Primers and method for detecting methylation level of transcription factor binding site in 5' untranslated region of MyD88 gene in ovarian cancer cells

Abstract

The invention discloses a primer and a method for detecting the methylation level of a transcription factor binding site in a 5' non-translated region of an ovarian cancer cell MyD88 gene, belonging to the field of biotechnology. The method adopts a BSP method to detect the methylation level of a CpG island in a transcription factor binding site in a 5' non-coding region of an ovarian cancer cell MyD88 gene. The invention significantly improves the specificity of ovarian cancer prognosis determination by detecting the methylation level of a transcription factor binding site in a 5' non-coding region, and has high accuracy and sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer and a method for detecting the methylation level of a transcription factor binding site in the 5' untranslated region of the MyD88 gene of ovarian cancer cells. Background Art

[0002] Epithelial ovarian cancer (ovarian cancer) is one of the three major gynecological malignancies. It is called the "silent killer" because of its high malignancy and difficulty in diagnosis. According to data released by the World Health Organization's International Agency for Research on Cancer, there will be approximately 314,000 new cases of ovarian cancer and 207,000 deaths worldwide in 2020. In clinical practice, three cruel "70%" of ovarian cancer are often mentioned, namely, 70% of ovarian cancer patients are already in the advanced stage when they seek medical treatment; 70% of ovarian cancer patients will experience chemotherapy resistance and tumor recurrence within three years after initial treatment; 70% of advanced ovarian cancer patients will not survive for more than 5 years.

[0003] Current research suggests that during tumorigenesis, ovarian cancer cells usurp or hijack the Toll-like receptor 4 (TLR4) / myeloid differentiation factor 88 (MyD88) signaling pathway, leading to ovarian cancer cell resistance to apoptosis and paclitaxel chemotherapy resistance. It also participates in ovarian cancer cell immune escape, giving paclitaxel a "double-edged sword" effect in the treatment of related tumors, and MyD88 is an important driver of paclitaxel resistance in this signaling pathway. Based on clinical research, this research team in 2012 and the Mayo Clinic in 2018 successively confirmed that more than 70% of ovarian cancer cells abnormally express MyD88, which is an independent factor for the poor prognosis of ovarian cancer.

[0004] Previous clinical and basic studies have shown that high-level expression of MyD88 protein promotes ovarian cancer cell migration and invasion, inhibits cell apoptosis, and is closely related to patient prognosis, immune escape, and paclitaxel resistance. The existing MyD88 immunohistochemistry test predicts the prognosis of ovarian cancer with an accuracy of 0.885, a sensitivity of 0.766, and a specificity of 0.595, and its detection specificity needs to be improved. The prior application of this application improved the accuracy to 0.886, the specificity to 0.84, and the sensitivity to 0.700 by detecting the methylation level of the 5'URR CpG island of the MyD88 gene in ovarian cancer cells. Therefore, this method still has a lot of room for improvement in terms of sensitivity, accuracy, and specificity. Summary of the invention

[0005] The purpose of the present invention is to provide a primer for detecting the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells to solve the above problem.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows: primers for detecting the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells, the primers have the sequences shown in Table 1 below:

[0007] Table 1 Primers used to detect the methylation level of transcription factor binding site in the 5' untranslated region of MyD88 gene in ovarian cancer cells

[0008]

[0009] The prior application of the present application used two pairs of primers, one of which was for the promoter. The inventors further studied and found that promoter methylation was not the most critical detection point, so the present application only used primers for the 5' non-translated region. The purpose of the primers was to release the sequence. The key lies in the comparison of the methylation status of the key points, namely the SP1 and IRF1 sites of the present application.

[0010] The second object of the present invention is to provide a method for detecting the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells using the above primers. The method is to detect the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells using bisulfite sequencing PCR (BSP) method.

[0011] As a preferred technical solution, the steps of the BSP method detection include:

[0012] (1) Primer design;

[0013] (2) Treat genomic DNA with a sulfite kit;

[0014] As a further preferred technical solution, in step (1), the primer design method is designed by MethPrimer online Methyl Primer Express v1.0 software.

[0015] As a further preferred technical solution, in step (2), the processing step includes:

[0016] 1) DNA pretreatment;

[0017] 2) BSP amplification and cloning construction;

[0018] 3) Sequencing;

[0019] 4) Compare with the original sequence to clarify the methylation status of the transcription factor binding sites SP1 and IRF1 in the 5' untranslated region.

[0020] The present invention proves through experiments:

[0021] (1) High expression of MyD88 in human ovarian cancer and its transcriptional regulation by transcription factors, and the correlation between the methylation levels of SP1 and IRF1, transcription factor binding sites in the 5' untranslated region, and MyD88 expression;

[0022] (2) IL-6 has the effect of upregulating IRF1 and SP1-mediated MyD88 expression; IRF1 and SP1 are transcription factors of the MyD88 gene, and there is an IRF1 binding motif in the transcription start site sequence of the MyD88 gene, which has a positive regulatory effect on MyD88 expression, namely the positive feedback regulation pathway of the MyD88-IL-6 / IRF1-SP1 / signal axis, but it depends on the methylation status of the 5' URR CpG island-rich region of the 5' untranslated region transcription factor binding site (SP1 and IRF1);

[0023] (3) The methylation status of the CpG island-enriched region of the 5' untranslated region transcription factor binding site (SP1 and IRF1) is involved in the regulation of MyD88 gene expression, thereby affecting the prognosis of ovarian cancer patients. Therefore, the present invention detects the methylation level of the CpG island of the 5' untranslated region transcription factor binding site (SP1 and IRF1).

[0024] Compared with the prior art, the advantages of the present invention are: the present invention uses the BSP method to detect the methylation level of the transcription factor binding sites (SP1 and IRF1) in the 5' untranslated region of the ovarian cancer cell MvD88 gene to make a prognosis judgment, which significantly improves the specificity of ovarian cancer prognosis judgment and has higher accuracy and sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The methylation frequency of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in the ovarian cancer cells of Example 1;

[0026] Figure 2 The expression of IL-6, IRF, SP1 and MyD88 mRNA in ovarian cancer cells transfected with pcDNA3.1-IL-6-GFP and shRNA IL-6;

[0027] Figure 2 In the figure, (A) the expression of IL-6, SP1, IRF1 and MyD88 mRNA in parental ovarian cancer cells; (B) the expression of IL-6, SP1, IRF1 and MyD88 mRNA in ovarian cancer cells transfected with pcDNA3.1-IL-6-GFP; (C) the expression of IL-6, SP1, IRF1 and MyD88 mRNA in ovarian cancer cells transfected with shRNA-IL-6-GFP;

[0028] Figure 3 The protein expression of IL-6, IRF, SP1 and MyD88 mRNA in ovarian cancer cells transfected with pcDNA3.1-IL-6-GFP and shRNA IL-6;

[0029] Figure 3 In the figure, (A) protein expression of SP1, IRF1 and MyD88 in parental and transfected ovarian cancer cells; (B) protein expression of IL-6, SP1, IRF1 and MyD88 in parental ovarian cancer cells; (C) protein expression of IL-6, SP1, IRF1 and MyD88 in ovarian cancer cells transfected with pcDNA3.1-IL-6-GFP; (D) protein expression of IL-6, SP1, IRF1 and MyD88 in ovarian cancer cells transfected with shRNA-IL-6-GFP;

[0030] Figure 4 The effect of IL-6 receptor monoclonal antibody (Tocilizumab) on the expression of SP1, IRF1 and MyD88 in ovarian cancer cells;

[0031] Figure 4 In the results, (AC) Tocilizumab had no significant effect on the expression of SP1, IRF1 and MyD88 mRNA in A2780 cells; (DF) Tocilizumab significantly downregulated the expression of SP1, IRF1 and MyD88 mRNA in OVCAR3 cells; (GI) Tocilizumab downregulated the expression of SP1, IRF1 and MyD88 proteins in a time- and dose-dependent manner;

[0032] Figure 5 It is a scatter plot of the correlation between 5'URR methylation of MyD88 gene promoter, IL-6 and MyD88 mRNA expression;

[0033] Figure 5 In the figure, (a) is a scatter plot of the correlation between 5'URR methylation of the MyD88 gene promoter and MyD88 mRNA expression; (b) is a scatter plot of the correlation between IL-6 and MyD88 mRNA expression;

[0034] Figure 6 Progression-free survival and overall survival curves of ovarian cancer patients with different MyD88 gene 5'URR CpG island methylation levels;

[0035] Figure 6 In the figure, (a) is the progression-free survival curve of ovarian cancer patients with different methylation levels of the 5'URR CpG island of the MyD88 gene; (b) is the overall survival curve of ovarian cancer patients with different methylation levels of the 5'URR CpG island of the MyD88 gene;

[0036] Figure 7 is the ROC curve of MyD88 immunohistochemistry detection in the prior art;

[0037] Figure 8 This is the ROC curve of the MyD88 methylation level detection of the present invention. DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with the accompanying drawings.

[0039] Experimental samples:

[0040] A total of 158 patients with ovarian cancer who underwent primary debulking surgery (PDS) and received 6-8 courses of chemotherapy with platinum-based drugs + paclitaxel in Sichuan Cancer Hospital from January 2009 to January 2019 were selected. All patients were diagnosed by two pathologists. The 158 cases were randomly divided into two groups, one with 75 cases and the other with 83 cases.

[0041] The sample processing method for the 75-case group was as follows: 75 fresh specimens of ovarian cancer tissues were collected, immediately frozen at -80°C in liquid nitrogen, and then stored in the biological specimen bank of the tumor research laboratory of our hospital. The age of these patients was (54.5±8.5) years old; surgical pathology staging: according to the 2018 staging standards of the International Federation of Gynecology and Obstetrics (FIGO), there were 6 cases in stage I, 6 cases in stage II, 52 cases in stage III, and 11 cases in stage IV; pathological type: 63 cases of serous carcinoma, 12 cases of other types (including mucinous carcinoma, clear cell carcinoma, etc.); pathological grading: 16 cases of G1, 8 cases of G2, and 1 case of G3; these 75 samples were used for methylation level detection in the following examples;

[0042] The sample processing method for the 83-case group was as follows: 83 cases of ovarian epithelial cancer were embedded in paraffin and subjected to complete serial tissue sections (3-5μm). The average age of the patients was 54.12+1.00 years old. According to the International Federation of Gynecology and Obstetrics (FIGO) staging standards, there were 7 cases in stage I, 4 cases in stage II, 60 cases in stage III, and 11 cases in stage IV; pathological grading, 54 cases in grade G3, 11 cases in grade G2, and 18 cases in grade G1; pathological type, 62 cases of serous carcinoma, and 21 cases of other types of epithelial carcinoma; the 83 samples were used for immunohistochemical detection in the following comparative example 1;

[0043] All the above ovarian cancer patients did not receive chemotherapy, radiotherapy, immunotherapy, targeted therapy, hormone replacement therapy or other treatments before surgery. All patients were followed up by hospital review or telephone, and the follow-up of the patients was recorded in detail; the follow-up started on the day of ovarian cancer diagnosis and ended on June 1, 2021, with a median follow-up time of 20.9 months (5.4-61.1 months).

[0044] Embodiment 1:

[0045] The BSP method detects CpG methylation of the transcription factor binding site in the 5' untranslated region of the MyD88 gene, including the following steps:

[0046] (1) The primers for the 5'URR sequence of the MyD88 gene were designed using the MethPrimer online Methyl Primer Express v1.0 software. The primer sequences are shown in Table 1 below:

[0047] Table 1 Primers used to detect the methylation level of transcription factor binding site in the 5' untranslated region of MyD88 gene in ovarian cancer cells

[0048]

[0049] (2) Treat genomic DNA with a bisulfite (BSP) kit (EPIGENTEK Bisulflash DNA Modification Kit); the BSP conversion steps are as follows:

[0050] ① Take 500 ng DNA, add 110 μL reaction mixture (BF1+BF5+BF6), make two for each sample, 2×110 μL, divide it into 4 PCR tubes, 95℃, 20 min;

[0051] ② Add 500 μL BF2 to the EP tube, and add all the samples after the reaction to the EP tube, mix well, transfer to the column after centrifugation, 12,000 rpm, 1 min;

[0052] ③ Add 200 μL of 90% ethanol for washing, 12,000 rpm, 1 min;

[0053] ④ Add 60 μL of BF3+90% ethanol mixture, let stand for 8 min, 12,000 rpm, 1 min;

[0054] ⑤ Add 200 μL of 90% ethanol to wash, 12,000 rpm, 1 min, repeat once (12,000 rpm, 1 min), place at 56°C, 5 min, and allow the ethanol to evaporate;

[0055] ⑥ Add 13 μL preheated BF4, let stand for 2 min, 12,000 rpm, 1 min, repeat once;

[0056] ⑦ Determine the DNA concentration (ssDNA, dsDNA) after treatment;

[0057] ⑧BSP amplification and cloning construction After two rounds of amplification of BSP-treated genomic DNA, the amplified products were recovered and cloned. After two rounds of PCR amplification, the amplified products were recovered, using the same primers and conditions. In the first round, each sample was PCR amplified with a 2×20 μL system, and in the second round, each sample was amplified with a 4×50 μL system: the amplification conditions are shown in Table 2;

[0058] ⑨ Concentration and purification Use the promga kit to purify the PCR product, concentrate the volume to 30 μL, and use ddH 2 O elution, and final gel purification;

[0059] ⑩TA cloning construction Take 1μL PEASY-T3 + 4μL purified DNA, 25℃ for 2h; add 50μL DH5α competent cells, ice bath for 20min, heat shock at 42℃ for 30s, ice bath for 2min, add 500μL LB to recover for 1h, spread on Amp plate premixed with IPTG and X-gal, and incubate at 37℃ overnight. The next day, pick out white spots, extract plasmids, send samples to Qingke Biotechnology for sequencing, and use SnapGene analysis software to analyze methylation sites. Compare with the original sequence to clarify the methylation status of the transcription factor binding sites (SP1 and IRF1) in the 5' untranslated region.

[0060] Table 2 Amplification conditions

[0061]

[0062] Determination of the expression of IL-6, MyD88, IRF1 and SP1 in human ovarian cancer cell lines intervened by shRNA IL-6 or IL-6 receptor monoclonal antibody (Tocilizumab).

[0063] The results are as follows Figure 1 As shown:

[0064] The BSP clone sequencing method was used to determine the expression of OVCAR3 (MyD88 high ) and A2780(MyD88 lowThe methylation levels of transcription factor binding sites in the 5' untranslated region of MyD88 gene in A2780 cells were compared with those in OVCAR3 cells. The average methylation frequencies of the 5' untranslated region were 0.25±0.26 and 0.53±0.30, respectively, with significant differences (P=0.011). The methylation frequencies of the SP1 and IRF1 transcription factor binding motifs in A2780 cells were significantly higher than those in OVCAR3 cells (P<0.001 and P=0.004).

[0065] Embodiment 2:

[0066] (1) Construction of pcDNA3.1IL-6-GFP and shRNA IL-6shRNA eukaryotic expression vectors

[0067] Based on the mRNA sequences of IL-6 (NM_000600.5), MyD88 (NM_001172567.1) and IRF1 (NM_002198.3) obtained from NCBI, Tsingke Biological Technology designed and used pcDNA3.1 and XM486-1in PIKo.1-EGFP-PURO-1 plasmids to construct endotoxin-free pcDNA3.1IL-6-GFP and shRNA IL-6 expression vectors for eukaryotic cell transfection.

[0068] (2) Transfection of pcDNA3.1IL-6-GFP and shRNA IL-6shRNA eukaryotic expression vectors

[0069] One day before transfection, appropriate amount of OVCAR3 and A2780 cells were inoculated in 6-well plates until the cell confluence reached 60-80%; 4 μg expression vector DNA was diluted in 250 mL Opti-MEM I medium, gently mixed, and 10 μL BufferTransEasyTM was added, and placed at room temperature for 20 minutes to form a complex (Note: the complex can remain stable at room temperature for at least 5 hours); the complex was added to the 6-well plate, and gently shaken to mix; at 37°C CO 2 After incubation in the incubator for 24-48 hours, the transfection efficiency was tested and the medium was changed 4-6 hours after transfection.

[0070] (3) RT-qPCR determination of IL-6, MyD88, IRF1 and SP1 mRNA expression

[0071] RNA sample preparation:

[0072] ① Collect the above cell suspension;

[0073] ② Wash once with pre-cooled PBS, centrifuge (7,000 rpm, 5 min), and carefully discard the supernatant;

[0074] ③ Every 5~10×10 6 Add 1 mL of Trizol reagent to each cell and let stand at room temperature for 10 min.

[0075] ④0.2mL chloroform, shake for 15s, and let stand at room temperature for 5min;

[0076] ⑤ Centrifuge (10,000r / min, 15min, 4℃), transfer the upper layer (containing total RNA) to a new EP tube (about 600μL), add an equal volume of isopropanol, mix well, and let stand at room temperature for 10min;

[0077] ⑥ Centrifuge (10,000 r / min, 15 min, 4°C), discard the supernatant, add 600 μL of 75% ethanol per ml of Trizol, mix well; centrifuge (10,000 r / min, 10 min, 4°C), discard the supernatant;

[0078] ⑦Open the lid, turn it upside down, and wait for the RNA to dry naturally at room temperature;

[0079] ⑧ Every 1×10 6 Each cell was added with DEPC to dissolve RNA in 25 μL and stored in a -80℃ refrigerator for later use;

[0080] ⑨Take 2 μL for purity detection of the extracted total RNA.

[0081] Primer design: Primers were designed using PrimerPremier5 software and verified online using NCBIBLAST to obtain primers with specific matches (Totalscore ≥ 46.1, Evalue ≤ 0.011), as shown in Table 3 below:

[0082] Table 3 Specific matching primers

[0083] Gene Upstream primer (5'-3') Downstream primer (5'-3') MYD88 CGGCAACTGGAACAGACAAA CAGAGACAACCACCACCATCC IL-6 TACCTAGAGTACCTCCAGAACAG CATTTGCCGAAGAGCCCTCA IFR1 ACTTCCAGGTGTCACCCATG CTCCAGGTTCATTGAGTAGGT SP1 ACAGCATATTTGCCACATCA TTGACAGGTGGTCACTCCTCA GAPDH CACTGCCACCCAGAAGACTG CCTGCTTCACCACCTTCTTG

[0084] RT-PCR: RT was reverse transcribed using EastepRTMasterMixKit to obtain cDNA. The experimental steps and RT conditions were carried out according to the kit instructions. Quantitative real-time PCR (qPCR) was carried out using EastepqPCR MasterMixKit. The experimental steps and RT conditions were carried out according to the kit instructions. The expression level of the target gene relative to the GAPDH reference gene was used; 2 -Δct The value is expressed as: -Δct = (target gene ct value - reference gene ct value). The specific conditions of PCR are as follows:

[0085] 1 Reverse transcription (RT) experimental steps are shown in Table 4:

[0086] Table 4 Reverse transcription steps

[0087]

[0088] ②PCR experimental steps are shown in Table 5:

[0089] Table 5 PCR experimental steps

[0090]

[0091] (4) Western Blot analysis of IL-6, MyD88, IRF1 and SP1 protein expressions

[0092] Protein sample preparation:

[0093] ① Different concentrations of IL-6 receptor monoclonal antibody (10, 10 μmol / L) were used to act on OVCAR3 and A2780 cell lines that grew well in the logarithmic phase for 6, 12 and 24 hours respectively;

[0094] The following steps are performed on ice:

[0095] ② Wash twice with 4℃ precooled PBS, 1 min each time;

[0096] ③ Lysis in lysis buffer containing 1% PMSF at 4°C overnight;

[0097] ④In an ice bath, use an ultrasonic cell disruptor for 5 minutes;

[0098] ⑤ Centrifuge (12000r / min, 5min, 4℃) and store at -20℃ for later use.

[0099] Determination of sample protein content: Detect and calculate the total protein content per milliliter of sample according to the above method. Gel preparation: SP1﹕8%Gel; IRF1, MyD88, Tublin﹕12%Gel, the composition of separation gel and concentration gel is shown in Table 6;

[0100] Table 6 Composition of separation gel and concentration gel

[0101]

[0102] Sample treatment: Mix 2×SDS loading buffer and sample in a 1:1 ratio and boil in a boiling water bath for 5 min.

[0103] Electrophoresis:

[0104] ① 80V constant voltage pre-electrophoresis, 10-15min;

[0105] ② Loading, 20 μg / lane;

[0106] ③80V concentrated gel electrophoresis, 30min;

[0107] ④100V separation gel electrophoresis, the duration depends on the molecular weight of the target protein (45-60min).

[0108] Semi-dry protein electroblotting:

[0109] ① Treatment of PVDF membrane: 100% methanol (several seconds) → deionized water (3 min);

[0110] ② Prepare two pieces of ultra-thick filter paper of equal size, pre-treated PVDF membrane and PAGE gel and immerse them in electrotransfer buffer for equilibrium;

[0111] ③ Constant voltage 10V semi-dry transfer, the duration depends on the molecular weight of the target protein, and is placed in the order from bottom to top: (+eV) ultra-thick filter paper → pre-treated PVDF membrane → PAGE gel → ultra-thick filter paper (-eV). Membrane blocking process (room temperature):

[0112] ① Rinse with TBST 3 times × 10 min;

[0113] ②10% skim milk powder (pH 7.4) blocking: shake for about 1 hour;

[0114] ③ Wash the membrane (deionized water) several times;

[0115] ④ Rinse with TBST 3 times for 10 min.

[0116] Antibody hybridization process:

[0117] ① Add diluted primary antibody (1:500) and incubate in hybridization bag at 4°C overnight;

[0118] ② Wash the membrane several times with deionized water;

[0119] ③ Add diluted secondary antibody (1:10000) and incubate in the hybridization bag at room temperature for 1 hour;

[0120] ④ Wash the membrane several times with deionized water.

[0121] The PVDF membrane was treated with horseradish peroxidase-ECL method, and the image signals were collected and analyzed using ChemiDoc XRS+software.

[0122] result:

[0123] (1) IL-6 was overexpressed and knocked down by transfection of pcDNA3.1-IL-6 and shRNA-IL-6, or treated with IL-6 receptor monoclonal antibody, and the expression levels of IL-6, IRF1, SP1 and MyD88 mRNA and protein in OVCAR3 and A2780 cells were determined by RT-qPCR and Western Blot, respectively. Overexpression of IL-6 significantly upregulated the mRNA and protein expression of IL-6, IRF1 and MyD88 in OVCAR3 and A2780 (P<0.01); knockdown of IL-6 significantly downregulated the mRNA and protein expression of IL-6, IRF1 and MyD88 in OVCAR3 and A2780 (P<0.01); in addition, IL-6 receptor monomer significantly reduced the IL-6-mediated SP1, IRF1 and MyD88 mRNA and protein expression in OVCAR3 cells (P<0.01);

[0124] like Figure 2 , Figure 3 and Figure 4 As shown, Figure 2 (A) Expression of IL-6, SP1, IRF1 and MyD88 mRNA in parental ovarian cancer cells. (B) Expression of IL-6, SP1, IRF1 and MyD88 mRNA in ovarian cancer cells transfected with pcDNA3.1-IL-6-GFP. (C) Expression of IL-6, SP1, IRF1 and MyD88 mRNA in ovarian cancer cells transfected with shRNA-IL-6-GFP. Mean ± standard deviation. Unpaired t-test was used for statistical analysis. ***, P < 0.001; Figure 3 (A) Protein expression of SP1, IRF1 and MyD88 in parental and transfected ovarian cancer cells. (B) Protein expression of IL-6, SP1, IRF1 and MyD88 in parental ovarian cancer cells. (C) Protein expression of IL-6, SP1, IRF1 and MyD88 in ovarian cancer cells transfected with pcDNA3.1-IL-6-GFP. (D) Protein expression of IL-6, SP1, IRF1 and MyD88 in ovarian cancer cells transfected with shRNA-IL-6-GFP. Expressed as mean ± standard deviation. Unpaired t-test was used for statistical analysis. *, P<0.05; **, P<0.01; ***, P<0.001; Figure 4(AC) Tocilizumab had no significant effect on the expression of SP1, IRF1 and MyD88 mRNA in A2780 cells. (DF) Tocilizumab significantly downregulated the expression of SP1, IRF1 and MyD88 mRNA in OVCAR3 cells. (GI) Tocilizumab downregulated the expression of SP1, IRF1 and MyD88 proteins in a time- and dose-dependent manner.

[0125] (2) Reverse transcription (RT)-real-time fluorescence quantitative PCR (qPCR) technology was used to detect the expression of MyD88mRNA and IL-6mRNA in ovarian cancer tissues. The BSP cloning sequencing method was used to determine the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer tissues. The Pearson correlation method was used to analyze the correlation between the methylation level of the transcription factor binding site in the 5' untranslated region of the IL-6mRNA and MyD88 gene in ovarian cancer tissues and the expression of MyD88mRNA. The results are as follows: Figure 5 As shown in the results, the CpG hypomethylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene, IL-6 and MyD88 mRNA expression were positively correlated (r = 0.662, P = 0.001 and r = 0.722, P = 0.001), and affected the survival prognosis of ovarian cancer patients (PFS: P = 0.001; OS: P = 0.001). Figure 6 shown.

[0126] Comparative Example 1

[0127] MyD88 immunohistochemistry detection

[0128] The sources of samples are as described above;

[0129] The specific steps are:

[0130] (1) Dewaxing: Place the sections on a rack and rinse once as follows: xylene 2×3 min → xylene and anhydrous ethanol 1:1 mixed for 3 min → anhydrous ethanol 2×3 min → 95% ethanol 3 min → 70% ethanol 3 min → 50% ethanol 3 min → cold water wash. (Note: Before antigen retrieval, ensure that the sections are always immersed in water and do not dry out, otherwise it will cause nonspecific antibody binding and produce high background.)

[0131] (2) Antigen repair (high-pressure steam-heat repair method): Add an appropriate amount of antigen repair buffer (1mmol / L EDTA, pH8.0) into the pressure cooker, cover it with a lid and pressurize it; place the cooker on a heating plate and turn it to maximum power. 5 minutes after steaming, turn off the heating plate and remove the pressure cooker. Cool the cooker with cold water for 10 minutes, wait for the pressure to drop, remove the pressure valve and open the lid. Take out the slices and soak them in PBS (0.01mol / L, pH 7.4) for later use. Avidin-biotin complex method (ABC method)

[0132] (1) Slice or cell slide 0.3% H 2 O 2 Incubate at room temperature for 30 min (to deplete endogenous catalase), and then rinse with PBS (0.01 mol / L, pH 7.4) for 3×5 min.

[0133] (2) Use a PAP pen (immunohistochemistry pen) to draw a waterproof circle around the tissue or cells.

[0134] (3) Incubate with 5% goat serum at room temperature for 30 min.

[0135] (4) Discard the blocking solution, add a primary antibody at an appropriate concentration (prepared in 0.01 mol / L pH 7.4 PBS, 4-5 μg / ml), and incubate overnight at 4°C. (Use PBS instead of the primary antibody as a negative control.)

[0136] (5) Aspirate the primary antibody, rinse with 0.01% Triton X-100 PBS (0.01 mol / L, pH 7.4) for 3×5 min (on a shaker), add the same secondary antibody (prepared with 0.01 mol / L pH 7.4 PBS, 5 μg / ml), and incubate at 37°C for 50 min.

[0137] (6) Aspirate the secondary antibody, rinse with 0.01% Triton X-100 PBS (0.01 mol / L, pH 7.4) for 3×5 min (on a shaker), add horseradish enzyme-labeled streptavidin (prepared with 0.01 mol / L pH 7.4 PBS, 4 μg / ml), and incubate at 37°C for 50 min.

[0138] (7) Remove the secondary antibody and rinse with 0.01% Triton X-100 PBS (0.01 mol / L, pH 7.4) for 3×5 min (on a shaker). DAB color development usually takes 2 to 10 min and can be observed under a microscope from time to time. When the cells are colored and the background color is lighter, remove the color development solution immediately and rinse with running water for 5 min.

[0139] (8) Counterstain with hematoxylin for 30 seconds. Dehydrate, irritate and seal.

[0140] (9) Images were collected and analyzed using an IX-71 fluorescence inverted microscope and AnalySIS image capture software.

[0141] ROC curve comparison:

[0142] (1) Data collection: Collect data from the tests performed using the above-mentioned Example 1 and Comparative Example 1, including the true positive rate (sensitivity) and the false positive rate (1-specificity);

[0143] (2) SPSS26.0 software was used for statistical analysis. The ROC curve was drawn and the area under the ROC curve (AUC) was compared to evaluate the overall performance of the test. The cut-off value of the ROC curve was 0.66, and <0.66 indicated a poor prognosis.

[0144] result Figure 7 and Figure 8 As shown, it can be seen that the existing MyD88 immunohistochemistry predicts the prognosis of ovarian cancer: accuracy 0.885, sensitivity 0.766, specificity 0.595; while the methylation of the present invention predicts the prognosis of ovarian cancer: accuracy 0.891, sensitivity 0.929, specificity 0.787, the accuracy, sensitivity and specificity are significantly higher than the immunohistochemistry method and the prior application of the present application, especially the sensitivity is significantly improved.

[0145] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer set for detecting the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells, characterized in that: The primers of the primer set are shown in the following table:

2. A method for detecting the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells using the primer set of claim 1, characterized in that: The method uses the BSP method to detect the methylation level of the transcription factor binding site in the 5' untranslated region of the MyD88 gene in ovarian cancer cells, and the method is not for diagnosis purposes.

3. The method according to claim 2, characterized in that The steps of the BSP method detection include: (1) Primer design; (2) Treat genomic DNA using a sulfite kit.

4. The method according to claim 3, characterized in that In step (1), the primer design method is designed by MethPrimer online Methyl Primer Express v1.0 software.

5. The method according to claim 3, characterized in that: In step (2), the processing steps include: 1) DNA pretreatment; 2) BSP amplification and cloning construction; 3) Sequencing; 4) Compare with the original sequence to clarify the methylation status of the transcription factor binding sites SP1 and IRF1 in the 5' untranslated region.

Images