Application of ZmFd3 gene in improving plant resistance to viruses

Abstract

The present invention provides an application of the ZmFd3 gene in improving plant resistance to viruses, and belongs to the technical field of plant genetic engineering. The present invention finds that silencing the ZmFd3 gene can improve plant resistance to viruses, and the ZmFd3‑dsRNA and FPH‑dsRNA of the present invention can reduce the expression of the plant ZmFd3 gene, thereby helping the plant resist MCMV and SCMV infection. The ZmFd3‑dsRNA and FPH‑dsRNA liposomes of the present invention have effective transport capabilities in corn plants, and can prevent dsRNA from degrading in the external environment. At 4 to 28° C., the liposomes are relatively stable. The dsRNA liposomes of the present invention can also effectively reduce the harmful effects of long-term silencing of ZmFd3 on plant growth, providing a new idea for plants to resist MCMV and SCMV infection.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to the application of ZmFd3 gene in improving plant resistance to viruses. Background Art

[0002] Ferredoxin (Fd) is a water-soluble, low molecular weight, acidic electron transfer protein. In plants, Fd mainly obtains electrons from PSI and transfers them to various enzymes associated with it, such as ferredoxin-NADP reductase (FNR), ferredoxin nitrite reductase, sulfite reductase, glutamate synthase, ferredoxin / thioredoxin reductase, etc., and participates in many light-dependent metabolic and regulatory reactions, especially transferring electrons to reduce NADP + The most important mode of action is the role of thioredoxin in carbon assimilation and photoperiod regulation. As the only soluble electron acceptor, Fd plays a unique and important physiological role in the process of photosynthetic electron transfer. Under different environmental conditions, Fd's choice of downstream electron acceptors directly determines the final destination of photosynthetic electrons, allowing organisms to adapt to changes in the environment and growth and development. The ZmFd gene family is the maize ferredoxin gene family, which is a group of genes that regulate maize photosynthesis.

[0003] Plant virus diseases are called plant cancers and account for nearly half of all plant diseases. Plant viruses cannot infect humans and other higher animals, but once crops are infected by plant viruses, the yield and quality will be seriously affected. Maize chlorotic mottle virus disease is a disease caused by maize chlorotic mottle virus (MCMV) that occurs on corn. MCMV infection of corn causes chlorosis and mottles, and in severe cases can cause leaf necrosis. Sugarcane mosaic virus (SCMV) mainly harms leaves, especially the base of new leaves. Once the plant is infected by the virus in the seedling stage, the plant grows short and the leaves show typical chlorosis and mosaic symptoms. When MCMV and some viruses of the Potyviridae family infect corn together (such as SCMV), it will cause a serious corn disease (maize lethal necrosis, MLN), which can cause the death of the entire corn plant and result in total loss of yield.

[0004] RNA interference (RNAi) is a gene silencing mechanism in which double-stranded RNA (dsRNA) induces efficient and specific degradation of homologous RNA. Since RNAi technology can specifically inhibit the expression of specific genes, it can resist plant virus infection. Finding key molecular target genes and obtaining specific and efficient dsRNA fragment sequences are the core of plant virus prevention and control strategies based on RNAi technology. Compared with chemical pesticides, RNA interference technology uses biological means to effectively avoid environmental pollution and is a green, friendly and sustainable means of plant disease prevention and control. However, the effect of the maize ZmFd3 gene on maize resistance to plant viruses has not been reported.

[0005] Nanoliposomes, composed of lipid nanomaterials, are one of the potential options in pesticide delivery systems. Because they have a larger surface area and greater solubility and bioavailability than traditional materials, nanoliposomes are seen as a promising carrier material. However, to date, there have been no reports on the delivery of ZmFd3-dsRNA via nanodelivery systems to control plant viral diseases. Summary of the invention

[0006] The object of the present invention is to provide application of ZmFd3 gene in improving plant resistance to viruses.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides application of ZmFd3 gene in improving plant resistance to viruses, and improves the disease resistance of crops to viruses by inhibiting the expression of ZmFd3 gene.

[0009] Preferably, a vector for suppressing the expression of the ZmFd3 gene is introduced into the plant.

[0010] Preferably, the vector for inhibiting ZmFd3 gene expression includes dsRNA, siRNA, shRNA, CRISPRi, CRISPR / Cas9 vector or virus-mediated gene silencing vector.

[0011] The present invention also provides a ZmFd3-dsRNA for inhibiting the expression of the ZmFd3 gene. The sequence of the ZmFd3-dsRNA is shown in SEQ ID NO.1.

[0012] The present invention also provides an FPH-dsRNA, which inhibits the expression of ZmFd3, SCMV-HC-Pro and MCMV-p7b genes. The sequence of the FPH-dsRNA is shown in SEQ ID NO.18.

[0013] The present invention also provides a dsRNA nucleic acid liposome, wherein the dsRNA nucleic acid liposome is a lipid nanoparticle encapsulating dsRNA, and the dsRNA includes the ZmFd3-dsRNA or the FPH-dsRNA.

[0014] Preferably, the dsRNA nucleic acid liposome comprises a cationic liposome or an anionic liposome.

[0015] The application of the ZmFd3-dsRNA or the FPH-dsRNA in plant anti-virus.

[0016] The invention also provides application of the dsRNA nucleic acid liposome in plant anti-virus.

[0017] Preferably, a solution containing the dsRNA nucleic acid liposome is sprayed onto the plants, wherein the solution contains 50-100 μg of the dsRNA nucleic acid liposome.

[0018] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention first discovered that silencing the ZmFd3 gene can improve the resistance of plants to viruses, and the ZmFd3-dsRNA and FPH-dsRNA of the present invention can reduce the expression of the plant ZmFd3 gene, thereby helping the plant resist MCMV and SCMV infection. The ZmFd3-dsRNA and FPH-dsRNA liposomes of the present invention have effective transport capabilities in corn plants and prevent dsRNA from being degraded in the external environment. The liposomes are relatively stable at 4 to 28°C. The dsRNA liposomes of the present invention can also effectively reduce the harmful effects of long-term silencing of ZmFd3 on plant growth, providing a new idea for plants to resist MCMV and SCMV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The effect of silencing ZmFd3 on MCMV and SCMV infection (p<0.05; **, p<0.01; ***, p<0.001), where:

[0020] A shows the leaves of CMV-ZmFd3 corn and CMV-GFP control corn infected with SCMV and MCMV viruses for 6 days;

[0021] B is the relative accumulation of SCMV / MCMV RNA in CMV-ZmFd3 corn and CMV-GFP control corn after infection with MCMV and SCMV viruses for 6 days;

[0022] C is the expression level of SCMV / MCMV coat protein in CMV-ZmFd3 corn and CMV-GFP control corn after infection with MCMV and SCMV viruses for 6 days;

[0023] D is the relative expression level of ZmFd3 gene in CMV-ZmFd3 corn and CMV-GFP control corn after infection with SCMV and MCMV viruses for 6 days.

[0024] Figure 2 These are the heights of 18-day-old CMV-ZmFd3 plants and 18-day-old CMV-GFP and CMV-ZmFd3 plants, where: A is the height of 18-day-old CMV-ZmFd3 plants; B is the height of 18-day-old CMV-GFP and CMV-ZmFd3 plants.

[0025] Figure 3 This is the electrophoresis detection diagram of in vitro synthesized ZmFd3-dsRNA.

[0026] Figure 4 is the silencing efficiency of ZmFd3-dsRNA in tobacco leaves, wherein: A is the silencing efficiency of ZmFd3-dsRNA in tobacco leaves under confocal microscope; B is the silencing efficiency of ZmFd3-dsRNA analyzed by protein blotting.

[0027] Figure 5 This is a diagram of the synthesis model of dsRNA@CLPs / ALPs.

[0028] Figure 6 Transmission electron microscopy images of CLPs, ALPs, ZmFd3@CLPs, and ZmFd3@ALPs.

[0029] Figure 7 Particle size, dispersity index and Zeta potential of CLPs, ALPs, ZmFd3@CLPs and ZmFd3@ALPs.

[0030] Figure 8 The electrophoresis diagrams of ZmFd3-dsRNA, ZmFd3@CLPs and ZmFd3@ALPs after nuclease treatment for 0.5h and 1h.

[0031] Fig. 9 The storage conditions of ZmFd3@CLPs and ZmFd3@ALPs at 4, 28 and 37°C, respectively, where: A is the average size change; B is the polydispersity index change; C is the Zeta potential change; D is the transmission electron microscopy image of ZmFd3@ALPs stored at 37°C for 21 days.

[0032] Fig.10 The morphologies of ZmFd3@CLPs and ZmFd3@ALPs (diluted 5-fold) stored at 4, 28, and 37°C for 21 days.

[0033] Fig.11 Confocal micrographs of roots, second leaves, and systemic leaves of plants 12 h after application of ZmFd3@CLPs / ALPs using the leaf rubbing or root immersion method.

[0034] Fig.12 Confocal micrographs of roots, second leaves, and systemic leaves of plants 24 h after application of ZmFd3@CLPs / ALPs using the leaf rubbing or root immersion method.

[0035] Fig.13 Confocal micrographs of roots, secondary leaves and systemic leaves 12 h and 24 h after ZmFd3-dsRNA was applied to plants using the leaf rub or root dunking method.

[0036] Fig.14 This is the infection status of the first systemic leaf of corn leaves sprayed with ZmFd3@CLPs / ALPs when corn was co-infected with SCMV and MCMV, wherein: A is the symptom of the first systemically infected leaf of the corn plant on the 6th day after the co-infection of SCMV and MCMV; B is the accumulation of MCMV and SCMV CP proteins in the corn plant on the 6th day after the co-infection of SCMV and MCMV; C~E are the accumulation of MCMV and SCMV RNA and the expression level of ZmFd3 in the corn plant on the 6th day after the co-infection of SCMV and MCMV.

[0037] Fig.15 The figures show the growth and plant height of corn plants treated with different liposomes for 6 days, wherein: A shows the growth of corn plants treated with different liposomes for 6 days; B shows the height of corn plants treated with different liposomes for 6 days.

[0038] Fig.16 This is the yeast two-hybrid result of the interaction between ZmFd3 and viral protein.

[0039] Fig.17 The BiFC results of ZmFd3 interacting with HC-Pro and p7b respectively.

[0040] Fig.18 is the resistance of corn leaves sprayed with FHP@CLPs / ALPs to MCMV and SCMV combined infection, where: A is the symptom of the first systemically infected leaf of the corn plant on the 6th day after SCMV and MCMV combined infection; B is the accumulation of MCMV and SCMV CP proteins in the corn plant on the 6th day after SCMV and MCMV combined infection; C-E are the accumulation of MCMV and SCMV RNA in the corn plant and the expression of ZmFd3 on the 6th day after SCMV and MCMV combined infection; F is the plant status of corn with different treatments to MCMV and SCMV combined infection on the 9th to 21st day after SCMV and MCMV combined infection; G is the mortality rate of corn plants with different treatments on the 9th to 21st day after SCMV and MCMV combined infection.

[0041] Fig.19 The resistance of sorghum sprayed with FPH@CLPs / ALP to SCMV, where: A is the incidence of mosaic symptoms in sorghum plants of different groups; B is the condition of sorghum leaves in different groups; and C is the western blot test result.

[0042] Fig. 20A diagram showing the synthesis pattern and mode of action of dsRNA@CLPs / ALPs, wherein: A is a diagram showing the synthesis pattern of dsRNA@CLPs / ALPs, and B is a diagram showing the mode of action of dsRNA@CLPs / ALPs. DETAILED DESCRIPTION

[0043] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0044] Example 1 Silencing ZmFd3 is beneficial for plants to resist MCMV and SCMV infection

[0045] 1. Construction of a CMV-ZmFd3 silencing vector specifically targeting the ZmFd3 gene

[0046] Reverse transcription-polymerase chain reaction (RT-PCR) was used to amplify the CDS sequence of maize ZmFd3 (Zm00001d034760).

[0047] The ID number of the ZmFd3 gene of the present invention in GenBank is: Zm00001d034760.

[0048] PCR amplification was performed using CMV-ZmFd3-F / R as primers and the genomic sequence of corn B73 as a template. The target fragment was a partial fragment (138 bp) of ZmFd3 cDNA, as shown in SEQ ID NO.1.

[0049] SEQ ID NO.1:

[0050] TTCGCTACTTCCTGCACGCTGTTGGGGCAATGTTAGAACAACGCAGGCCTCCCAGACAGCGGTGAAGAGCCCTTCGTCTCTAAGCTTCTTCAGCCAAGTTACGAAGGTTCCAAGCCTGAAGACCTCCAAGAAACTGGAT

[0051] Table 1 Primers for amplifying partial fragments of ZmFd3 cDNA

[0052]

[0053] Amplification system: 1 μl cDNA; 0.5 μl / 0.5 μl forward and reverse primers (CMV-ZmFd3-F / R); 10 μl PrimeSTARMax Premix;

[0054] 8 μl ddH2O.

[0055] Amplification program: 98°C for 10 sec; 55°C for 5 sec; 72°C for 5 sec. 30 cycles.

[0056] After amplifying the 138 bp target fragment, the ZMBJ-CMV-2bN81 plasmid was double-digested with Kpn I and Xba I, and the 138 bp fragment of ZmFd3 was inserted into the ZMBJ-CMV-2bN81 vector by homologous recombination to obtain a recombinant vector.

[0057] The enzyme digestion system is: 4 μl ZMBJ-CMV-2bN81 vector; 1 μl / 1 μl Kpn I and Xba I restriction endonucleases; 2 μl 10X buffer; 12 μl ddH2O.

[0058] The homologous recombination reaction system was: 8 μl linearized ZMBJ-CMV-2bN81 vector; 2 μl recovered amplified fragment; 4 μl 5×CE II Buffer; 2 μl Exnase II; 4 μl ddH2O.

[0059] The GFP sequence of the same length was cloned into the vector as a control (primers: CMV-GFP-F / R), as shown in Table 2.

[0060] Table 2 CMV-GFP-F / R Primers

[0061]

[0062] 2. Agrobacterium Transformation

[0063] Thaw the Agrobacterium GV3101 competent cells stored at -80℃ on ice; add 1μg of plasmid to the thawed 50μL competent cells, mix gently, and place on ice for 10 minutes; after the ice bath, quickly freeze the competent cells in liquid nitrogen for 5 minutes; place the centrifuge tube in step 3 in a 37℃ water bath for 5 minutes; after the water bath, place on ice for 5 minutes; add 800μL LB liquid culture medium, and culture at 200rpm at 28℃ for 2-3 hours; place the centrifuge tube in a centrifuge at 5,000rpm for 1 minute, and retain 100μL to spread on the LB culture medium plate containing 50μg / mL Kan and Rif.

[0064] 3. Agrobacterium Infiltration

[0065] Pick a freshly streaked or plated Agrobacterium monoclone and place it in a 1.5mL centrifuge tube with 1mL of LB liquid medium containing 50μg / mL Kan and Rif in advance, and then place it in a 28℃ shaker at 170rpm overnight culture for 10-16h. In a sterile operating table, take 80μL of freshly cultured bacterial solution and add it to a 50mL centrifuge tube containing 15mL of LB liquid medium containing 50μg / mL Kan and Rif, and place it in a 28℃ shaker at 180rpm overnight culture for 12-16h. Centrifuge at 5,000rpm for 15min at room temperature, pour off the supernatant to collect the bacteria, and suspend them in infiltration buffer (10mmol / L MgCl2, 10mmol / L MES, 100μmol / LAS). The infiltration buffer is a blank control. Use a spectrophotometer to adjust the bacterial solution concentration to OD600 of 1.0, and then stand at room temperature in the dark for induction for 3-5h. Take the Agrobacterium after the static period, mix the three plasmids pCMV101, pCMV201-2bN81:: insert fragment (recombinant vector) and pCMV301 in a ratio of 1:1:1 [the three vectors are the three components of the virus (RNA1, RNA2, RNA3), and they can only play a silencing role when they are expressed at the same time], and use pCMV201-2bN81 mixed with GFP220 as a negative control. Inject the above fully mixed Agrobacterium into the 3rd and 4th true leaves of Nicotiana benthamiana that have grown to the 5-6 leaf stage and are fully expanded.

[0066] pCMV101 and pCMV301 plasmids were prepared according to the literature R. Wang, X. Yang, N. Wang, X. Liu, R. S. Nelson, W. Li, Z. Fan, T. Zhou, An efficient virus-induced gene silencing vector for maize functional genomics research, Plant J. 86 (1) (2016) 102-115. https: / / doi.org / Methods in 10.1111 / tpj.13142. preparation.

[0067] 4. CMV-VIGS needle-piercing corn

[0068] (1) Take Nicotiana benthamiana leaves infiltrated with Agrobacterium tumefaciens of the ZMBJ CMV-VIGS vector system for 3 days;

[0069] (2) Weigh the inoculated leaves and add 0.01 M phosphate buffer (stored in a refrigerator at 4°C) at a ratio of 1.5:10 (w / v);

[0070] (3) Use liquid nitrogen to pre-cool the mortar, add a little quartz sand and grind thoroughly. Transfer the homogenate to a new 1.5 mL centrifuge tube, centrifuge at 3,000 rpm for 5 min at 4°C, and carefully collect the supernatant.

[0071] (4) Select B73 corn seeds with suitable flatness, 50 seeds for each treatment, soak the seeds in deionized water at room temperature for 40 min, and place them on a tray covered with moistened absorbent paper with the embryo facing upward;

[0072] (5) Use a pipette to drop 15 μL of crude virus extract onto the embryo of the seed, and use three rows of inoculation needles on both sides of the embryo to insert 1 to 2 mm into the seed at a 60° angle. Mark the corn seeds with different treatments in advance, seal the tray with plastic wrap to keep it moist, and place it in an incubator at 25°C in the dark for 3 days;

[0073] (6) Select the corn seeds that have germinated and are growing uniformly, and carefully plant them in nutrient soil (because the seeds need to be handled carefully at this time because of embryo formation), and continue to place them in a light incubator for cultivation. The culture conditions are changed to 16h / 20℃ light and 8h / 18℃ darkness.

[0074] 5. Challenge the poison:

[0075] The corn that had been subjected to VIGS was cultured in an incubator for 12 to 14 days, and the first fully expanded true leaf was selected for challenge inoculation with crude virus extracts of SCMV, MCMV, and SCMV+MCMV for friction inoculation. The inoculated corn plants were placed under 16h / 24℃ light and 8h / 22℃ dark culture conditions for further culture, and the silencing efficiency of ZmFd3 and the corresponding accumulation of SCMV and MCMV RNA and viral capsid protein were detected 6 days after SCMV, MCMV, and SCMV+MCMV inoculation.

[0076] (1) Western blot determination of viral coat protein accumulation

[0077] a. Take fresh leaves or leaves stored in a -80℃ refrigerator, and grind them thoroughly in a mortar pre-cooled with liquid nitrogen. Add lysis solution at a ratio of 0.1g leaf powder to 1mL lysis solution (the final concentration of PMSF is 1mM). Lyse on ice for 15min. Transfer it to a rotary mixer and mix at 4℃ for 2h. After lysis, centrifuge at 14,000g for 5min at 4℃, use a pipette to carefully transfer the supernatant to a sterilized 1.5mL centrifuge tube, and store at -80℃ for later use. Refer to the instructions of the Bio-Tech BCA protein concentration assay to calculate the protein concentration in the sample.

[0078] b. Preparation of protein samples: add appropriate volume of protein solution and 5× SDS-PAGE protein loading buffer in a ratio of 4:1 (v / v), and react in a metal bath at 100°C for 5 min to fully denature the protein;

[0079] c. Add the samples to the loading wells of PAGA gel in sequence and perform electrophoresis at 150V for about 45 to 55 minutes until the bromophenol blue dye runs to the end. End the electrophoresis.

[0080] d. Coomassie Brilliant Blue (CBB) staining: Immerse the gel strip in the prepared Coomassie Brilliant Blue staining solution and stain on a shaker until clear protein bands are visible. Then soak the gel strip in clean water, remove the background, and take a photo against a white background as an internal reference.

[0081] e. Transfer: Cut a PVDF membrane slightly larger than the gel, soak it in methanol for 1-2 minutes to activate it (not too long), then soak the PVDF membrane and gel in the transfer buffer for 5 minutes. Take out the wet transfer instrument clip, use the "sandwich method" to put in the soaked filter paper, PVDF membrane, gel, and soaked filter paper in turn, use tools to carefully remove the bubbles between the PVDF membrane and gel, and transfer the membrane at 120V for 150 minutes;

[0082] f. Blocking: Place the transferred PVDF membrane carefully into a box, add blocking solution (5% BSA) buffer that can completely soak the membrane, and block at room temperature (about 25°C, if the room temperature is too low, the blocking time can be appropriately extended) for 1.5 hours;

[0083] g. Primary antibody incubation: Use monoclonal antibodies diluted in 3% BSA, SCMV primary antibody diluted 5,000 times, MCMV primary antibody diluted 20,000 times. Place the blocked PVDF membrane in the diluted primary antibody and incubate at room temperature for 1.5 hours or at 4°C overnight (more than 12 hours). Wash the PVDF membrane with TBST buffer for 5 minutes, repeat 4 times;

[0084] h. Secondary antibody incubation: Place the PVDF membrane in the secondary antibody diluted 2,000 times with TBST and incubate at room temperature for 1 hour. Wash the PVDF membrane with TBST buffer for 5 minutes, repeat 4 times;

[0085] i. Color development: Remove excess water from the PVDF membrane with absorbent paper, add an appropriate amount of CDP-Star color development solution (a mixture of solution A and solution B in equal proportions), incubate at room temperature in the dark for 5 minutes, and develop the color using the chemiluminescence imaging system of Shanghai Tianneng Life Sciences Co., Ltd. until the bands are clear.

[0086] (2) RT-qPCR detection of relative expression levels of SCMV and MCMV viral genes

[0087] ABI 7500FAST Real Time System real-time fluorescence quantitative PCR instrument was used to detect the relative expression levels of related genes according to the instructions. Primer-blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) and Primer 5 software were used to design RT-qPCR related primers. For specific primers, please refer to the appendix. The expression of ZmUBI gene was used as an internal reference. -ΔΔCt Methods The relative expression levels of genes were calculated. Three replicates were included in each sample for RT-qPCR analysis.

[0088] The reaction system was as follows: 10 μL 2×ChamQ SYBR qPCR Master Mix (LowROX Premixed); 0.45 μL forward / reverse primers (10 μmol·L -1 ); 5 μL sample cDNA; 4.1 μL ddH2O.

[0089] Reaction procedure: step 1 (pre-denaturation), 95°C for 30 sec, 1 cycle;

[0090] Step 2 (cyclic reaction), 95°C for 10 sec, 60°C for 30 sec, 40 cycles;

[0091] Step 3 (melting curve), 95℃ for 15sec, 60℃ for 60sec,

[0092] React at 95°C for 15 seconds, one cycle.

[0093] Western blot and RT-qPCR test results are shown in Figure 1 As shown. Figure 1 It can be seen that compared with the CMV-GFP control group, infection with MCMV and SCMV resulted in reduced yellowing symptoms in the local and systemic infected leaves of ZmFd3-silenced plants ( Figure 1 This is consistent with the significant reduction in the accumulation levels of MCMV or SCMV RNA and viral coat protein in ZmFd3-silenced plants ( Figure 1 In addition, the silencing efficiency of ZmFd3 in silenced plants was 88% and 63%, respectively ( Figure 1 The above results indicate that silencing ZmFd3 is beneficial for plants to resist MCMV and SCMV infection.

[0094] However, compared with the control group, CMV-ZmFd3 plants grown for 18 days showed significant developmental retardation, such as Figure 2As shown. It can be seen that knocking out or reducing the expression of the ZmFd3 gene is beneficial for plants to resist virus infection, but long-term silencing of ZmFd3 has a harmful effect on plant growth, so a ZmFd3-dsRNA liposome delivery solution was constructed.

[0095] Example 3 Synthesis of ZmFd3-dsRNA

[0096] 1. Synthesis of ZmFd3-dsRNA

[0097] Using the siRNA targeting effect of ZmFd3, ZmFd3-dsRNA of the same length as CMV-ZmFd3 was synthesized in vitro. The specific steps were as follows: T7-ZmFd3 / FHP-dsRNA-F and T7-ZmFd3-dsRNA-R were used as primers, as shown in Table 3. The cDNA of the maize inbred line B73 was used as a template for ZmFd3-dsRNA synthesis to amplify the ZmFd3 gene.

[0098] Table 3 ZmFd3-dsRNA synthesis primers

[0099]

[0100] Amplification system:

[0101] 1 μl cDNA; 0.5 μl / 0.5 μl forward and reverse primers (T7-ZmFd3 / FHP-dsRNA-F and T7-ZmFd3-dsRNA-R); 10 μl PrimeSTARMax Premix; 8 μl ddH2O.

[0102] Amplification program: 98°C for 10 sec; 55°C for 5 sec; 72°C for 5 sec. 30 cycles.

[0103] The product was recovered and used as a template for in vitro synthesis.

[0104] In vitro synthesis system: 10×Transcription Buffer 2μl, A / G / C / UTP Solution 2μl each, RNase Inhibitor 0.5μl, T7 RNA Polymerase 2μl, RNase free H2O 6.5μl, the above contains T7 in vitro synthesis template 1μl.

[0105] Reaction procedure: 42℃ for 2h. The electrophoresis results of in vitro synthesized ZmFd3-dsRNA are as follows: Figure 3 As shown, Figure 3 The results showed that the fragment of ZmFd3 gene was 138 bp, which reached the expected length.

[0106] 2. Confocal Laser Scanning to Assess Silencing Efficiency

[0107] The synthesized ZmFd3-dsRNA and Agrobacterium containing the pGD-ZmFd3-EGFP plasmid at OD600 = 1.0 were co-injected into Nicotiana benthamiana leaves. 40 μg or 80 μg of dsRNA was applied to each tobacco leaf, and tobacco leaves without ZmFd3-dsRNA were used as controls. The silencing efficiency was evaluated by laser confocal microscopy three days later. The confocal microscopy results are shown in Figure 2. Figure 4 The results showed that when 40 μg or 80 μg of dsRNA was applied to each tobacco leaf, laser confocal microscopy demonstrated that the silencing efficiency of ZmFd3 reached 55% and 64%, respectively. This result was also confirmed by western blot.

[0108] Example 4 Synthesis of ZmFd3-dsRNA Liposome Nanoparticles (LNPs)

[0109] 1. Synthesis of cationic liposomes (CLPs): 1 mg of ZmFd3-dsRNA prepared in Example 3 was dissolved in 8 mL of nucleic acid-free water for standby use. 23 mg of lecithin, 4 mg of cholesterol, 54.2 mg of 1,2-dioleylpropyltrimethylammonium chloride and 0.8 mg of Cy5.5 fluorescent dye were dissolved in 2 mL of chloroform and 1 mL of anhydrous ethanol by ultrasound. The solution was then introduced into an evaporating flask and mixed at a speed of 20 rpm in a 70 ° C water bath until the chloroform was completely evaporated and a thin film was formed on the flask wall. Then the nucleic acid-free water dissolved with dsRNA was added to the evaporating flask, and the obtained ZmFd3@CLPs were reduced to 17 rpm in a 60 ° C water bath until the LNPs (lipid nanoparticles) film was completely separated from the evaporating flask. Finally, the ultrasonic treatment was performed for 15 min, and the solution was adjusted to a volume of 8 mL.

[0110] 2. Synthesis of anionic liposomes (ALPs): The ALPs adsorption method of dsRNA is as follows: 10 mL of PEI solution (0.484 mg / mL) was gradually added to 100 μl of ZmFd3-dsRNA (0.446 mg / mL), vortexed vigorously for 2 min, and then incubated at room temperature for 15 min. Then, 53 mg of lecithin, 3.4 mg of DMPG, 24.2 mg of CHEMS, and 0.8 mg of Cy5.5 were dissolved in 2 mL of chloroform and 1 mL of anhydrous ethanol by ultrasound. The subsequent steps were consistent with ZmFd3@CLPs.

[0111] Example 5 Performance of ZmFd3@CLPs and ZmFd3@ALPs

[0112] 1. Microstructure of dsRNA liposomes

[0113] Transmission electron microscopy (TEM) was used to analyze the microstructures of CLPs, ALPs, ZmFd3@CLPs, and ZmFd3@ALPs, including particle size, dispersion index, and Zeta potential. The CLPs, ALPs, ZmFd3@CLPs, and ZmFd3@ALPs solutions were attached to a copper grid, negatively stained with phosphotungstic acid for 10 min, and observed at 120 kV. The results are shown in Figure 1. Figure 6 , Figure 7 shown. Figure 6 It was shown that CLPs interacted electrostatically with negatively charged dsRNA to generate a positive charge of 39.77 mV. For ZmFd3@ALPs, the intermediate state was established by the initial electrostatic interaction between the positively charged PEI and the negatively charged phosphate groups, resulting in a positively charged complex. Figure 7 As shown, the subsequent encapsulation and compression of ALPs causes the ZmFd3@ALPs particles to transform to a negative charge of -34.67 mV. Figure 7 It was shown that CLPs, ALPs, ZmFd3@CLPs and ZmFd3@ALPs complexes showed uniform distribution, and the overall microstructure was ellipsoidal in the range of 90-400 nm. There was no particle aggregation between CLPs, ALPs, ZmFd3@CLPs and ZmFd3@ALPs, and the LNPs vesicle structure was clearly discernible. The loading of dsRNA caused a slight increase in the outer coating of LNPs, especially in ZmFd3@ALPs, where the average particle size increased more significantly. This further proves that the constructed LNPs particles successfully encapsulated dsRNA.

[0114] 2. Protective properties of ZmFd3@CLPs or ZmFd3@ALPs on nucleic acids

[0115] The abundance of nucleases in the external environment and on the surface of plant leaves makes dsRNA extremely susceptible to degradation. Therefore, it is necessary to evaluate the ability of carrier molecules to protect dsRNA.

[0116] Methods: 10 U nuclease was added to dsRNA@CLPs or dsRNA@ALPs solutions containing 1000 ng dsRNA, respectively, and then incubated at 37°C. Then, 1 / 10 of the total volume of 3M NaAc was added, and twice the total volume of anhydrous ethanol was added within 0.5h and 1h, mixed, and precipitated at -80°C for 1h.

[0117] For the control group, 10 U of nuclease was added to 1000 ng of ZmFd3-dsRNA, and the subsequent steps were the same as above.

[0118] The dsRNA was then extracted and stored at -80°C. The resulting samples were subjected to agarose gel electrophoresis and quantitatively analyzed using ImageJ software.

[0119] The results are as follows Figure 8 As shown, Figure 8 The results showed that the untreated ZmFd3-dsRNA showed a distinct band at 150 bp, and the band at 150 bp was missing after 0.5 h and 1 h, indicating that the ZmFd3-dsRNA was completely degraded. In contrast, a discernible band at 150 bp was found in the CLPs and ALPs treated groups after 0.5 h of treatment. After quantitative analysis, it was observed that ALPs showed the most effective protection of dsRNA, retaining 89.78% of the initial concentration at 0.5 h and 68.88% at 1 h. Although the dsRNA content in CLPs was lower compared to ALPs, the concentration of dsRNA in CLPs remained at 65.42% of the initial concentration after 30 min and remained at 52.12% after 1 h. These results indicate that CLPs and ALPs can protect ZmFd3-dsRNA from nuclease degradation even after nuclease treatment, and because the presence of nucleases in the natural environment does not reach the concentration in the experiment, the constructed LNPs delivery system can meet the conditions for field use.

[0120] 3. Storage of ZmFd3@CLPs and ZmFd3@ALPs at different temperatures

[0121] To evaluate the applicability of using CLPs and ALPs in natural environments, the stability of LNPs was measured. The synthesized ZmFd3@CLPs / ALPs were stored at 4, 28, and 37 °C for 21 days, and the changes in their average size, polydispersity index (PDI), and zeta potential were measured.

[0122] The stability of LNPs was evaluated by observing the changes in particle size and Zeta potential during different storage periods using a Malvern particle size analyzer. Fig. 9 shown. Fig. 9 Figures A to C show that no significant changes were observed in the size, polydispersity index, and zeta potential of ZmFd3@CLPs and ZmFd3@ALPs after storage at 4°C for 17 days. However, on day 21, all three indicators of both LNPs showed a downward trend. When stored at 37°C, the changes in LNPs were particularly obvious, mainly the significant fluctuations in the polydispersity index and the partial precipitation at the bottom of the ALPs test tube ( Fig.10). ZmFd3@LNPs stored at 28°C showed similar states to those stored at 4°C. Among them, ZmFd3@ALPs showed relatively large changes in particle size. In contrast, CLPs showed significantly improved states at different temperatures due to their smaller particle size ( Fig. 9 The average size, polydispersity index (PDI) and Zeta potential of ZmFd3@CLPs and ZmFd3@ALPs were relatively stable at 4-28℃.

[0123] 4. ZmFd3@CLPs and ZmFd3@ALPs can be transported in corn plants

[0124] In order to study whether dsRNA@CLPs and dsRNA@ALPs can be transported in corn plants, the present invention adopts two methods: leaf friction and root immersion.

[0125] ① Cy3-UTP was used to label the ZmFd3-dsRNA in ZmFd3@CLPs and ZmFd3@ALPs. The preparation method was different from that in Example 3 in that UTP was replaced with Cy3-UTP labeled with Cy3 during the synthesis of dsRNA.

[0126] ② Use Cy5.5 fluorescent dye to label the liposomes in ZmFd3@CLPs and ZmFd3@ALPs prepared in step ①, and the preparation method is the same as Example 4.

[0127] Leaf rubbing method: Use a cotton ball to gently apply the ZmFd3@CLPs or ZmFd3@ALPs synthesized in step ② on the second leaf of corn. Observe the fluorescence of ZmFd3-dsRNA and liposomes 12h and 24h after treatment.

[0128] Root soaking method: The roots of corn were soaked in a solution containing ZmFd3@CLPs or ZmFd3@ALPs prepared in step ②. Each corn plant was treated with CLPs or ALPs containing 80 μg of dsRNA, and dsRNA without liposome encapsulation was used as a control. The fluorescence intensity was observed using a confocal microscope at 12h and 24h after treatment with LNPs (ZmFd3@CLPs or ZmFd3@ALPs).

[0129] The leaf friction method was used to study the transport of liposomes and dsRNA on different leaves by observing the fluorescence intensity of the second leaf and systemic leaves; the root immersion method was used to observe the fluorescence intensity of the roots and systemic leaves to study the transport of liposomes and dsRNA from roots to systemic leaves.

[0130] After 12 h of treatment, the fluorescence of ZmFd3-dsRNA and liposomes was observed by root immersion method. Fig.11shown. Fig.11 The results showed that relatively higher fluorescence intensities were detected in plants treated with CLPs compared with other treatments. Similar results were observed in systemic leaves of these plants, although the fluorescence intensities were relatively lower.

[0131] When the leaf application method was used, a large amount of red and dye fluorescence was detected in the second leaf (the applied leaf), while no ZmFd3-dsRNA was detected in the systemic leaves, and only a small amount of LNPs fluorescence was detected ( Fig.11 ). This indicates that ZmFd3-dsRNA has not been systemically transported to systemic leaves at 12 h.

[0132] Confocal micrographs of the root system, second leaf, and systemic leaf of corn 24 h after treatment with CLPs and ALPs. Fig.12 shown. Fig.12 The results showed that strong fluorescence signals were detected in leaves and systemic leaves treated with leaf friction and roots and systemic leaves treated with root immersion method, and the three positions of plants treated with CLPs showed higher fluorescence intensity compared with those treated with ALPs.

[0133] At 12 h, a low level of fluorescence signal was detected in the rubbed leaves using dsRNA alone, while the fluorescence signal observed in the roots was even lower, and no fluorescence signal was detected in the systemic leaves. After 24 h, no fluorescence signal was detected in these three locations, indicating that the dsRNA was completely degraded ( Fig.13 ).

[0134] In summary, ZmFd3@CLPs / ALPs have effective transport capacity in corn plants and prevent dsRNA from degradation in the external environment. ZmFd3@CLPs has better performance than ZmFd3@ALPs due to its smaller particle size and positive charge.

[0135] 5. Determination of antiviral activity of ZmFd3@CLPs and ZmFd3@ALPs

[0136] Two-day-old B73 corn seedlings were divided into five groups, namely, blank control group, CLPs group, ALPs group, ZmFd3@CLPs group and ZmFd3@ALPs group.

[0137] In the ZmFd3@CLPs group, CLPs containing 80 μg of ZmFd3-dsRNA were sprayed on each plant using a spray bottle;

[0138] In the ZmFd3@ALPs group, ALPs containing 80 μg of ZmFd3-dsRNA were sprayed on each plant using a spray bottle;

[0139] In the CLPs group, an equal volume of CLPs without ZmFd3-dsRNA was sprayed on each plant using a spray bottle;

[0140] In the ALPs group, an equal volume of ACLPs without ZmFd3-dsRNA was sprayed on each plant using a spray bottle;

[0141] The blank control group used a watering can to spray an equal volume of water on each plant.

[0142] 24 hours after spraying, each corn seedling was mixed and inoculated with SCMV and MCMV viruses, and then the corn leaves were collected on the 6th day after virus inoculation, and the leaves were observed and analyzed using real-time quantitative RT-qPCR and Western blot. The steps of real-time quantitative RT-qPCR and Western blot analysis were the same as those in Example 1. The results are shown in FIG. Fig.14 shown.

[0143] Depend on Fig.14 As shown in A, 9-day-old B73 maize seedlings treated with ZmFd3@CLPs or ZmFd3@ALPs showed reduced chlorosis and yellowing areas on the 6th day of complex infection, while plants treated with CLPs or ALPs alone showed no changes, which was comparable to plants sprayed with water alone. Fig.14 As shown in B, on the 6th day of combined infection of B73 corn seedlings, the accumulation levels of MCMV and SCMV coat proteins in the leaves of plants treated with ZmFd3@CLPs were reduced by 52.44% and 87.95%, respectively, compared with the blank control group. Plants treated with ZmFd3@ALPs also showed similar antiviral activity. Fig.14 As shown in C and D, the expression levels of MCMV and SCMV viral RNA in corn plants in the ZmFd3@CLPs and ZmFd3@ALPs groups were reduced. Fig.14 As shown in E, the expression levels of ZmFd3 in corn plants in the ZmFd3@CLPs and ZmFd3@ALPs groups dropped to 16.00% or 17.20%, respectively, and no silencing effect was detected when CLPs or ALPs were sprayed alone.

[0144] After liposome treatment for 6 days, the growth of corn was Fig.15 As shown. Fig.15 It can be seen that the corn sprayed with ZmFd3-dsRNA liposomes did not show dwarfing phenomenon, indicating that ZmFd3-dsRNA liposomes can effectively reduce the harmful effects of long-term silencing of ZmFd3 on plant growth.

[0145] Example 6 Verification of the interaction between ZmFd3 and virus-encoded proteins

[0146] 1. Yeast two-hybrid assay to verify the interaction between ZmFd3 and virus-encoded proteins

[0147] The complete CDS sequence of ZmFd3 gene was cloned using the cDNA of corn B73 as a template, totaling 456 bp.

[0148] Amplification primers:

[0149] ZmFd3-CDS-F: ATGTCGACCAGCACATTC; (SEQ ID NO.8)

[0150] ZmFd3-CDS-R: CTAGTACAGGTCGCCTTCCTT (SEQ ID NO.9)

[0151] Amplification system: 1 μl cDNA; 0.5 μl / 0.5 μl forward and reverse primers (ZmFd3-CDS-F / R); 10 μl PrimeSTARMax Premix;

[0152] 8 μl ddH2O.

[0153] Amplification program: 98°C for 10 sec; 55°C for 5 sec; 72°C for 5 sec. 30 cycles.

[0154] pGADT7 and pGBKT7 were used to construct N-terminal GAL4AD or GAL4 DNABD fusion constructs in yeast two-hybrid (Y2H) experiments.

[0155] The preparation of yeast competent cells and the transformation of AD and BD plasmids in the present invention are carried out according to the method provided in the instruction manual of the yeast two-hybrid kit of Clontech.

[0156] The CDS sequence of the ZmFd3 gene was constructed onto BD using homologous recombination, and then BD-ZmFd3 was subjected to dot-to-dot hybridization experiments with a series of vectors containing pGADT7-SCMV viral proteins (10) and MCMV viral proteins (7). Negative controls (AD-T7 and BD-Lam) and positive controls (AD-T7 and BD-53) were also set up.

[0157] 10 SCMV proteins: p1, HC-Pro, p3, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb, SCMV-CP.

[0158] 7 MCMV proteins: p32, p50, p111, p7a, p7b, p31, MCMV-CP.

[0159] The co-transfected yeast cells were spread on SD / -Trp / -Leu and SD / -Trp / -Leu / -His / -Ade culture media, respectively, and cultured at 30°C for 3-5 days. Fig.16 shown. Fig.16 The results showed that the positive control of AD-T7 and BD-53, ZmFd3 and HC-Pro of SCMV, and ZmFd3 and p7b of MCMV could grow on SD / -Trp / -Leu and SD / -Trp / -Leu / -His / -Ade culture media, while the negative control of AD-T7 and BD-Lam and other combinations could only grow on SD / -Trp / -Leu culture medium, indicating that ZmFd3 could interact with HC-Pro of SCMV and p7b of MCMV in yeast, respectively, and other genes such as p7a and p31 of MCMV could not interact with ZmFd3.

[0160] 2. BiFC Verification of the Interaction between ZmFd3 and Virus-Encoded Proteins

[0161] In order to further analyze the interaction between ZmFd3 and HC-Pro of SCMV and p7b of MCMV, fusion plasmids of ZmFd3 at the C-terminus of YFP (fluorescent protein) and HC-Pro of SCMV, p7b of MCMV and p31 of MCMV at the N-terminus of YFP were constructed. After streaking and shaking, the recombinant plasmid was transformed into Agrobacterium and then streaked. Finally, all the cells were adjusted to OD600 of 0.6. GV3101 Agrobacterium carrying pSPYCE(M)-ZmFd3 plasmid was mixed with GV3101 Agrobacterium carrying pSPYNE173-SCMV-HC-Pro or pSPYNE173-MCMV-p7b plasmid, and Agrobacterium carrying silencing suppressor P19 plasmid was added (1:1:1). The above-mentioned fully mixed Agrobacterium was injected into the 3rd and 4th true leaves of Nicotiana benthamiana that had grown to the 5-6 leaf stage and fully expanded. The mixed combination is shown in Table 4.

[0162] Table 4 BiFC injection combinations

[0163]

[0164] The expression of YFP was observed using a laser confocal microscope 3 days after infiltration. Among them, pSPYCE(M)-ZmFd3 and pSPYNE173-MCMV-P31 were used as negative controls. Fig.17 shown. Fig.17The results showed that YFP fluorescence appeared on tobacco leaves injected with ZmFd3 and SCMV HC-Pro and MCMV p7b, respectively, while no YFP fluorescence was observed in the negative control ZmFd3 and MCMV p31 combination, indicating that ZmFd3 can interact with SCMV HC-Pro and MCMV p7b in tobacco, respectively, but cannot interact with the negative control MCMV p31. This is consistent with the yeast two-hybrid results.

[0165] Example 6 Antiviral activity of FPH@CLPs / ALP in plants

[0166] 1. Preparation of FPH-dsRNA@CLPs / ALP

[0167] (1) Synthesis of FHP-dsRNA

[0168] FHP-dsRNA is a dsRNA targeting ZmFd3, MCMV-p7b and SCMV-HC-Pro (FPH-dsRNA).

[0169] Specific regions of the ZmFd3, SCMV-HC-Pro and MCMV-p7b genes (138 bp, 120 bp and 120 bp, respectively, as shown in SEQ ID NO.1, SEQ ID NO.10 and SEQ ID NO.11) were selected, and the cDNA of B73 corn infected with SCMV and MCMV was used as a template to amplify with FHP-dsRNA-F1 / R1, FHP-dsRNA-F2 / R2 and FHP-dsRNA-F3 / R3 primers, respectively, to synthesize FHP-dsRNA.

[0170] SEQ ID NO.10

[0171] CGGTGTAACCCAAAATTTTCACATTTGCCTTTACTATGGCAAGTGGCTGAAACAGTAGGACATTACACTGACAACCAATCGAAACAAATAATTGATATCAGTGAGGCGCTCATCAAAGTT

[0172] SEQ ID NO.11

[0173] TTCGTCCTGGCCTCAGTGGTTAAGGAATTTAATTCTGGGGATTTTGATCTCCTCGATTCTGTT CATCTTGACGAAGACACAGGACACCGTTGCCGTTTATCACGAGCCATCGGTGTACTC

[0174] Table 5 Primers for synthesizing FHP-dsRNA

[0175]

[0176]

[0177] Subsequently, the primer pair T7-ZmFd3 / FHP-dsRNA-F and T7-FHP-dsRNA-R was used to amplify the fusion gene FHP-dsRNA with SEQ ID NO.1, SEQ ID NO.10, and SEQ ID NO.11 as templates, as shown in SEQ ID NO.18.

[0178] SEQ ID NO.18:

[0179] TTCGCTACTTCCTGCACGCTGTTGGGCAATGTTAGAACAACGCAGGCCTCCCAGACAGCGGTGAAGAGCCCTTCGTCTCTAAGCTTCTTCAGCCAAGTTACGAAGGTTCCAAGCCTGAAGACCTCCAAGAAACTGGATCGGTGTAACCCAAAATTTTCACATTTGCCTTTACTATGGCAAGTGGCTGAA ACAGTAGGACATTACACTGACAACCAATCGAAACAAATAATTGATATCAGTGAGGCGCTCATCAAAGTTTTCGTCCTGGCCTCAGTGGTTAAGGAATTTAATCTTGGGGATTTTGATCTCCTCGATTCTGTTCATCTTGACGAAGACACAGGACACCGTTGCCGTTTATCACGAGCCATCGGTGTACTC

[0180] In vitro transcription was performed using a T7 kit, DNA template was removed, and rRNA-free DNase was added to the dsRNA product. The quality of dsRNA was assessed by enzyme digestion and electrophoresis, and the concentration of FHP-dsRNA was determined.

[0181] (2) Synthesis of FHP@CLPs / ALP

[0182] The preparation of CLPs / ALP containing FHP-dsRNA refers to the preparation of ZmFd3@CLPs / ALP in Example 4.

[0183] 2. Verification of the antiviral activity of FPH@CLPs / ALP in corn

[0184] The corn plants were divided into three groups, with 15 plants in each group, namely blank control group, FHP@CLPs group and FHP@ALPs group.

[0185] In the FHP@CLPs group, CLPs containing 80 μg of FHP-dsRNA were sprayed on each plant using a spray bottle;

[0186] In the FHP@ALPs group, ALPs containing 80 μg of FHP-dsRNA were sprayed on each plant using a spray bottle;

[0187] The blank control group used a watering can to spray an equal volume of water on each plant.

[0188] After 24 h of spraying, each corn seedling was inoculated with SCMV and MCMV, and then the corn leaves were collected on the 6th day after virus inoculation, and the leaves were observed and the results were analyzed using real-time quantitative RT-qPCR and Western blotting, as shown in Figure 2. Fig.18 shown. Fig.18 A shows that on the 6th day after corn was infected with SCMV and MCMV, the plants sprayed with CLPs / ALPs loaded with FHP-dsRNA showed less chlorotic area compared with the blank control group corn on the 6th day after virus infection; Fig.18 BD in the figure are the results of western blot and RT-qPCR, respectively, showing that the virus level in the plants treated with FPH@CLPs / ALPs was significantly reduced; Fig.18 E in the figure is the expression of ZmFd3 on the 6th day after MCMV and SCMV virus infection. The silencing efficiency of ZmFd3 in corn leaves was 52.98% and 55.78%, respectively.

[0189] Depend on Fig.18 As shown in F and G, on the 11th day after MCMV and SCMV virus infection, the initial plants of the blank control group showed complete wilting, and on the 15th day, all plants of the blank control group had died, while the plant symptoms were alleviated and death was delayed after FPH@CLPs / ALP treatment, indicating that FPH@CLPs / ALP has anti-MCMV and SCMV virus activity in corn plants.

[0190] 3. Verification of the antiviral activity of FPH@CLPs / ALP in sorghum

[0191] The sorghum plants were divided into three groups, with 15 plants in each group, namely blank control group, FHP@CLPs group and FHP@ALPs group.

[0192] In the FHP@CLPs group, CLPs containing 80 μg of FHP-dsRNA were sprayed on each plant using a spray bottle;

[0193] In the FHP@ALPs group, ALPs containing 80 μg of FHP-dsRNA were sprayed on each plant using a spray bottle;

[0194] The blank control group used a watering can to spray an equal volume of water on each plant.

[0195] Each sorghum seedling was inoculated with SCMV 24 h after spraying, and then the sorghum leaves were collected on the 6th day after virus inoculation. The leaves were observed and analyzed by Western blotting. The results are shown in Fig.19 As shown. Fig.19 As shown in A, the incidence of mosaic symptoms in sorghum plants in the FPH@CLPs group decreased from 70.00% to 20.00%, and no yellowing plants were found in the leaves of sorghum plants in the FPH@ALPs group. Western blot analysis showed that the accumulation of SCMV CP protein in plants sprayed with FPH@CLPs was significantly reduced by 91.90% compared with the blank control group. In addition, no viral protein was detected in plants sprayed with FPH@ALPs. This proves the successful application of the FPH@CLPs / ALP nanodelivery system in sorghum antiviral.

[0196] As can be seen from the above examples, the present invention provides the use of ZmFd3 gene in improving plant resistance to viruses and a ZmFd3-dsRNA, FPH-dsRNA and liposomes thereof and their use, and the schematic diagram of their mode of action is shown in FIG. Fig. 20 As shown, this provides a new idea for plants to resist MCMV and SCMV infection.

[0197] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of ZmFd3 gene in improving plant resistance to viruses, characterized in that: The expression of ZmFd3 gene is inhibited, thereby improving the disease resistance of crops to viruses; the virus is MCMV virus or SCMV virus, and the plant is corn.

2. The use according to claim 1, characterized in that: By introducing a vector for suppressing the expression of the ZmFd3 gene into the plant.

3. The use according to claim 2, characterized in that: The vector for inhibiting the expression of ZmFd3 gene includes dsRNA, siRNA, shRNA, CRISPRi, CRISPR / Cas9 vector or virus-mediated gene silencing vector.

4. The use according to claim 3, characterized in that: The sequence of ZmFd3-dsRNA in the dsRNA vector is shown as SEQ ID NO.

1.

5. The use according to claim 3, characterized in that: The sequence of FPH-dsRNA in the dsRNA vector is shown as SEQ ID NO.18; FPH-dsRNA inhibits the expression of ZmFd3, SCMV-HC-Pro and MCMV-p7b genes.

6. The use according to claim 4 or 5, characterized in that: The ZmFd3-dsRNA or FPH-dsRNA is applied in the form of nucleic acid liposomes, and the ZmFd3-dsRNA or FPH-dsRNA is encapsulated in lipid nanoparticles.

7. The use according to claim 6, characterized in that: The nucleic acid liposomes include cationic liposomes or anionic liposomes.

8. Application of ZmFd3-dsRNA or FPH-dsRNA in plant anti-virus, characterized in that: The virus is MCMV virus or SCMV virus, and the plant is corn; the sequence of the ZmFd3-dsRNA is shown in SEQ ID NO.1, and the sequence of the FPH-dsRNA is shown in SEQ ID NO.

18.

9. Application of dsRNA nucleic acid liposome in plant anti-virus, characterized in that: The virus is MCMV virus or SCMV virus, and the plant is corn; the dsRNA nucleic acid liposome is ZmFd3-dsRNA nucleic acid liposome or FPH-dsRNA nucleic acid liposome, and ZmFd3-dsRNA or FPH-dsRNA is encapsulated in lipid nanoparticles to obtain dsRNA nucleic acid liposome; the sequence of the ZmFd3-dsRNA is shown in SEQ ID NO.1, and the sequence of the FPH-dsRNA is shown in SEQ ID NO.

18.

10. The use according to claim 9, characterized in that: The solution containing the dsRNA nucleic acid liposome is sprayed on the plants, wherein the solution contains 50-100 μg of the dsRNA nucleic acid liposome.

Images