A primer set for detecting Nipah virus, a modified primer set and applications thereof

Abstract

The present invention provides a primer set, a modified primer set and an application thereof for detecting Nipah virus, and belongs to the field of inspection and quarantine technology. The present invention designs primers for the G protein gene and the P protein gene of the Nipah virus, and the designed primers have the advantages of high sensitivity and good specificity, and can be used in combination with microfluidics and colloidal gold methods. The microfluidics technology is used to complete the amplification of the target fragment in the chip, and finally the colloidal gold technology is used to achieve the visualization result, which is convenient, simple, highly sensitive and repeatable. The reaction of the present invention is completed in one step from RNA to amplification in the reaction chamber of the microfluidic chip, eliminating the two-step reaction from reverse transcription to amplification, reducing the pollution from opening the cover, and avoiding the occurrence of false positive results. The detection lower limit of the present invention is not higher than 1048 copies / μL.

Description

Technical Field

[0001] The invention belongs to the technical field of inspection and quarantine, and in particular relates to a primer set and a modified primer set for detecting Nipah virus and applications thereof. Background Art

[0002] Nipah virus (NiV) is a zoonotic pathogen of the genus Henipavirus, which can cause encephalitis and respiratory symptoms in humans, with a mortality rate of up to 75%. NiV is a single-stranded negative-sense RNA virus with a genome containing 18,246 nucleotides, encoding six structural proteins, namely nucleoprotein (N), phosphoprotein (P), matrix-protein (M), fusion protein (F), glycoprotein (G) and large protein (L). Nipah virus invades host cells through a pH-independent membrane fusion mechanism, in which proteins F and G are essential. P protein mRNA encodes 709 amino acids, 100 amino acids more than other paramyxovirus P proteins, with a molecular weight of about 78 ku, making it the largest protein encoded in the P gene. P protein has two main functions: one is to protect the viral genomic RNA from damage; the other is to participate in the transcription and replication of viral RNA. It is the main immunodominant antigen of NiV and the protein with the most bifurcations in the viral genome. G protein mRNA encodes 602 amino acids and has a molecular weight of approximately 67 ku. It is a viral surface glycoprotein that can stimulate the body to produce neutralizing antibodies and is the main protective antigen.

[0003] Both the treatment of NiV patients and NiV disease control require diagnostic tests with high sensitivity and specificity to enable early detection of human NiV infection. Traditionally, accurate diagnosis of NiV relies on serological, molecular, or virological analysis, with nucleic acid amplification tests (NAATs), such as reverse transcriptase PCR (RT-PCR), being the preferred method for detecting active viral infection. However, NiV infection often occurs in areas with poor health and laboratory infrastructure, which do not have the laboratory infrastructure required for NAATs. Serological tests such as ELISA are temperature-dependent, have a high false-positive rate, and can only provide indirect evidence of NiV infection. Testing only for the NiV pathogen N gene can also result in false test results due to improper sample selection and the inability to distinguish transcripts from viral genomes. Therefore, it is necessary to develop a test method that is fast, easy to use, cost-effective, accurate, and compatible in resource-poor areas. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a primer set capable of real-time detection of Nipah virus, which can be used in combination with microfluidic colloidal gold detection technology and has the advantages of convenience, simplicity, moderate sensitivity, good specificity and high accuracy.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer set for detecting Nipah virus, wherein the primer set is at least one of a primer set 1 and a primer set 2; the nucleotide sequences of the primer pairs in the primer set 1 are respectively shown as SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the primer pairs in the primer set 2 are respectively shown as SEQ ID NO.3 and SEQ ID NO.4.

[0007] The present invention also provides a modified primer set for detecting Nipah virus, wherein the primer set is labeled with a fluorescent group and a hapten.

[0008] Preferably, the fluorescent group includes 6-FAM, and the hapten includes digoxigenin.

[0009] The present invention also provides the use of the primer set or the modified primer set in preparing a Nipah virus detection product.

[0010] The present invention also provides a Nipah virus detection kit, which comprises the above primer set.

[0011] The present invention also provides a Nipah virus microfluidic PCR-colloidal gold detection kit, which comprises the above-mentioned modified primer set, a microfluidic chip and a colloidal gold detection test strip; an anti-fluorescent group antibody is fixed on the upper sample plate of the colloidal gold detection test strip, an antibody against the fluorescent group antibody is fixed on the quality control line, and the detection line is designed as a hapten binding line.

[0012] The present invention also provides a non-diagnostic Nipah virus microfluidic PCR-colloidal gold detection method, comprising the following steps: adding a reaction system containing a sample RNA to be tested and a modified primer group to a sample addition well of a microfluidic chip, reacting using a microfluidic PCR instrument, and after the reaction is completed, using a colloidal gold test strip for detection, if both the test line and the quality control line are colored as positive, or if only the quality control line is colored as negative, if the quality control line is not colored, the result is deemed invalid and needs to be retested.

[0013] Preferably, when the modified primer set is a modified primer set of primers in group 1, the reaction program of the microfluidic PCR instrument is: 55°C for 5 min; 95°C for 150 s, 1 cycle; 95°C for 5 s, 60°C for 20 s, 35 cycles.

[0014] Preferably, when the modified primer set is a modified primer set of primers in group 2, the reaction program of the microfluidic PCR instrument is: 55°C for 5 min; 95°C for 150 s, 1 cycle; 95°C for 5 s, 55°C for 20 s, 35 cycles.

[0015] Preferably, the reaction system, based on 20 μL, includes 1 μL of enzyme mixture, 14 μL of buffer mixture and 5 μL of template.

[0016] Beneficial effects of the present invention:

[0017] The present invention avoids selecting the Nipah virus N gene with high transcriptional activity as a target, and at the same time adds the Nipah virus P and G double genes with low transcriptional activity as targets, thereby ensuring the reliability of virus molecular diagnosis. The present invention designs primers for the G protein and P protein of NiV, and the designed primers have the advantages of high accuracy, moderate sensitivity, and good specificity, and can be used in combination with microfluidics and colloidal gold methods. Using microfluidics technology, the target fragment amplification is completed in the chip, and finally the colloidal gold technology is used to achieve visualization of the results, which is convenient, simple, highly sensitive, and has good repeatability. The reaction of the present invention is completed in one step from RNA to amplification in the reaction chamber of the microfluidic chip, eliminating the two-step reaction from reverse transcription to amplification, reducing the pollution of opening the cover, and avoiding false positive results. The detection lower limit of the present invention is not less than 1048 copies / μL.

[0018] The kit provided by the present invention can detect in real time and analyze immediately at the sampling site, reducing the complicated sample processing procedures and quickly obtaining test results, which is of great significance for quickly controlling biological hazards, preventing the spread of infection, and diagnosing infectious diseases in remote areas. The present invention adopts microfluidic colloidal gold detection technology, which can complete the entire process from nucleic acid extraction to PCR amplification and then to test results on site, greatly compressing the diagnosis time. In addition, the diagnostic results of microfluidics plus colloidal gold technology are extremely accurate, and the process of automatic detection is basically realized, which can also reduce the detection cost and improve efficiency.

[0019] The present invention utilizes microfluidics technology to integrate the detection process into a chip of a few square centimeters, achieving miniaturization, automation, integration and portability. It has the advantages of low sample consumption, fast detection speed, simple operation, multi-functional integration, small size and easy to carry, which greatly expands the application space of on-site instant diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the reaction principle of colloidal gold;

[0021] Figure 2This is a flowchart of the use of the colloidal gold test paper cartridge. From left to right, it represents the four steps of peeling off the sealing strip of the liquid outlet on the back of the cartridge, installing the chip into the slot on the back of the cartridge, prying open the four support pillars on the front of the cartridge, and slowly pressing the push rod to the bottom.

[0022] Figure 3 The chip placement method for adding samples;

[0023] Figure 4 It is a microfluidic PCR instrument;

[0024] Figure 5 is the interpretation of the test results, where 1 means positive, 2 means negative, 3 means invalid, and 4 means invalid;

[0025] Figure 6 For NiV-G plasmid analysis;

[0026] Figure 7 For NiV-P plasmid analysis;

[0027] Figure 8 The left picture shows the results of Gram staining. The left picture shows the results of NiV-P Escherichia coli staining. The right picture shows the results of NiV-G Escherichia coli staining.

[0028] Fig. 9 The results of MacConkey agar plates, the left picture is the NiV-G result, and the right picture is the NiV-P result;

[0029] Fig.10 The results of eosin-methylene blue agar plates, the left picture is the NiV-P result, and the right picture is the NiV-G result;

[0030] Fig.11 are the amplification results of different primer pairs, wherein 1 corresponds to the result of the primer pair P42-168 of Example 1, 2 corresponds to the result of the primer pair P9-166 of Example 1, 3 corresponds to the result of the primer pair of Example 2, 4 corresponds to the result of the primer pair F147-349 of Example 2, 5 corresponds to the result of the primer pair F762-1009 of Example 2, 6 corresponds to the result of the primer pair of Example 3, and M is a marker;

[0031] Fig.12 The specificity verification results of the primer pair described in Example 2, where M is a marker, P is a positive control, N is a negative control, and the rest are different types of viruses;

[0032] Fig.13 The specificity verification results of the primer pair described in Example 3, where M is a marker, P is a positive control, N is a negative control, and the rest are different types of viruses;

[0033] Fig.14The specificity verification results of the modified primer pair in Example 6, where P is a positive control, A is an African swine fever positive sample, R is a porcine rotavirus sample, E is a PEDV positive cell sample, D is a PDCoV positive cell sample, O is OZK93, S is PRRSV, T is TGEV, and the unmarked one on the far right is a negative control;

[0034] Fig.15 The results of agarose gel electrophoresis after microfluidic PCR are shown in Figure 1. Fig.14 ;

[0035] Fig.16 The specificity verification results of the modified primer pair in Example 7, wherein P is a positive control, A is an African swine fever positive sample, R is a porcine rotavirus sample, E is a PEDV positive cell sample, D is a PDCoV positive cell sample, and N is a negative control;

[0036] Fig.17 The specificity verification results of the modified primer pairs in Example 7, from left to right are the positive control, OZK93, PRRSV, TGEV and negative control;

[0037] Fig.18 The results of agarose gel electrophoresis after microfluidic PCR are shown in Figure 1. Fig.16 ;

[0038] Fig.19 The agarose gel electrophoresis results after microfluidic PCR, where S is PRRSV virus, T is TGEV, O is OZK93, N is negative control, and P is positive control;

[0039] Fig. 20 The results of the sensitivity verification of the primers described in Example 2 for ordinary PCR, where N is the negative control; M is the marker, and 1-7 correspond to 6.46×10 9 copies / μL, 6.46×10 7 copies / μL, 6.46×10 5 copies / μL, 6.46×10 3 copies / μL, 6.46×10 2 copies / μL, 64.6copies / μL and 6.46copies / μL;

[0040] Fig.21 The results of sensitivity verification of the primers described in Example 3 for ordinary PCR, wherein N is a negative control, M is a marker, and 1-3 correspond to 2965 copies / μL, 296.5 copies / μL, and 29.65 copies / μL, respectively;

[0041] Fig. 22 The sensitivity test results of the modified primer pairs described in Example 6 are negative control, 104.8 copies / μL, 1048 copies / μL, and 10480 copies / μL from left to right;

[0042] Fig.23 The agarose gel electrophoresis results after the microfluidic PCR of the modified primer pair described in Example 6, wherein 1-3 correspond to 10480 copies / μL, 1048 copies / μL, and 104.8 copies / μL, respectively, N is a negative control, and M is a marker;

[0043] Fig.24 The sensitivity test results of the modified primer pairs described in Example 7 are 9360 copies / μL, 936 copies / μL, 93.6 copies / μL, and negative control from left to right;

[0044] Fig.25 The agarose gel electrophoresis results after the microfluidic PCR of the modified primer pair described in Example 7 are shown in Figure 1, wherein 1-4 correspond to 9360 copies / μL, 936 copies / μL, 93.6 copies / μL and negative control, respectively, and M is a marker;

[0045] Fig.26 1 is the negative control of the primers in Example 7, 2 is the negative control of the primers in Example 6, 3 is the positive result of Example 6 (NiV-P), and 4 is the positive result of Example 7 (NiV-G).

[0046] The markers involved in the above figures are all 2000bp. DETAILED DESCRIPTION

[0047] The present invention provides a primer set for detecting Nipah virus, wherein the primer set is at least one of a primer set 1 and a primer set 2; the nucleotide sequences of the primer pairs in the primer set 1 are respectively shown as SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the primer pairs in the primer set 2 are respectively shown as SEQ ID NO.3 and SEQ ID NO.4.

[0048] In the present invention, the primers of group 1 are primer pairs designed for the Nipah virus P protein gene sequence, the nucleotide sequence of the forward primer is TGTCGAACACCCGTGACTG (SEQ ID NO.1), and the nucleotide sequence of the reverse primer is ATCACTCCACCCTCTCTCAGG (SEQ ID NO.2). The primers of group 2 are primer pairs designed for the Nipah virus G protein gene sequence, the nucleotide sequence of the forward primer is AACCCACTCCCTTTTAGAGA (SEQ ID NO.3), and the nucleotide sequence of the reverse primer is TCACCTCTGTCTAGTACCTCTCC (SEQ ID NO.4).

[0049] The present invention also provides a modified primer set for detecting Nipah virus, wherein the primer set is labeled with a fluorescent group and a hapten.

[0050] In the present invention, the fluorescent group preferably includes 6-FAM, and the hapten preferably includes digoxin. In the present invention, when the fluorescent group and the hapten are used to label the above-mentioned group 1 primers, digoxin is preferably used to label the forward primer, specifically: 5'-dig-TGTCGAACACCCGTGACTG, and FAM is used to label the reverse primer, specifically: 5'6-FAM-ATCACTCCACCCTCTCTCAGG. When the fluorescent group and the hapten are used to label the above-mentioned group 2 primers, FAM is preferably used to label the forward primer, specifically: 5'6-FAM-AACCCACTCCCTTTTAGAGA, and digoxin is used to label the reverse primer, specifically: 5'-dig-TCACCTCTGTCTAGTACCTCTCC. The present invention does not specifically limit the specific sources of FAM and digoxin, and conventional commercially available products in the field can be used.

[0051] The present invention also provides the use of the above primer set or the above modified primer set in preparing a Nipah virus detection product. In the present invention, the product preferably includes a kit.

[0052] The present invention also provides a Nipah virus detection kit, and the kit preferably includes the above-mentioned primer set. The Nipah virus detection kit of the present invention preferably also includes a positive reference plasmid, and the positive reference plasmid is preferably prepared by the following steps: extracting plasmids from Escherichia coli containing NiV-G and NiV-P gene sequences (specifically referring to the top10 Escherichia coli carrying genes and puc57 vectors synthesized by Sangon Biotech (Shanghai) Co., Ltd.), using the plasmid as a template, and amplifying the target fragment with Niv-g-all-fr (SEQ ID NO.5, SEQ ID NO.6) and Niv-P-all-fr (SEQID NO.7, SEQ ID NO.8) primers; then running agarose gel electrophoresis for gel recovery; using TransGen's pEasy-Blunt (CB101) as a cloning vector and Trans1-T1Phage competent state to prepare positive reference plasmids.

[0053] The present invention also provides a Nipah virus microfluidic PCR-colloidal gold detection kit, which comprises the above-mentioned modified primer set, a microfluidic chip and a colloidal gold detection test strip; an anti-fluorescent group antibody is fixed on the upper sample plate of the colloidal gold detection test strip, an antibody against the fluorescent group antibody is fixed on the quality control line, and the detection line is designed as a hapten binding line.

[0054] In the present invention, the microfluidic chip is purchased from Beijing Yuanjingtai Biotechnology Co., Ltd. When performing microfluidic reactions, the microfluidic chip and the microfluidic PCR instrument need to be used in conjunction with each other, so the microfluidic PCR instrument of the present invention is purchased from Beijing Yuanjingtai Biotechnology Co., Ltd. The colloidal gold test strip of the present invention is prepared by Beijing Yuanjingtai Biotechnology Co., Ltd. The colloidal gold reaction principle is shown in Figure 1 . There is an anti-fluorescent antibody on the sample plate of the test strip, and when the sample is loaded, it will flow with the target DNA containing the fluorescent group along with the liquid toward the detection line; the present invention is designed to modify the primer with two groups, so the amplified target protein has these two groups at the 5' end. There is a hapten (biotin / digoxigenin) binding line on the test strip, and the target protein containing both the biotin / digoxigenin group and the fluorescent group will bind to this binding line and develop color. If the loading solution does not contain the labeled target protein, then even if the solution contains other proteins, it will not develop color at the biotin / digoxigenin binding site. However, the anti-fluorescent group antibody on the sample plate will bind to the quality control (control) line and develop color, and the result is negative. Therefore, the control line must be colored. If it is not colored, it means that there is a problem with the test strip and the test strip needs to be replaced and retested.

[0055] In the present invention, the colloidal gold test strip delivered to Beijing Yuanjingtai Biotechnology Co., Ltd. is preferably a card box structure. After the microfluidic PCR reaction is completed, the microfluidic chip is preferably installed in the card slot on the back of the card box. The specific process is as follows: Figure 2 In the present invention, after the microfluidic PCR reaction is completed, the reaction solution in the microfluidic chip can also be added dropwise to the sample loading position of the colloidal gold test strip to perform a color development reaction. Alternatively, the reaction solution is taken, and the sample loading position of the colloidal gold test strip is inserted into the reaction solution to perform a color development reaction.

[0056] The Nipah virus microfluidic PCR-colloidal gold detection kit of the present invention preferably also includes an RNA positive reference, and the RNA positive reference is preferably prepared by the following steps: amplifying the above-mentioned positive reference plasmid with universal primer M13, performing gel recovery to obtain a target fragment containing a T7 promoter, and then in vitro transcribing the linear fragment to obtain RNA of the target fragment, and purifying to obtain an RNA positive reference, wherein the nucleotide sequence of the RNA positive reference of NiV-G is shown in SEQ ID NO.17, and the nucleotide sequence of the RNA positive reference of NiV-P is shown in SEQ ID NO.18.

[0057] The present invention also provides a non-diagnostic Nipah virus microfluidic PCR-colloidal gold detection method, which preferably includes the following steps: adding a reaction system containing a sample RNA to be tested and a modified primer group to a sample addition well of a microfluidic chip, reacting using a microfluidic PCR instrument, and after the reaction is completed, using a colloidal gold test strip for detection, if both the test line and the quality control line are colored as positive, or only the quality control line is colored as negative, if the quality control line does not color, the result is deemed invalid and needs to be retested.

[0058] The present invention has no particular limitation on the specific method of obtaining the RNA of the sample to be tested, and any conventional nucleic acid extraction method in the art can be used. In the present invention, the reaction system is based on a volume of 20 μL, and the ratio of each raw material is preferably as shown in Table 1.

[0059] Table 1 Reaction system

[0060] Reagent name volume Enzyme mixture 1μL Buffer mixture 14μL Template (sample to be tested) 5μL

[0061] The specific ratio of the enzyme mixture in Table 1 is preferably shown in Table 2, and the specific ratio of the buffer mixture in Table 1 is preferably shown in Table 3.

[0062] Table 2 Enzyme mixture (50 times) formula

[0063] Reagent name Specification volume Taq DNA Polymerase-Glycerol-free 5U / μL 10-15 μL Mutiscript Reverse Transcriptase II-Glycerin Free 200 U / μL 5-10 μL RNasin-Glycerin Free 40 U / μL 7-12 μL Heat-labileUracil-DNAGlycosylase-1Glycerol-free 1U / μL 10~20μL

[0064] Table 3 Buffer mixture (detection buffer) (50 times) formula

[0065]

[0066]

[0067] The present invention has no particular limitation on the specific sources of the above raw materials, and any commercially available products in the art can be used. When the reaction system containing the sample RNA to be tested and the modified primer set is added to the sample well of the microfluidic chip, the microfluidic chip is arranged as follows: Figure 3 The microfluidic PCR instrument used in the present invention was purchased from Beijing Yuanjingtai Biotechnology Co., Ltd. Figure 4 After the microfluidic PCR reaction is completed, the colloidal gold test strip is used for detection, and the result is determined as follows Figure 5 As shown in the figure, if both the test line (T) and the quality control line (C) are colored as positive, only the quality control line (C) is colored as negative, if the quality control line (C) does not show color, the result is considered invalid and needs to be retested.

[0068] In the present invention, when the modified primer set used is the modified primer set of group 1 primers, the reaction program of the microfluidic PCR instrument is preferably: 55°C 5min; 95°C 150s, 1 cycle; 95°C 5s, 60°C 20s, 35 cycles. When the modified primer set used is the modified primer set of group 2 primers, the reaction program of the microfluidic PCR instrument is preferably: 55°C 5min; 95°C 150s, 1 cycle; 95°C 5s, 55°C 20s, 35 cycles.

[0069] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0070] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0071] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. All markers in the figures involved in the following examples are 2000 bp.

[0072] Example 1

[0073] Preparation of common PCR positive reference

[0074] Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize a plasmid strain (top10 Escherichia coli of pUC57 vector) containing the G and P gene sequences of Nipah virus as a standard. Since the strain prepared by the company did not contain T7 promoter, in vitro transcription was required later. Therefore, the plasmid (Novozymes, DC201-01) containing the NiV-G and NiV-P gene sequences synthesized by the company was extracted, and the plasmid was used as a template to amplify the target fragment with Niv-g-all-fr (SEQ ID NO.5, SEQ ID NO.6) and Niv-P-all-fr (SEQ ID NO.7, SEQ ID NO.8) primers. KOD enzyme was used for amplification: the reaction system was 12.5 μL: upstream and downstream primers: 0.5 μL, template 1 μL, water 10.5 μL; reaction procedure: 98°C, 3 min for a total of one cycle; 98°C, 10 s, 55°C, 5 s, 68°C, 7 s for a total of 35 cycles; 72°C, 5 min. Then run agarose gel electrophoresis for gel recovery; use TransGen's pEasy-Blunt (CB101) as the cloning vector and Trans1-T1Phage competent to prepare a positive reference (Trans T1 phage Escherichia coli containing the target gene). The constructed positive reference was extracted with a plasmid extraction kit (Novozyme, DC201-01) and sent to Bioengineering for sequencing verification. The sequencing results were compared and analyzed using MegAlign software. The results are as follows Figure 6 and Figure 7 As shown, no base changes occurred. In addition, the following aspects were identified:

[0075] The morphology and biochemical characteristics are Gram-negative straight rods. Gram-stained microscopic observations show small red rods with blunt ends and a size of about 0.4-0.7 μm × 2-3 μm ( Figure 8 ), which is consistent with the staining characteristics of Escherichia coli.

[0076] The results of biochemical identification are shown in Table 4 . The trisaccharide iron base and slant of NiV-P and NiV-G strains were yellow, they fermented glucose and produced gas, fermented maltose and rhamnose, were urease negative, MR positive, and VP negative, which was consistent with the biochemical characteristics of E. coli.

[0077] Table 4 Biochemical identification characteristics of bacterial strains

[0078] Bacteria Glucose gas production maltose Rhamnose <![CDATA[H2S]]> Urease MR VP TSI NiV-P + + + - - + - yellow NiV-G + + + - - + - yellow

[0079] Note: “+” represents a positive result; “-” represents a negative result.

[0080] NiV-P and NiV-G both have ampicillin (Amp+). Cultivation characteristics NiV-P and NiV-G grow faster in LB (Amp+) liquid culture medium. After 12 to 20 hours of culture at 37°C, they are uniformly turbid with sticky precipitates at the bottom of the tube. On LB solid plates (weigh 36g of commercial LB agar powder, add 1L of distilled or deionized water, stir until completely dissolved, then dispense into Erlenmeyer flasks, and sterilize at 121°C for 15 minutes. When the culture medium cools to about 50°C, add Amp at a final concentration of 100μg / ml, mix evenly, pour into a sterile culture dish, and store at 4 to 8°C for later use after solidification) and culture at 37°C for 24 hours, neat edges, round protrusions, shiny, moist, smooth, translucent, grayish-white colonies are formed with a diameter of 2 to 3mm. Black colonies with metallic luster are formed on MacConkey agar plates (55 g of commercial MacConkey agar powder is weighed, and 1 1 of distilled water or deionized water is added. After stirring until completely dissolved, the mixture is dispensed into Erlenmeyer bottles. After being sterilized at 121°C for 15 minutes, the mixture is cooled to about 50°C and poured into sterile culture dishes. After solidification, the mixture is stored at 4-8°C for later use). Fig. 9 As shown; red colonies are formed on the eosin-methylene blue agar plate (weigh 37.5g of commercial eosin-methylene blue agar medium powder, add 1l of distilled water or deionized water, stir until completely dissolved, then dispense into a conical bottle, sterilize at 121℃ for 15 minutes, cool to about 50℃ and pour into a sterile culture dish, and store at 4-8℃ for later use after solidification). Fig.10 shown.

[0081] Molecular biological characteristics: NiV-P and NiV-G were inoculated into LB (Amp+) liquid culture medium, shaken and cultured at 37°C for 12 hours. The obtained bacterial solution was used to extract plasmids (Novozyme, DC201-01) according to the instructions of the plasmid extraction kit. The plasmids were used as templates for PCR and colloidal gold-based microfluidics detection. Clear target bands were visible after agarose gel electrophoresis; there were also positive bands on the colloidal gold bars.

[0082] The above identification results indicate that common PCR positive reference materials containing NiV-P and NiV-G genes were indeed obtained.

[0083] Preparation of microfluidic PCR-colloidal gold positive reference

[0084] The common PCR positive reference prepared above was amplified with universal primer M13, and then recovered with a gel recovery kit (BioFlux, BSC02S1) to obtain the target fragment containing the T7 promoter. The linear fragment was then transcribed in vitro with an in vitro transcription kit (Novozyme TR101-01) to obtain the RNA of the target fragment (as shown in SEQ ID NO.17 and SEQ ID NO.18, respectively), which was purified (nearshore protein No.: S125) and used as a microfluidic PCR-colloidal gold positive reference.

[0085] Example 2

[0086] Nucleic acid extraction: Extract nucleic acid from the sample according to the instructions of the commercially available viral nucleic acid extraction kit (RNA extraction kit, Newbase Biochemical; M062), and use it directly for detection. If the sample is not tested immediately after extraction, store it at -70℃ for future use, and avoid repeated freezing and thawing.

[0087] The extracted nucleic acid was amplified by PCR using NiV-P257-F: TGTCGAACACCCGTGACTG (SEQ ID NO.1) and NiV-P414-R: ATCACTCCACCCTCTCTCAGG (SEQ ID NO.2) primer pairs. The reaction procedure was 95°C, 3min for one cycle; 95°C, 15s, 60°C, 15s, 72°C, 20s for 35 cycles; 72°C, 5min for one cycle. The reaction system was 20μL, including Taq enzyme (Novozyme): 10μL, forward and reverse primers were both 0.2μL, H2O: 4.6μL, and template (sample to be tested): 5μL. After amplification, agarose gel electrophoresis was performed. If a band appeared, it indicated that the sample to be tested contained Nipah virus. If no band appeared, it indicated that the sample to be tested did not contain Nipah virus.

[0088] Example 3

[0089] The difference from Example 2 is that the primer pair used is NiV-G490-F:

[0090] AACCCACTCCCTTTTAGAGA (SEQ ID NO.3) and NiV-G779-R:

[0091] TCACCTCTGTCTAGTACCTCTCC (SEQ ID NO. 4), the reaction procedure is 95° C., 3 min for a total of one cycle; 95° C., 15 s, 55° C., 15 s, 72° C., 20 s for a total of 35 cycles; 72° C., 5 min for a total of one cycle, and the rest are the same as in Example 2. If a band appears, it indicates that the sample to be tested contains Nipah virus, and if no band appears, it indicates that the sample to be tested does not contain Nipah virus.

[0092] Comparative Example 1

[0093] The difference from Example 2 is that the primer pairs used are different, and the rest are the same as Example 2. The specific primers used are: two pairs of primers are designed for the conserved region of the Nipah virus P protein, one pair of primers (denoted as P42-168) is NiV-P42-F: CCCCCTACCAAGAAGGCAAG (SEQ ID NO.9) and NiV-P 168-R: TATTTATCATCAAGTGAGTCGTTGTC (SEQ ID NO.10), and the other pair of primers (denoted as P9-166) is NiV-P9-F:

[0094] TGAAGAACAAGTTAAAGAGATCCCA (SEQ ID NO. 11) and NiV-P 166-R: TCCCCTTTCTTTCTCCTTTCCC (SEQ ID NO. 12).

[0095] Comparative Example 2

[0096] The difference from Example 3 is that the primer pairs used are different, and the rest are the same as Example 3. The specific primers used are: two pairs of primers are designed for the conserved region of Nipah virus G protein, one pair of primers (denoted as F147-349) is NiV-F147-F: AAGCAATCCTCTCACAAAAGACA (SEQ ID NO.13) and NiV-F349-R: CTGCCATTATAACTCCGGC (SEQ ID NO.14), and the other pair of primers (denoted as F762-1009) is NiV-F762-F:

[0097] TGATCTTCTAGAAAGTGACAGCA (SEQ ID NO. 15) and NiV-F1009-R: TCCTCTTTGTAATTAGGCAAAATCC (SEQ ID NO. 16).

[0098] The amplified products of Examples 2 and 3 and Comparative Examples 1 and 2 were subjected to agarose gel electrophoresis. The results are as follows: Fig.11 As shown, it can be seen that the primer pairs of Examples 2 and 3 of the present invention have higher amplification efficiency.

[0099] Example 4

[0100] The difference from Example 2 is that the samples to be tested are replaced by the positive control (the common PCR positive reference obtained in Example 1), the negative control (sterile water), African swine fever virus (ASFV), porcine rotavirus (RV), porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea (PEDV) and porcine transmissible gastroenteritis virus (TGEV), and the rest are the same as in Example 2. The results are as follows Fig.12 As shown, it is shown that the primer pair designed in Example 2 of the present invention has high specificity.

[0101] Example 5

[0102] The difference from Example 3 is that the samples to be tested are replaced by the positive control (the common PCR positive reference obtained in Example 1), the negative control (sterile water), African swine fever virus (ASFV), porcine rotavirus (RV), porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea (PEDV) and porcine transmissible gastroenteritis virus (TGEV), respectively, and the rest are the same as in Example 3. The results are shown in Fig.13 As shown, it is shown that the primer pair designed in Example 3 of the present invention has high specificity.

[0103] Example 6

[0104] Nucleic acid extraction: Extract nucleic acid from the sample according to the instructions of the commercially available viral nucleic acid extraction kit (RNA extraction kit, Newbase Biochemical; M062), and use it directly for detection. If the sample is not tested immediately after extraction, store it at -70℃ for future use, and avoid repeated freezing and thawing.

[0105] The primer pair described in Example 2 is labeled with digoxin and FAM, which is NiV-P257-FX: 5'-dig-TGTCGAACACCCGTGACTG and NiV-P414-RX: 5'6-FAM-ATCACTCCACCCTCTCTCAGG, and the modified primer pair is used to perform microfluidic PCR colloidal gold method to detect the sample to be tested. The microfluidic chip and microfluidic PCR instrument are purchased from Beijing Yuanjingtai Biotechnology Co., Ltd., and the colloidal gold test strip is made by Beijing Yuanjingtai Biotechnology Co., Ltd. The colloidal gold test strip is fixed with nanogold particles labeled with anti-FAM fluorescent group antibody at the upper sample plate, and there is an antibody with anti-FAM fluorescent group antibody at the quality control line, and the detection line is designed as a digoxin hapten binding line.

[0106] Add the reaction system shown in Table 1 containing the sample to be tested and the modified primer to Figure 3In the sample well of the microfluidic chip shown in the figure, turn on the microfluidic PCR instrument, place the chip in the microfluidic PCR instrument, stick an aluminum film to prevent volatilization, cover the lid, and set the reaction program to 55℃ 5min; 95℃ 150s, 1 cycle; 95℃ 5s, 60℃ 20s, 35 cycles. After the reaction is completed, collect the liquid in the chip and use colloidal gold test strips for detection. If both the test line (T) and the quality control line (C) are colored as positive, only the quality control line (C) is colored as negative, and if the quality control line (C) does not color, the result is considered invalid and needs to be retested.

[0107] Example 7

[0108] The difference from Example 6 is that the modified primer set used is obtained by modifying the primers in Example 3, specifically NiV-G490-F: 5'6-FAM-AACCCACTCCCTTTTAGAGA and NiV-G779-R: 5'-dig-TCACCTCTGTCTAGTACCTCTCC, and the reaction program is set to 55°C 5min; 95°C 150s, 1 cycle; 95°C 5s, 56°C 20s, 35 cycles. The rest is the same as Example 6.

[0109] Example 8

[0110] The difference from Example 6 is that the samples to be tested are replaced by the positive control (RNA prepared in Example 1), porcine epidemic diarrhea virus (PEDV), African swine fever virus (ASFV), porcine rotavirus (RV), porcine deltacoronavirus (PDCoV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine transmissible gastroenteritis virus (TGEV), porcine foot-and-mouth disease virus (OZK93) and negative control (sterile water), and the rest are the same as Example 6. The results are as follows Fig.14 After the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are shown in Fig.15 It shows that the modified primer pair of Example 6 of the present invention has high specificity, and the colloidal gold detection result has high accuracy.

[0111] Example 9

[0112] The difference from Example 7 is that the samples to be tested are replaced by the positive control (RNA prepared in Example 1), porcine epidemic diarrhea virus (PEDV), African swine fever virus (ASFV), porcine rotavirus (RV), porcine deltacoronavirus (PDCoV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine transmissible gastroenteritis virus (TGEV), porcine foot-and-mouth disease virus (OZK93) and negative control (sterile water), and the rest are the same as Example 7. The results are as follows: Fig.16 and Fig.17After the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are shown in Fig.18 and Fig.19 It shows that the modified primer pair of Example 7 of the present invention has high specificity, and the colloidal gold detection result has high accuracy.

[0113] Example 10

[0114] Sensitivity verification of the primer pair described in Example 2

[0115] Plasmids were extracted from the positive bacteria cultured in Example 1 (normal PCR positive reference), the concentration was measured, and the samples were diluted tenfold and used as templates for PCR amplification in Example 2 to check the dilution times at which the band disappeared (negative control was sterile water). The formula for converting the copy number was:

[0116] (6.02×10 23 copies / mol)×(concentration g / μL)×10×10 -9 / (MW g / mol)=copies / μL

[0117] The results are as follows Fig. 20 As shown, the detection limit of the primer pair described in Example 2 is 64.6 copies / μL.

[0118] Embodiment 11

[0119] Sensitivity verification of the primer pair described in Example 3

[0120] Plasmids were extracted from the positive bacteria cultured in Example 1 (normal PCR positive reference), the concentration was measured, and the samples were diluted tenfold and used as templates for PCR amplification as described in Example 3 to see how many times the dilution was required for the band to disappear (negative control was sterile water). The results are as follows: Fig.21 As shown, the detection limit of the primer pair described in Example 3 is 29.65 copies / μL.

[0121] Example 12

[0122] Sensitivity of microfluidic PCR colloidal gold detection using the modified primers described in Example 6

[0123] The microfluidic PCR-colloidal gold positive reference obtained in Example 1 was used as the test sample, the concentration was measured, and the sample was diluted tenfold and used as a template. The method described in Example 6 was used to detect the number of times the colloidal gold test strip test line did not show color (the negative control was sterile water). The results are as follows Fig. 22 After the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are shown in Fig.23The detection limit of the modified primer pair described in Example 6 is 1048 copies / μL.

[0124] Embodiment 13

[0125] Sensitivity of microfluidic PCR colloidal gold detection using the modified primers described in Example 7

[0126] The microfluidic PCR-colloidal gold positive reference obtained in Example 1 was used as the test sample, the concentration was measured, and the sample was diluted tenfold and used as a template to perform the test described in Example 7 to see how many times the dilution was required for the colloidal gold test strip to show no color (the negative control was sterile water). The results are as follows Fig.24 As shown, after the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are as follows Fig.25 The detection limit of the modified primer pair described in Example 7 is 936 copies / μL.

[0127] Embodiment 14

[0128] The RNA templates of the microfluidic PCR-colloidal gold positive reference NiV-G and NiV-P obtained in Example 1 were diluted by 10 -5 After that, the mixture was mixed at a ratio of 1:1 as the test sample, and the tests of Example 6 and Example 7 were carried out simultaneously (the negative control was sterile water), and the reaction program was set to 55°C for 5 min; 95°C for 150 s, 1 cycle; 95°C for 5 s, 58°C for 20 s, 35 cycles. The results are as follows Fig.26 It shows that both modified primers in Example 6 and Example 7 of the present invention can be used to detect Nipah virus with high specificity.

[0129] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer set for detecting Nipah virus, characterized in that: The primer set is at least one of the primers in set 1 and primers in set 2; the nucleotide sequences of the primer pairs in the primers in set 1 are shown as SEQ ID NO. 1 and SEQ ID NO. 2, respectively; The nucleotide sequences of the primer pairs in Group 2 primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

2. A modified primer set for detecting Nipah virus, characterized in that: The primer set according to claim 1 is labeled with a fluorescent group and a hapten.

3. The modified primer set according to claim 2, characterized in that: The fluorescent group includes 6-FAM, and the hapten includes digoxigenin.

4. Use of the primer set according to claim 1 or the modified primer set according to any one of claims 2 to 3 in the preparation of a Nipah virus detection product.

5. A Nipah virus detection kit, characterized in that: The kit comprises the primer set according to claim 1.

6. A Nipah virus microfluidic PCR-colloidal gold detection kit, characterized in that: The kit comprises the modified primer set according to claim 2 or 3, a microfluidic chip and a colloidal gold test strip; the colloidal gold test strip has anti-fluorescent group antibodies fixed on the sample plate, the quality control line has antibodies against the fluorescent group antibodies, and the detection line is designed as a hapten binding line.

7. A non-diagnostic Nipah virus microfluidic PCR-colloidal gold detection method, characterized in that: The method comprises the following steps: adding a reaction system containing a sample RNA to be tested and a modified primer set to a sample addition hole of a microfluidic chip, reacting using a microfluidic PCR instrument, and after the reaction is completed, detecting using a colloidal gold test strip, wherein both the test line and the quality control line are colored as positive, and only the quality control line is colored as negative. If the quality control line does not color, the result is deemed invalid and needs to be retested; the modified primer set is the modified primer set of claim 2 or 3.

8. The method according to claim 7, characterized in that When the modified primer set is the modified primer set of primers in group 1, the reaction program of the microfluidic PCR instrument is: 55°C for 5 min; 95°C for 150 s, 1 cycle; 95°C for 5 s, 60°C for 20 s, 35 cycles.

9. The method according to claim 7, characterized in that: When the modified primer set is the modified primer set of group 2 primers, the reaction program of the microfluidic PCR instrument is: 55°C 5min; 95°C 150s, 1 cycle; 95°C 5s, 55°C 20s, 35 cycles.

10. The method according to claim 7, characterized in that The reaction system is 20 μL, including 1 μL of enzyme mixture, 14 μL of buffer mixture and 5 μL of template.

Images