A dsRNA targeting the RDNCM gene of the grain borer and its application

Abstract

The invention provides a targeted grain borer RDNCM The invention relates to a dsRNA targeting the grain borer and its application, belonging to the technical field of grain reserve pest control. RDNCM The dsRNA of the gene is prepared by a method comprising the following steps: reverse transcribing the total RNA of the rice borer into cDNA, using the cDNA as a template, performing PCR amplification using the primer pair shown in SEQ ID No.1 and SEQ ID No.2, and in vitro transcribing the PCR amplification product into dsRNA, so as to obtain the RDNCM Gene targeting agent. The present invention targets the grain borer RDNCM The dsRNA of the gene can effectively prevent and control the stored grain pest, the grain borer, after application.

Description

Technical Field

[0001] The invention belongs to the technical field of grain reserve pest prevention and control, and specifically relates to a dsRNA targeting the RDNCM gene of the grain borer and an application thereof. Background Art

[0002] Grain storage, with a stable environment and sufficient food, provides an ideal breeding ground for the growth and reproduction of stored grain pests. Grain borers are a common type of small stored grain pests belonging to the order Coleoptera and the family Coleoptera. During the growth and development of grain borers, the large amount of powder produced by their infestation of grain grains will reduce the permeability of the grain pile. At this time, the temperature inside the grain pile will rise, and the grain will become moldy, seriously affecting the quality of the grain and making the grain lose its edible value.

[0003] So far, many regions have found that the grain borer has developed high resistance. As the grain borer's resistance to phosphine increases, in order to achieve the desired insecticidal effect, fumigation can only be carried out by increasing the phosphine concentration. However, studies have shown that in a high-concentration phosphine environment, the grain borer will produce a protective coma, which will greatly reduce the fumigation effect of phosphine. Therefore, in order to effectively prevent and control the grain pest grain borer, especially the highly resistant grain borer strains, new control agents and technologies are urgently needed to ensure food security. Summary of the invention

[0004] The purpose of the present invention is to provide a dsRNA targeting the RDNCM gene of the grain borer, which can effectively prevent and control the grain storage pest grain borer after application.

[0005] The present invention also provides application of the RDNCM gene targeting agent in preventing and controlling the stored grain pest rice borer.

[0006] The purpose of the present invention is achieved by the following technical solutions:

[0007] A dsRNA targeting the RDNCM gene of the grain borer is prepared by a method comprising the following steps: reverse transcribing the total RNA of the grain borer into cDNA, using the cDNA as a template and the primer pair shown in SEQ ID No.1 and SEQ ID No.2 for PCR amplification, and in vitro transcribing the PCR amplification product into the dsRNA.

[0008] In the present invention, the PCR amplification system includes: 1 μL of cDNA, 0.5 μL of each primer shown in SEQ ID No.1 and SEQ ID No.2, TaKaRa Taq TM PCR Master Mix 12.5 μL and RNase-free water 10.5 μL.

[0009] In the present invention, the PCR amplification procedure includes the following steps: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 58°C for 2 min, extension at 72°C for 3 min, 50 cycles; and extension at 72°C for another 9 min.

[0010] The present invention also provides application of the dsRNA in preventing and controlling the stored grain pest, the grain borer.

[0011] In the present invention, the application comprises the steps of splitting the wheat grains and dripping the dsRNA targeting the RDNCM gene of the grain borer.

[0012] In the present invention, the concentration of the dsRNA targeting the RDNCM gene of P. grain borer is 1900-2100 ng / μL, and the application dosage is 0.7-0.9 μL / wheat grain.

[0013] Beneficial effect: The stored-grain pest, the grain borer, undergoes metamorphosis and is regulated by related genes during its growth and development to complete the process of its larvae transforming into adults. After the dsDNA provided by the present invention is eaten by the larvae of the stored-grain pest, the growth and development regulating function of the RDNCM gene in its body is invalidated, thereby blocking the transformation of the larvae of the stored-grain pest, the grain borer, into adults, achieving the purpose of killing the stored-grain pest, especially effectively preventing and controlling the phosphine-resistant grain borer population, the method is reliable, and the effect is stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is an agarose gel electrophoresis diagram, where M is DNA Marker and 1 is the target gene amplification product. DETAILED DESCRIPTION

[0015] The present invention does not specifically limit the method for extracting total RNA, as long as the OD value of the extracted RNA is 260 / OD 280 It can be within the range of 1.8 to 2.2. In the embodiment, the insect RNA column extraction kit (purchased from Beijing Biolab Technology Co., Ltd.) is used to extract total RNA according to the instructions, but it cannot be identified as the entire protection scope of the present invention.

[0016] The present invention also has no particular limitation on the method of reverse transcription of RNA into cDNA, and the method can be performed using conventional methods in the art. For example, in the embodiment of the present invention, the cDNA of Nanjing Vazyme Co., Ltd. is used. II 1st Strand cDNA Synthesis Kit (+gDNAwiper) was used to synthesize the first strand of cDNA.

[0017] Example 1 Test insect phosphine resistance determination

[0018] The collected test grain borers (Table 1) were tested for their resistance to phosphine using the drainage method apparatus and method recommended by the Food and Agriculture Organization of the United Nations (hereinafter referred to as FAO) (Anonymous. Recommended Methods for the Detection and Measurement of Resistance of Agricultural Pests to Pesticides. Teantative Method for Adults of Some Major Pest Species of Stored Cereals, with MethylBromide and Phosphine [J]. FAO Plant Protection Bulletin, 1975, 23: 12-25.).

[0019] PH3 gas is produced by the reaction of zinc phosphide and 10% sulfuric acid.

[0020] The method of phosphine resistance determination of stored grain pests recommended by FAO was used to detect rice borers, including the following steps: 50 rice borer adults selected from the same population were placed in each fumigation bottle, sealed with a high vacuum silicone grease glass stopper, phosphine gas was extracted using a syringe, and the gas was injected into the bottle from the rubber stopper, and placed in a constant temperature and humidity incubator at (30±1)℃, RH 75%±5%, and no light for about 20 hours of closed fumigation. The concentration of phosphine was then calculated according to the volume of the fumigation bottle and the volume of phosphine gas injected. Three replicate groups were set for each concentration, and the same volume of air was injected as a control. After the fumigation time is over, open the glass stopcock of the fumigation bottle in the fume hood, leave it for about 1 hour to allow the gas to fully dissipate, then take the test insects out of the fumigation bottle and put the grain borer into an incubator with sufficient feed for observation for 14 days. Use a brush to lightly touch the tail of the insect body. The adult insects with motionless limbs are regarded as dead test insects. Record the mortality rate of the test insects in each concentration group, and calculate the resistance coefficient of the grain borer according to the resistance calculation formula (Wang Jinglei, Wang Dianxuan, Xiao Yabin, et al. Determination of resistance of grain pests to phosphine in Liaoning Province and research on countermeasures [J]. Grain and Feed Industry, 2014(9):16-18+23.).

[0021] A resistance coefficient Rf less than 5 is judged as a non-resistant population (sensitive population), a resistance coefficient Rf greater than or equal to 5 and less than 40 is judged as a resistant population, a resistance coefficient Rf greater than or equal to 40 and less than or equal to 160 is judged as a highly resistant population, and a resistance coefficient Rf greater than 160 is judged as an extremely highly resistant population.

[0022] The results of the test population determination of the grain borer are shown in Table 1.

[0023] Table 1 Resistance coefficients and resistance levels of various populations of tested grain borer

[0024] Serial number source Phosphine resistance coefficient Rf Resistance level 1 Grain depot 4.00 No resistance 2 Processing Plant 57.15 High resistance 3 Processing Plant 1173.63 Very high resistance

[0025] Example 2

[0026] 1. Test insect culture

[0027] Whole wheat flour (the moisture content of whole wheat flour is controlled at 15% ± 1%) and yeast powder are mixed at a mass ratio of 19:1 to obtain feed for cultivating rice borers. The rice borers in Table 1 are cultivated as test insects. The test insect cultivation environment is a constant temperature and humidity incubator with a temperature of 30℃ ± 1℃, a relative humidity of 70% ± 5%, and no light. The eclosing rice borer adults (cultivated in the same batch, the same age) are selected for subsequent experiments.

[0028] 2. Total RNA extraction from test insects

[0029] Take 10 heads of each of the non-resistant, highly resistant, and extremely highly resistant adults of the grain borer obtained by the cultivation of the title 1 of this embodiment, and extract the total RNA according to the instructions of the insect RNA column extraction kit (purchased from Beijing Biolab Technology Co., Ltd.). The grinding rods, tweezers and other consumables and tools used in the experiment were sterilized and dried, and the clean bench and pipette were wiped with 75% alcohol. The whole experiment was sterile and standardized. The total RNA solution extracted from the non-resistant, highly resistant, and extremely highly resistant adults of the grain borer was placed in a -80°C ultra-low temperature refrigerator for storage.

[0030] 3. Agarose gel electrophoresis detection

[0031] The total RNA extracted above was subjected to agarose gel electrophoresis. The results showed that the RNA bands were clear and bright, and no diffuse degradation was found. The OD value of the extracted RNA was measured by a nucleic acid concentration meter. 260 / OD 280 All of them were within the range of 1.8 to 2.2, indicating that the RNA had good integrity and high purity without degradation, and could be used as a template for cDNA synthesis for subsequent experiments.

[0032] 4. Synthesis of the first strand of cDNA

[0033] The RNA of non-resistant, highly resistant and extremely resistant rice borer extracted above was used as template and the RNA of II 1st Strand cDNA Synthesis Kit (+gDNAwiper) was used to synthesize the first strand of cDNA. The obtained cDNA was stored in a -20°C refrigerator for later use.

[0034] 5. Gene sequencing

[0035] The cDNA obtained in Title 4 of this Example was used as a template, and RD-F and RD-R were used as primers to perform PCR amplification on the RDNCM gene of the rice borer to identify the cDNA.

[0036] Among them, RD-F: GAAAGACCCTCATCAAATCGG; RD-R: CAGCCACTAACGCAGCATA.

[0037] The PCR reaction used 2×Taq Master Mix DNA amplification enzyme system (purchased from Nanjing Novozyme Biotechnology Co., Ltd.). The reaction system was: cDNA 2μL, RNase-free water 8.5μL, Taq PCR Master Mix 12.5μL, RD-F 1μL and RD-R 1μL. The reaction program was: 95℃ pre-denaturation for 2min; 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 2min, 35 cycles; 72℃ extension for 10min.

[0038] The obtained PCR product was sent to Shanghai Sangon Biotech Co., Ltd. for gene sequencing and compared with the RDNCM gene in the Omicshare database (number Unigene0044157). The results showed that it was consistent with the gene sequence of the grain borer.

[0039] 6. Synthesis of dsRNA

[0040] In order to obtain dsRNA that can kill rice borers, dozens of primer pairs were designed for the RDNCM gene, and only primer pair 1 had a very good effect. 25 of the primer pairs are listed in Table 2.

[0041] Using the cDNA synthesized in Title 4 of this Example as a template, PCR amplification was performed using the primer pairs in Table 2 to obtain PCR amplification products. Then, Promega's T7 RiboMAX TM The PCR amplification product was transcribed in vitro to synthesize dsRNA using the Express RNAi System kit.

[0042] The following description will be made taking primer pair 1 as an example.

[0043] PCR amplification system: template (cDNA) 1 μL, primers M1-F and M1-R 0.5 μL each, TaKaRa Taq TM PCR MasterMix 12.5μL and RNase-free water 10.5μL. TM PCR Master Mix was purchased from TaKaRa.

[0044] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 58°C for 2 min, extension at 72°C for 3 min, 50 cycles; and extension at 72°C for another 9 min.

[0045] The PCR amplification product obtained using primer pair 1 was subjected to agarose gel electrophoresis. Figure 1 As shown in the figure, there is a specific target gene band at a molecular weight of 425 bp, which is clear and bright, consistent with expectations. The PCR amplification product was recovered using the DNA purification kit MiniBESTDNA Fragement Purification Kit Ver.4.0 (purchased from TaKaRa), and the OD value of the PCR amplification product was measured by a nucleic acid concentration meter. 260 / OD 280 It was 1.86, indicating that the amplified target gene had good integrity and high purity and could be used for subsequent experiments.

[0046] The PCR product obtained by primer pair 1 was purified by using Promega's T7 RiboMAX TM The Express RNAiSystem kit was used to synthesize dsRNA by in vitro transcription, and the specific method was carried out according to the operating instructions of the kit.

[0047] The dsRNA obtained corresponding to primer pair 1 consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID NO: 3, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID NO: 3.

[0048] Table 2 Information of primers designed for dsRNA synthesis

[0049]

[0050]

[0051] 7. Inspection of medication and feeding

[0052] (1) Wheat kernel treatment: The dsRNA obtained from the 25 primer pairs in Table 2 was adjusted to a concentration of 2000 ng / μL using RNase-free water and added dropwise to wheat kernels cut open with a sterile scalpel, with an application dose of 0.8 μL / wheat kernel.

[0053] (2) Preparation of test insects. Take 100 newly emerged adults of the non-resistant, highly resistant, and extremely highly resistant varieties in Example 1, place them in a constant temperature and humidity incubator containing 250 g of the feed prepared in Example 1, and lay eggs for 1 week at 30°C ± 1°C, relative humidity 70% ± 5%, and no light, and collect the eggs of the grain borer.

[0054] (3) Application and feeding. Take 120 eggs of each of the non-resistant, highly resistant, and extremely resistant grain borer species and place them together with 400 grains of wheat treated with each dsRNA in a sterilized feeding bottle. Culture them in a constant temperature and humidity incubator at 30°C ± 1°C, relative humidity 70% ± 5%, and no light for 66 days. Then open the bottles and check the number of live grain borer adults.

[0055] The wheat grains and rice borer egg culture groups without dsRNA treatment were used as the control group.

[0056] Based on the mortality of adults of P. pygmaea in each treatment group and that of adults of P. pygmaea in the control group, the mortality rate was corrected according to the Abbott formula to test the killing effect of the above-mentioned synthesized dsRNA on P. pygmaea.

[0057]

[0058] The control effects of dsRNA obtained from 25 primer pairs on the stored grain pest Pyralis pyralis are shown in Table 3. Among them, the dsRNA obtained from primer pair 1 had a corrected mortality rate of 100% on the stored grain pest Pyralis pyralis, which was significantly higher than that obtained from other primer pairs.

[0059] Table 3 Effects of primer pairs in preparing gene-targeted agents on the control of rice borers

[0060]

[0061]

Claims

1. A dsRNA, characterized in that The method comprises the following steps: reverse transcribing the total RNA of the grain borer into cDNA, taking the cDNA as a template and adopting the primer pair shown in SEQ ID No.1 and SEQ ID No.2 to perform PCR amplification, and in vitro transcribing the PCR amplification product into the dsRNA; the dsRNA consists of a sense chain and an antisense chain, the nucleotide sequence of the sense chain is SEQ ID NO:3, and the nucleotide sequence of the antisense chain is the reverse complementary sequence of SEQ ID NO:

3.

2. The dsRNA according to claim 1, characterized in that The PCR amplification system includes: 1 μL of cDNA, 0.5 μL of primers shown in SEQ ID No. 1 and SEQ ID No. 2, 12.5 μL of TaKaRa Taq™ PCR Master Mix, and 10.5 μL of RNase-free water.

3. The dsRNA according to claim 2, characterized in that The PCR amplification procedure includes the following steps: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 2 min, annealing at 57°C for 2 min, extension at 72°C for 3 min, 60 cycles; and extension at 72°C for 10 min.

4. Use of the dsRNA according to claim 1 in controlling the stored-grain pest, Mytilus edulis, wherein the stored grain is wheat.

5. The use according to claim 4, characterized in that The method comprises the steps of splitting wheat kernels and dripping the dsRNA according to any one of claims 1 to 3.

6. The use according to claim 5, characterized in that The concentration of the dsRNA is 700-900 ng / μL, and the administration dose is 3.2-4.0 μL / grain.

Images