A long male deletion fragment Indel marker for rapid identification of sex of long-snout catfish and its application

Abstract

The invention provides a long male deletion fragment Indel marker and amplification primer for rapid identification of the sex of long snout catfish, which can be used simply, quickly and stably for genetic sex identification of long snout catfish at different developmental stages. The method can easily determine the sex of long snout catfish without high-concentration agarose gel electrophoresis, and has a wide identification range, and can accurately identify the sex of long snout catfish from different regions. The deletion of the SEQ ID NO.1 sequence in males can be used for the research and development of all-male breeding technology of long snout catfish. By breeding all-male long snout catfish, the yield can be greatly increased, and the economic benefits of breeding can be increased.

Description

Technical Field

[0001] The invention relates to a long male deletion fragment Indel marker, primer and application for rapid identification of sex of long-snouted catfish, belonging to the field of biotechnology. Background Art

[0002] Longnose catfish (Leiocassis longirostris), belonging to the order Siloriformes, family Bagridae, genus Leiocassis, is one of the important freshwater economic fish in my country. It is widely distributed in the main stream of the Yangtze River, lakes connected to the river, and the downstream waters of major tributaries. Longnose catfish, also known as Jiangtuan, is popular among consumers for its rich nutrition, tender meat, and few intermuscular spines, and has broad breeding prospects. Male longnose catfish grow fast and are large; female individuals grow slowly and are small. Breeding female individuals will reduce breeding yields and increase breeding costs. Therefore, breeding all-male longnose catfish can effectively increase production and increase economic benefits. At present, it is still impossible to identify the sex chromosomes of longnose catfish using an optical microscope, that is, no sex chromosomes for sex identification have been found. Studies have shown that the sex chromosome type of longnose catfish may be XX / XY, that is, homozygous chromosomes XX are females, and heterozygous chromosomes XY are males. Therefore, it is necessary to develop molecular markers for rapid and efficient identification of genetic sex of long-nosed catfish, which can also be used to determine sex chromosome types.

[0003] In terms of sex-specific molecular marker screening and genetic sex identification of long-snouted catfish, three molecular markers for sex identification of long-snouted catfish were isolated in 2021 by resequencing the genomes of female and male fish. However, the male insertion / deletion fragments of the three markers identified were between 6-32bp, and high-concentration agarose gel (at least 3%) electrophoresis was required to effectively separate the two male fragments. However, high-concentration agarose is difficult to prepare, and there are problems such as long electrophoresis time and high cost. These shortcomings limit the widespread application of these three markers. Therefore, it is particularly necessary to develop an indel multi-marker based on long insertion / deletion fragments to solve the above technical problems. Summary of the invention

[0004] The invention aims to provide a long male deletion fragment Indel marker for quickly identifying the sex of long-snout catfish.

[0005] Another object of the present invention is to provide an amplification primer for quickly identifying the sex of long-snout catfish and marking the long male deletion fragment Indel.

[0006] Another object of the present invention is to provide a method for quickly identifying the sex of long-snouted catfish using a long male deletion fragment Indel marker to identify the sex of long-snouted catfish.

[0007] Furthermore, the present invention also provides a long male deletion fragment Indel marker for quickly identifying the sex of long-snouted catfish and the use of amplification primers in identifying the sex of long-snouted catfish.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] A long male deletion fragment Indel marker for rapid identification of the sex of long-snouted catfish, wherein the marker nucleotide sequence is shown as SEQ ID NO.1, wherein female individuals have the SEQ ID NO.1 sequence, and male individuals lack the SEQ ID NO.1 sequence.

[0010] The invention discloses an amplification primer for quickly identifying the sex of a long-snout catfish and a long male deletion fragment Indel marker. The nucleotide sequence of the front primer of the amplification primer sequence is shown as SEQ ID NO.2, and the nucleotide sequence of the rear primer is shown as SEQ ID NO.3.

[0011] A method for quickly identifying the sex of long-snouted catfish by using a long male deletion fragment Indel marker to identify the sex of long-snouted catfish, the specific method is as follows:

[0012] (1) extracting genomic DNA of the long-snout catfish to be tested;

[0013] (2) Using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3, the DNA obtained in step (1) was subjected to PCR amplification to obtain an amplified product; the PCR reaction system was: 10x Buffer (Mg 2+ free) 1μL, 25mM MgCl2 1μL, dNTP Mix (10mM each) 1.6μL, forward and reverse primers (10mM) 1μL each, template DNA (>30ng / μL) 1μL, Taq enzyme (5U / μL) 0.2μL, ddH2O 13.2μL;

[0014] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 45 s; 72°C for 10 min;

[0015] (3) The PCR amplification product obtained in step (2) was subjected to 1.5% agarose gel electrophoresis. The individual with only the 469 bp specific fragment was a female long-snouted catfish, and the individual with two fragments of 469 bp and 391 bp had a deletion of the SEQ ID NO.1 sequence and was a male long-snouted catfish.

[0016] A long male deletion fragment Indel marker and amplification primer for rapid identification of the sex of long-snouted catfish and their application in identifying the sex of long-snouted catfish.

[0017] The present invention has the following beneficial effects:

[0018] The invention provides a long male deletion fragment Indel marker and amplification primer for rapid identification of the sex of long snout catfish, which can be used simply, quickly and stably for genetic sex identification of long snout catfish at different developmental stages. The method can easily determine the sex of long snout catfish without high-concentration agarose gel electrophoresis, and has a wide identification range, and can accurately identify the sex of long snout catfish from different regions. The deletion of the SEQ ID NO.1 sequence in males can be used for the research and development of all-male breeding technology of long snout catfish. By breeding all-male long snout catfish, the yield can be greatly increased, and the economic benefits of breeding can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Validation electrophoresis of male-specific Indel markers in 20 individuals of Longnose Catfish from Meishan, Sichuan.

[0020] Figure 2 : Validation electrophoresis of male-specific Indel markers in 20 individuals of Longnose Catfish in Shishou, Hubei. DETAILED DESCRIPTION

[0021] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0022] Example 1: Application of specific Indel markers for sex identification of long-snouted catfish

[0023] 1. DNA extraction

[0024] The genomic DNA of the tested long-snout catfish was extracted using a kit or the phenol-chloroform method.

[0025] 2. Primer design

[0026] Primers were designed for the molecular marker with nucleotide sequence as shown in SEQ ID No.1:

[0027] F1:CCATCACATTTATTTCCGTCTC(SEQ ID NO.2);

[0028] R1: ACATTGGCTTTCAAACATCG (SEQ ID NO.3);

[0029] 3. PCR amplification

[0030] Using the above primer pair, the DNA obtained in step 1 was used as a template for PCR amplification to obtain an amplified product; the PCR reaction system was: 10x Buffer (Mg 2+free) 1μL, 25mM MgCl2 1μL, dNTP Mix (10mM each) 1.6μL, forward and reverse primers (10mM) 1μL each, template DNA (>30ng / μL) 1μL, Taq enzyme (5U / μL) 0.2μL, ddH2O 13.2μL.

[0031] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 45 s; and 72°C for 10 min.

[0032] 4. Electrophoresis detection

[0033] The PCR amplification product obtained in step 3 was subjected to 1.5% agarose gel electrophoresis. The individual with only the 469 bp specific fragment was a female long-snouted catfish, and the individual with two fragments of 469 bp and 391 bp had a deletion of the SEQ ID NO.1 sequence and was a male long-snouted catfish.

[0034] Example 2: Validation of male sex-specific Indel markers in long-snouted catfish sex identification

[0035] 1. Collect 20 male and female longnose catfish of known sex from Meishan, Sichuan and Shishou, Hubei.

[0036] 2. According to the method described in Example 1, a total of 40 samples were tested for gender. The results are as follows: Figure 1 and Figure 2 The results showed that all male samples had two fragments of 469 bp and 391 bp, while female samples only had a fragment of 469 bp, indicating that the marker of the present invention can accurately, simply, quickly and widely identify the sex of long-snouted catfish.

Claims

1. A long male deletion fragment Indel marker for rapid identification of the sex of long-snouted catfish, characterized in that: The marker nucleotide sequence is shown as SEQ ID NO.1, wherein the female individual has the SEQ ID NO.1 sequence, and the male individual lacks the SEQ ID NO.1 sequence.

2. A long male deletion fragment Indel-labeled amplification primer for rapid identification of the sex of long-snouted catfish, characterized in that: The nucleotide sequence of the front primer of the amplification primer sequence is shown as SEQ ID NO.2, and the nucleotide sequence of the rear primer is shown as SEQ ID NO.

3.

3. A method for quickly identifying the sex of long-snout catfish by using long male deletion fragment Indel markers, characterized in that: The specific method is as follows: (1) Extracting genomic DNA from the long-snouted catfish to be tested; (2) using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3, the DNA obtained in step (1) is subjected to PCR amplification to obtain an amplified product; the PCR reaction system is Mg 2+ 1 μL of free 10 x Buffer, 1 μL of 25 mM MgCl2, 1.6 μL of 10 mM each dNTP Mix, 1 μL of 10 mM forward and reverse primers, 1 μL of template DNA with a concentration of >30 ng / μL, 0.2 μL of 5 U / μL Taq enzyme, and 13.2 μL of ddH2O; The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 45 s; 72°C for 10 min; (3) The PCR amplification product obtained in step (2) was subjected to 1.5% agarose gel electrophoresis. The individual with only the 469 bp specific fragment was a female long-snouted catfish, and the individual with two fragments of 469 bp and 391 bp had a deletion of the SEQ ID NO.1 sequence and was a male long-snouted catfish.

4. Use of the long male deletion fragment Indel marker and amplification primer for quickly identifying the sex of long-snouted catfish as described in claim 1 or 2 in identifying the sex of long-snouted catfish.

Images