirus according to the aforementioned method, and CAR-T cells are prepared; (3) flow cytometry detection is performed on the 6th day of CAR-T culture; (4) on the 10th day of CAR-T culture, KG-1a-GFP-Luc is used as the target cell, and the killing experiment is performed according to the aforementioned method with the effector-target ratio set to E:T=5:1, 10:1, and 20:1.

[0254] 2. Experimental results

[0255] The results of flow cytometry were shown in Fig.17 The results showed that the transduction rates of VHH06 and hVHH06 were 12.4% and 21%, respectively, and the CD7 positive rates were 0.249% and 0.157%, respectively; the results of the killing experiment are shown in Fig.18The results showed that when E:T=5:1, 10:1, and 20:1, the average killing rates of blank T cells against KG-1a-GFP-Luc cells were 27.40%, 28.00%, and 26.80%, respectively; the average killing rates of VHH06 against KG-1a-GFP-Luc cells were 69.90%, 79.80%, and 79.70%, respectively; and the average killing rates of hVHH06 against KG-1a-GFP-Luc cells were 70.80%, 81.20%, and 89.60%, respectively. From the above results, it can be seen that humanization has no effect on the properties of the antibody, indicating that VHH06 was successfully humanized in this example.

[0256] Example 8 Preparation of dual VHH CAR-T cells

[0257] 1. Construction of dual VHH CAR structure

[0258] (1) The VHHs (VHH03, VHH06, VHH10, and VHH12) with better functions screened in Example 6 were used to construct a dual-VHH CAR structure plasmid. The schematic diagram of the structure is shown in FIG. Fig. 20 First, the VHH sequence of the positive clone was amplified by PCR, and the first round of PCR primers were:

[0259] dNCAR-F1: 5'-CAGGTGCAGCTGCAGGAG-3'

[0260] dNCAR-R1: 5'-TGAGGAGACGGTGACCTGG-3'

[0261] After the first round of PCR, the second round of PCR was performed using the first round PCR product as a template. The second round of PCR primers were:

[0262] dNCAR-F2: 5'-CCAGGTCACCGTCTCCTCAGGAGGAGGAGGATCCGGAGGAGGAGGATCTGGCGG CGGCGGCAGTGGCGGCGGCGGCTCCGGCGGCGGCGGCTCTCAGGTGCAGCTGCAGGAG-3'

[0263] dNCAR-R2: 5'-TAGGAGCCGGGGTGGGCGGCCGCGGTGCTGGGGTAGTTGAGGAGACGGTGACCTGG-3'

[0264] Then, the second round of PCR products were connected to the vector VHH-XX (XX represents the sequence number of the CAR structure targeting CD7 single VHH) by homologous recombination, and the vector was cut with Not I. Among them, the double VHH structures constructed with VHH03 and VHH12 using VHH-06 as a vector were named dVHH-B and dVHH-C, respectively. The double VHH structures constructed with VHH12 and VHH10 using VHH-10 as a vector were named dVHH-D and dVHH-E, respectively. The double VHH structure constructed with VHH12 as a vector and VHH12 was named dVHH-F.

[0265] 2. Preparation of dual VHH CAR-T cells

[0266] The preparation process of dual VHH CAR-T cells is consistent with the preparation process of single VHH CAR-T cells in Example 5. The lentiviral packaging process is as follows Fig.10 As shown, the cultivation process is as follows Fig.11 CAR-T cells, VHH10CAR-T cells, and VHH12CAR-T cells prepared from the five dual VHH structures and transduced T cells were cultured for 6 days and then tested by flow cytometry.

[0267] 3. Experimental results

[0268] In this example, a total of five dual VHH structures were constructed, which were named dVHH-B to dVHH-F (VHH-06+VHH-03, VHH-06+VHH-12, VHH-10+VHH-12, VHH-10+VHH-10, and VHH-12+VHH-12). Fig. 20 As shown, EF1α is the promoter of elongation factor 1α, leader is the coding sequence of the signal peptide, VHH is the coding sequence of the anti-CD7 nanobody, CD8H+TM is the hinge region and transmembrane region of CD8, 4-1BB and CD3ζ intracellular signal regions are intracellular co-stimulatory domains, and the tEGFR extracellular region is expressed by connecting with the T2A peptide so that the expression of CAR can be detected after viral transduction;

[0269] The results of the proportion of CAR+ cells and CD7 MFI values ​​are shown in the figure below. Fig.21 and Fig. 22The results showed that the CAR positivity rates of dVHH-B to dVHH-F were 22.59%, 53.6%, 68.68%, and 55.34%, respectively; the positivity rates of VHH10 and VHH12 were 72.2%, and 86.7%, respectively; the average MFI value of blank T cell CD7-positive cells was 10109, the average MFI values ​​of CAR-T cell CD7-positive cells of dVHH-B to dVHH-F were 708, 797, 648, 577, and 1057, respectively; the average MFI value of CAR-T cell CD7-positive cells of VHH10 was 2302, and the average MFI value of CAR-T cell CD7-positive cells of VHH12 was 1238.

[0270] Example 9 Cultivation of dual VHH CAR-T cells (dVHH-D) and in vitro functional experimental verification

[0271] 1. Preparation of dVHH-D dual VHH CAR-T cells

[0272] The dVHH-D, VHH10, and VHH12 structures were cultured in vitro using the CAR-T cell preparation method described in Example 8, and the cell expansion multiples during the culture process were counted.

[0273] 2. In vitro functional validation of dVHH-D dual VHH CAR-T cells

[0274] To compare the in vitro functions of dVHH-D and single VHH CAR-T, on the 12th day of dVHH-D, VHH10, and VHH12 CAR-T cell culture, CAR-T cells and blank T cells were respectively subjected to cell killing experiments with the CD7 expression positive cell line CCRF-CEM (leukemia T lymphoma cells) at a ratio of E:T = 2:1: first, the target cells were collected, centrifuged at 2000rpm for 5min, resuspended and counted in DPBS, CFSE stained, and added to a 96-well plate at a number of 1E5 / well. Then, according to different effector-target ratios (E:T = 0.5:1, 1:1, 2:1), appropriate amounts of effector cells were added to the target cells, mixed and incubated for 4 hours, and the cell killing ratio was detected by flow cytometry.

[0275] 3. Experimental results

[0276] dVHH-D amplification curve is shown in Fig.23 The results showed that on the 14th day, the average amplification fold of dVHH-D was 46.35, the average amplification fold of VHH-12 was 26.3, and the average amplification fold of VHH-10 was 22.75. It can be seen that the amplification fold of dVHH-D is significantly better than that of single VHH CAR-T;

[0277] The results of in vitro functional validation of dVHH-D are shown in Fig.24 The results showed that when the killing ratio was 0.5:1, 1:1, and 2:1, the average killing rate of dVHH-D against CCRF-CEM was 86.925%, 92.115%, and 94.465%, respectively; the average killing rate of VHH10 against CCRF-CEM was 45.55%, 69.95%, and 85.85%, respectively; the average killing rate of VHH12 against CCRF-CEM was 58.65%, 80.9%, and 82.95%, respectively. It can be seen that dVHH-D has a high killing power against CCRF-CEM.

[0278] Example 10 Cultivation of dual VHH CAR-T cells (dVHH-E) and in vitro functional experimental verification

[0279] 1. Preparation of dVHH-E dual VHH CAR-T cells

[0280] The dVHH-E, VHH10, and VHH12 structures were cultured in vitro using the CAR-T cell preparation method described in Example 8, and the cell expansion multiples during the culture process were counted.

[0281] 2. In vitro functional validation of dVHH-E dual VHH CAR-T cells

[0282] The method described in Example 9 was used to perform in vitro functional experimental verification of dVHH-E dual VHH CAR-T.

[0283] 3. Experimental results

[0284] The amplification curve of dVHH-E is shown in Fig.25 The results showed that on the 13th day, the average amplification fold of dVHH-E was 45.875, the average amplification fold of VHH-12 was 19.775, and the average amplification fold of VHH-10 was 21.36. It can be seen that the amplification fold of dVHH-E is significantly better than that of single VHH CAR-T;

[0285] The results of in vitro functional validation of dVHH-E are shown in Fig.26 The results showed that when the killing ratio was 0.5:1, 1:1, and 2:1, the average killing rate of dVHH-E against CCRF-CEM was 58.15%, 84.385%, and 91.775%, respectively; the average killing rate of VHH10 against CCRF-CEM was 45.55%, 69.95%, and 85.85%, respectively; the average killing rate of VHH12 against CCRF-CEM was 58.65%, 80.9%, and 82.95%, respectively. It can be seen that dVHH-E showed a relatively high killing ability against CCRF-CEM.

[0286] Example 11 Determination of antibody affinity (dVHH-D, dVHH-E, VHH10, VHH12) by SPR method

[0287] 1. Experimental methods

[0288] In this example, the SPR method (surface plasmon resonance) was used to determine the affinity of the antibody. The CD7-His protein prepared in Example 1 was fixed on the CM5 chip by the amino coupling method. Antibodies (dVHH-D, dVHH-E, VHH10, VHH12) were used as analytes to conduct experiments to detect the affinity between each antibody and the CD7 antigen.

[0289] 2. Experimental results

[0290] The results showed that the affinity constant between dVHH-D and CD7-His protein was 3.35E-09M, the affinity constant between dVHH-E and CD7-His protein was 4.51E-09M, the affinity constant between VHH10 and CD7-His protein was 9.99E-08M, and the affinity constant between VHH12 and CD7-His protein was 1.34E-09M (see Table 2). The above results further indicate that dVHH-D, dVHH-E, VHH10, and VHH12 can all specifically bind to the CD7 antigen and have strong affinity.

[0291] Table 2 Statistics of antibody affinity determination using the SPR method

[0292]

[0293] The description of the above embodiments is only used to understand the method and core concept of the present invention. Several improvements and modifications may be made to the present invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. An anti-CD7 nanobody, characterized in that: The amino acid sequences of CDR1, CDR2 and CDR3 of the nanobody are shown in SEQ ID NO: 27, SEQ ID NO: 29 and SEQ ID NO: 31, respectively.

2. The Nanobody according to claim 1, characterized in that The amino acid sequence of the Nanobody is shown in SEQ ID NO:

25.

3. The Nanobody according to claim 2, characterized in that The nucleotide sequence encoding the nanobody is shown in SEQ ID NO:

26.

4. A humanized anti-CD7 nanobody, characterized in that: The humanized anti-CD7 nanobody is obtained by humanizing the residues at the key positions of the nanobody according to any one of claims 1 to 3 by using the universal humanized framework h-NbBcII10FGLA as a reference and by comparing with DP-47; The amino acid sequences of CDR1, CDR2 and CDR3 of the humanized anti-CD7 nanobody are shown in SEQ ID NO: 139, SEQ ID NO: 141 and SEQ ID NO: 143, respectively.

5. The Nanobody according to claim 4, characterized in that The nucleotide sequences encoding CDR1, CDR2, and CDR3 of the humanized anti-CD7 nanobody are shown in SEQ ID NO: 140, SEQ ID NO: 142, and SEQ ID NO: 144, respectively.

6. The Nanobody according to claim 4, characterized in that The amino acid sequence of the humanized anti-CD7 nanobody is shown in SEQ ID NO:

137.

7. The Nanobody according to claim 4, characterized in that The nucleotide sequence encoding the humanized anti-CD7 nanobody is shown in SEQ ID NO:

138.

8. A chimeric antigen receptor based on a single nanobody, characterized in that The chimeric antigen receptor comprises any one of the Nanobodies of any one of claims 1-3 or any one of claims 4-7.

9. The chimeric antigen receptor according to claim 8, characterized in that The chimeric antigen receptor also comprises a transmembrane domain.

10. The chimeric antigen receptor according to claim 9, characterized in that The chimeric antigen receptor also comprises an intracellular signaling domain.

11. The chimeric antigen receptor according to claim 10, characterized in that The chimeric antigen receptor also comprises a hinge region.

12. The chimeric antigen receptor according to claim 11, characterized in that The chimeric antigen receptor also comprises a co-stimulatory signaling domain.

13. The chimeric antigen receptor according to claim 12, characterized in that The chimeric antigen receptor also comprises a signal peptide.

14. The chimeric antigen receptor according to claim 13, characterized in that The chimeric antigen receptor further comprises EF1α, T2A, and tEGFR.

15. The chimeric antigen receptor according to claim 14, characterized in that The chimeric antigen receptor also comprises a tEGFR signal peptide.

16. The chimeric antigen receptor according to claim 9, characterized in that The transmembrane domain includes the transmembrane domain of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor or IL-11 receptor.

17. The chimeric antigen receptor according to claim 10, characterized in that The intracellular signaling domain includes the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12 or CD66d.

18. The chimeric antigen receptor according to claim 11, characterized in that The hinge region includes the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor or IL-11 receptor.

19. The chimeric antigen receptor according to claim 12, characterized in that The co-stimulatory signaling domain includes the co-stimulatory signaling domain of the following molecules: 4-1BB, CD27, CD19, CD4, CD28, ICOS, CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7 or CD226.

20. The chimeric antigen receptor according to claim 13, characterized in that The signal peptides include signal peptides of the following molecules: α chain and β chain of T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR or GM-CSF.

21. The chimeric antigen receptor according to claim 16, characterized in that The transmembrane domain is the CD8α transmembrane domain.

22. The chimeric antigen receptor according to claim 17, characterized in that The intracellular signaling domain is a CD3ζ intracellular signaling domain.

23. The chimeric antigen receptor according to claim 18, characterized in that The hinge region is the CD8α hinge region.

24. The chimeric antigen receptor according to claim 19, characterized in that The co-stimulatory signaling domain is a 4-1BB co-stimulatory signaling domain.

25. The chimeric antigen receptor according to claim 24, characterized in that The chimeric antigen receptor is obtained by connecting EF1α, signal peptide, the nanobody, CD8α hinge region, CD8α transmembrane domain, 4-1BB co-stimulatory signal domain, CD3ζ intracellular signal transduction domain, T2A, tEGFR signal peptide and tEGFR in series.

26. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleotide sequence encoding the Nanobody of any one of claims 1-3, the Nanobody of any one of claims 4-7, or the Chimeric Antigen Receptor of any one of claims 8-25.

27. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the nanobody is shown in SEQ ID NO:26 or SEQ ID NO:

138.

28. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the signal peptide in the chimeric antigen receptor is shown in SEQ ID NO:

146.

29. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the CD8α hinge region in the chimeric antigen receptor is shown in SEQ ID NO:

148.

30. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the CD8α transmembrane domain in the chimeric antigen receptor is shown in SEQ ID NO:

150.

31. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the 4-1BB co-stimulatory signal domain in the chimeric antigen receptor is shown in SEQ ID NO:

152.

32. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the CD3ζ intracellular signaling domain in the chimeric antigen receptor is shown in SEQ ID NO:

154.

33. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of T2A in the chimeric antigen receptor is shown in SEQ ID NO:

156.

34. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of EF1α in the chimeric antigen receptor is shown in SEQ ID NO:

157.

35. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of the tEGFR signal peptide in the chimeric antigen receptor is shown in SEQ ID NO:

159.

36. The nucleic acid molecule according to claim 26, characterized in that The nucleotide sequence of tEGFR in the chimeric antigen receptor is shown in SEQ ID NO:

161.

37. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid molecule of any one of claims 26-36.

38. The recombinant expression vector according to claim 37, characterized in that: The expression vector includes a DNA vector, an RNA vector, a plasmid, a transposon vector or a viral vector.

39. The recombinant expression vector according to claim 38, characterized in that: The viral vector includes a lentiviral vector, an adenoviral vector or a retroviral vector.

40. An engineered host cell, characterized in that The engineered host cell expresses the Nanobody of any one of claims 1-3, the Nanobody of any one of claims 4-7, or the Chimeric Antigen Receptor of any one of claims 8-25.

41. The engineered host cell of claim 40, wherein The engineered host cell comprises the recombinant expression vector of claim 37.

42. The engineered host cell of claim 40, wherein The engineered host cells comprise engineered immune cells.

43. The engineered host cell of claim 42, wherein The engineered immune cells include T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells and / or NKT cells.

44. The engineered host cell of claim 43, wherein The engineered immune cells are T cells.

45. A conjugate, characterized in that The conjugate comprises the Nanobody of any one of claims 1 to 3 or the Nanobody of any one of claims 4 to 7, and a modifying portion attached to the Nanobody.

46. ​​The conjugate according to claim 45, characterized in that Such modifying moieties include detectable labels and / or therapeutic agents.

47. The conjugate according to claim 46, characterized in that The detectable labels include enzymes, radionuclides, fluorescent dyes, luminescent substances and / or biotin.

48. The conjugate according to claim 46, characterized in that The therapeutic agents include drugs with anti-tumor activity and / or cytotoxic agents.

49. The conjugate according to claim 48, characterized in that The drugs with anti-tumor activity include chemotherapeutic drugs, anti-tumor angiogenesis drugs and / or immune checkpoint inhibitors.

50. The conjugate according to claim 49, characterized in that The chemotherapy drugs include taxane chemotherapy drugs, vinca alkaloid chemotherapy drugs, metal platinum chemotherapy drugs, anthracycline chemotherapy drugs, antifolate chemotherapy drugs, nitrogen mustard chemotherapy drugs and / or podophyllotoxin alkaloid chemotherapy drugs.

51. The conjugate according to claim 50, characterized in that The taxane chemotherapy drugs include paclitaxel, liposome paclitaxel, albumin-bound paclitaxel and / or docetaxel.

52. The conjugate according to claim 50, characterized in that The vinca alkaloid chemotherapy drugs include vincristine, vindesine and / or vinblastine.

53. The conjugate according to claim 50, characterized in that The metal platinum chemotherapy drugs include cisplatin, carboplatin, oxaliplatin, nedaplatin and / or lobaplatin.

54. The conjugate according to claim 50, characterized in that The anthracycline chemotherapy drugs include epirubicin, pirarubicin, doxorubicin and / or epirubicin.

55. The conjugate according to claim 50, characterized in that The antifolate chemotherapy drugs include methotrexate and / or pemetrexed disodium.

56. The conjugate according to claim 50, characterized in that The nitrogen mustard chemotherapy drugs include cyclophosphamide and / or bendamustine.

57. The conjugate according to claim 50, characterized in that The podophyllotoxin alkaloid chemotherapy drugs include etoposide and / or teniposide.

58. The conjugate according to claim 49, characterized in that The anti-tumor angiogenesis drugs include small molecule multi-target angiogenesis inhibitors, large molecule single-target angiogenesis inhibitors and / or endogenous pan-target angiogenesis inhibitors.

59. The conjugate according to claim 58, characterized in that The small molecule multi-target angiogenesis inhibitors include sorafenib, sunitinib, pazopanib, vandetanib, cabozantinib, regorafenib, axitinib, nintedanib, lenvatinib, apatinib, anlotinib, fruquintinib and / or erdafitinib.

60. The conjugate according to claim 58, characterized in that The macromolecular single-target angiogenesis inhibitors include bevacizumab, ramucirumab and / or aflibercept.

61. The conjugate according to claim 58, characterized in that The endogenous pan-target angiogenesis inhibitor includes Endostar.

62. The conjugate according to claim 49, characterized in that The immune checkpoint inhibitors include ipilimumab, pembrolizumab, nivolumab, atezolizumab, durvalumab, avelumab and / or sintilimab.

63. The conjugate according to claim 48, characterized in that The cytotoxic agents include alkaloid cytotoxic agents and / or antibiotic cytotoxic agents.

64. The conjugate according to claim 63, characterized in that The alkaloid cytotoxic agents include anisodamine hydrobromide and / or homoharringtonine.

65. The conjugate according to claim 63, characterized in that The antibiotic cytotoxic agents include idarubicin and / or doxorubicin hydrochloride.

66. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the Nanobody of any one of claims 1-3, the Nanobody of any one of claims 4-7, the Chimeric Antigen Receptor of any one of claims 8-25, the Engineered Host Cell of any one of claims 40-44 and / or the Conjugate of any one of claims 45-65.

67. A kit, characterized in that The kit comprises the Nanobody of any one of claims 1-3, the Nanobody of any one of claims 4-7, the Chimeric Antigen Receptor of any one of claims 8-25, the Engineered Host Cell of any one of claims 40-44 and / or the Conjugate of any one of claims 45-65.

68. A reagent for detecting CD7 protein, characterized in that: The reagent for detecting CD7 protein comprises the Nanobody according to any one of claims 1 to 3, the Nanobody according to any one of claims 4 to 7, or the conjugate according to any one of claims 45 to 65.

69. A method for detecting CD7 protein for non-diagnostic purposes, the method comprising the following steps: ① Obtain samples containing CD7 protein; ② contacting the sample collected in step ① with the Nanobody according to any one of claims 1 to 3, the Nanobody according to any one of claims 4 to 7, or the conjugate according to any one of claims 45 to 65; ③ Detect the presence of antibody-antigen complex.

70. A method for preparing an engineered host cell according to any one of claims 40-44, the method comprising the following steps: introducing the recombinant expression vector according to any one of claims 37-39 into a host cell.

71. The method according to claim 70, characterized in that The introduction method includes lipofection, microinjection, electroporation, DNA vector, RNA vector, retroviral vector, lentiviral vector, poxvirus vector, herpes simplex virus vector, adenovirus vector and / or adeno-associated virus vector.

72. Use of the Nanobody of any one of claims 1-3 or the Nanobody of any one of claims 4-7 in the preparation of a reagent or kit for detecting CD7 protein.

73. Use of the Nanobody of any one of claims 1-3, the Nanobody of any one of claims 4-7, the Chimeric Antigen Receptor of any one of claims 8-25, or the Engineered Host Cell of any one of claims 40-44 in the preparation of an anti-tumor drug; The tumor is a blood tumor of T lymphocyte lineage.

74. The use according to claim 73, characterized in that The tumors include acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

75. The use according to claim 73, characterized in that The anti-tumor drugs include anti-tumor immune cell therapeutic agents or anti-tumor gene therapeutic drugs.

76. Use of the nucleic acid molecule of any one of claims 26-36 or the recombinant expression vector of any one of claims 37-39 in the preparation of an engineered host cell, wherein the engineered host cell is the engineered host cell of any one of claims 40-44.

Images