Trichoderma harzianum and its application in prevention and control of corn diseases

Abstract

The invention discloses a strain of Trichoderma harzianum and its application in corn disease prevention and control, and belongs to the field of biotechnology. The invention separates and purifies a strain of Trichoderma harzianum (Trichoderma harzianum) CTCCSJ-F-AW10716, which is deposited in the China Center for the Collection of Typical Microorganisms, with a deposit number of CCTCC NO:M 20231036. Experimental verification shows that the Trichoderma harzianum has a significant inhibitory effect on Helminthosporium, Fusarium graminearum, and Fusarium pseudoverticillium, and is adapted to low temperature or cool environment, and has application potential in the prevention and control of corn leaf spot, root rot, stem rot, and ear rot in the Northeast and other regions.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to Trichoderma harzianum and application thereof in corn disease prevention and control; specifically relates to Trichoderma harzianum CTCCSJ-F-AW10716 and application thereof in corn disease prevention and control. Background Art

[0002] Corn is one of the four major high-yield food crops in the world. It is widely cultivated on all continents and is rich in nutrients. Corn can be used as high-quality feed to improve the yield and quality of livestock and poultry, and can also be used as industrial raw materials and widely used in food, medicine, textile and other industrial sectors. Therefore, the development of corn production is of great significance to the improvement of people's lives and the development of the rural economy.

[0003] Corn is one of the four major crops in Northeast China. However, corn diseases are numerous, widely distributed, and highly pathogenic, which has a significant impact on the development of the corn industry. Statistics show that from 2014 to 2016, a total of 9.9533 million hectares of corn diseases occurred in the three provinces of Northeast China. 2 · times, resulting in actual losses of 1.3371 million tons. Corn leaf spot is one of the important diseases in China's corn producing areas, generally causing a 15-20% reduction in yield, and a severe reduction of more than 50%, or even no harvest. Corn leaf spot, also known as corn spot, is a disease of corn caused by infection with Helminthosporium. It mainly harms leaves, but leaf sheaths, bracts and cobs can also be affected. It can occur throughout the entire growth period of corn, but is most serious during the tasseling and filling stages. Fusarium graminearum is an important pathogenic fungus that causes a variety of corn diseases. Corn diseases caused by Fusarium graminearum infection cause serious yield and economic losses. The pathogen also produces a large amount of mycotoxins that contaminate grains, posing a serious threat to human and livestock health. Since the virulence factors and molecular pathogenic mechanisms of Fusarium graminearum infecting crops are still unclear, the prevention and control measures for Fusarium graminearum are very limited, mainly focusing on chemical control, and there is no completely effective biological control method available.

[0004] Trichoderma is a fungus widely found in soil under different environmental conditions. It can produce a variety of biologically active substances, secondary metabolites and cell wall degrading enzyme products that have antagonistic effects on plant pathogenic fungi, bacteria and insects. It can effectively prevent and treat various soil-borne plant diseases, enhance plant stress resistance, improve plant nutrient utilization efficiency, promote plant growth and repair agricultural pollution environments. It is widely used in soil improvement and biological control. The strains screened out in different environments have certain differences in biological activity, metabolites and functions. Moreover, the biological control effect of Trichoderma involves the interaction between plants, Trichoderma, pathogens and the environment. Therefore, it is of great practical significance to screen an efficient strain for common maize pathogens suitable for low temperature environments in Northeast China. Summary of the invention

[0005] The present application provides a Trichoderma harzianum and its application in corn disease prevention and control. The Trichoderma harzianum CTCCSJ-F-AW10716 or its fermentation liquid can effectively inhibit at least one of Helminthosporium, Fusarium graminearum and Fusarium pseudoverticillium, and can germinate and grow in a low temperature environment, and can be applied in the biological control of corn leaf blight and root rot, stem rot and ear rot.

[0006] In a first aspect, the present application provides a Trichoderma harzianum CTCCSJ-F-AW10716, with a deposit number of CCTCC NO: M 20231036.

[0007] The strain was isolated from a soil sample from a corn field in Heihe City, Heilongjiang Province. The colony cultured on nutrient agar (PDA) at 28°C for 24 hours was transparent and fluffy. It could cover a 9-cm culture dish in about 48 hours. A dense spore-producing cluster area would form around the middle fungus disc. The color was milky white, and spores were produced, spreading outward in concentric circles. Yellow appeared in the middle spore-producing cluster area around 72 hours, and the spore-producing cluster area spread to the edge of the culture dish. Light green, yellow-green, yellow, and white were observed from the middle to the edge around 96 hours. The entire colony turned green in 5-7 days, and then gradually turned dark green, with a brown back. The spore stalks were tree-like, alternate or oppositely branched, and the main axis was straight. There were generally 2 to 3 spore stalks in a group. The spore stalks were bottle-shaped and short, slightly thin at the bottom, swollen in the middle, and thin at the top. Conidia are spherical or ovoid, with a truncate base and smooth walls, and grow successively from stalks.

[0008] The ITS sequence of the isolated strain CTCCSJ-F-AW10716 was compared in the NCBI (GenBank) database. After BLAST comparison, the standard strain with high similarity was downloaded. The phylogenetic tree of the isolated strain and the standard strain was constructed using the software MEGA11.0, thereby confirming that the strain of the isolated strain was the strain of Trichoderma harzianum (such as Figure 3 harzianum CTCCSJ-F-AW10716.

[0009] As an embodiment of the present invention, Trichoderma harzianum CTCCSJ-F-AW10716 can effectively inhibit Fusarium graminearum and Fusarium pseudoverticillium at 8°C.

[0010] In a second aspect, the present invention further provides a fermentation broth for inhibiting pathogens, comprising a fermentation broth of Trichoderma harzianum CTCCSJ-F-AW10716, wherein the Trichoderma harzianum is deposited with CCTCC NO: M20231036.

[0011] As an embodiment of the present invention, the spore content in the fermentation broth is 10 6 -2×10 6 .

[0012] As an embodiment of the present invention, the pathogen is at least one of Helminthosporium, Fusarium graminearum and Fusarium pseudoverticillium. The pathogenic bacteria inhibition fermentation liquid containing Trichoderma harzianum CTCCSJ-F-AW10716 of the present invention can effectively inhibit Helminthosporium, Fusarium graminearum and Fusarium pseudoverticillium.

[0013] In a third aspect, the present invention provides a method for preparing a fermentation broth for inhibiting pathogens, the method comprising: inoculating Trichoderma harzianum CTCCSJ-F-AW10716 in a liquid culture medium (PD); culturing at 23-28°C, 160-200r / min in a shaking table for 7-12 days, filtering out the mycelium and the culture medium to obtain a fermentation filtrate.

[0014] As an embodiment of the present invention, the spore content in the fermentation filtrate is 10 6 -2×10 6 .

[0015] As an embodiment of the present invention, 1-5 Trichoderma harzianum CTCCSJ-F-AW10716 bacterial discs are inoculated into every 100 mL of liquid culture medium. The filtration is performed 1-3 times.

[0016] In a fourth aspect, the present invention also provides a use of the aforementioned Trichoderma harzianum CTCCSJ-F-AW10716 or the fermentation liquid for pathogen inhibition in the preparation of a product for controlling corn diseases, which can be applied in the biological control of corn leaf blight, root rot, stem rot, ear rot, etc.

[0017] As an embodiment of the present invention, the corn disease is southern corn leaf blight.

[0018] As an embodiment of the present invention, the corn disease is at least one of corn root rot, stalk rot and ear rot.

[0019] As an embodiment of the present invention, the aforementioned Trichoderma harzianum CTCCSJ-F-AW10716 or the fermentation liquid for pathogen inhibition is used for preventing and controlling corn diseases under low temperature or cool environment (such as 8-15°C). The Trichoderma harzianum CTCCSJ-F-AW10716 of the present invention can survive under low temperature conditions. For example, it can germinate and grow and proliferate under 8-15°C. Further, the pathogen is at least one of Fusarium graminearum and Fusarium pseudoverticillium.

[0020] The Trichoderma harzianum provided in this application has a deposit name of CTCCSJ-F-AW10716, a deposit date of June 15, 2023, a depository of the China Center for Typical Microorganism Collection, an address of the depository of Wuhan University, Wuhan, China, and a deposit number of CCTCC NO: M 20231036.

[0021] Compared with the prior art, this application has the following beneficial effects:

[0022] 1) The strain of the present invention is isolated from soil samples of corn fields in Heihe City, Heilongjiang Province, and is adapted to low temperature or cool environments. In the application of corn disease prevention and control in Northeast China and other regions, it can play a role under low temperature conditions with excellent performance.

[0023] 2) The fermentation liquid of the strain of the present invention has a significant inhibitory effect on Helminthosporium, with an average inhibition rate of 40.89%.

[0024] 3) The fermentation liquid of the strain of the present invention has a significant inhibitory effect on Fusarium graminearum, with an average inhibition rate of 49.89%.

[0025] 4) The strain of the present invention has a significant inhibitory effect on Fusarium graminearum at 8°C, and the inhibition rate reaches 45.33% in 22 days.

[0026] 5) The strain of the present invention has a significant inhibitory effect on Fusarium spp. at 8°C, and the inhibition rate reaches 41.94% in 22 days. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0028] Figure 1 The results of microscopic observation of isolated strains (1000×);

[0029] Figure 2 It is the growth state of the isolated strain on the nutrient agar medium; where a is the back side and b is the front side;

[0030] Figure 3 Phylogenetic tree of the isolated strains;

[0031] Figure 4 The growth diagram of Trichoderma harzianum CTCCSJ-F-AW10716 of the present invention and the control Trichoderma harzianum T22 on a plate at 8°C; wherein a is a Trichoderma harzianum CTCCSJ-F-AW10716 fungus plate with mycelium grown, and b is a Trichoderma harzianum T22 fungus plate without mycelium grown;

[0032] Figure 5 The graph is a growth curve of Trichoderma harzianum CTCCSJ-F-AW10716 of the present invention and the control Trichoderma harzianum T22 at 10°C and 28°C plates.

[0033] Figure 6 The figure is a confrontation diagram of Trichoderma harzianum CTCCSJ-F-AW10716 of the present invention with Fusarium pseudo-verticillium plates under 8°C; wherein a is a blank control Fusarium pseudo-verticillium, and b is the growth inhibition of Trichoderma harzianum CTCCSJ-F-AW10716 on Fusarium pseudo-verticillium;

[0034] Figure 7 This is a diagram showing the confrontation between Trichoderma harzianum CTCCSJ-F-AW10716 and Fusarium graminearum on a plate at 8°C; wherein, a is the blank control Fusarium graminearum, and b is the growth inhibition of Fusarium graminearum by Trichoderma harzianum CTCCSJ-F-AW10716. DETAILED DESCRIPTION

[0035] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0036] Example 1 - Isolation and purification of bacterial strains

[0037] This embodiment provides a process for obtaining a new strain of bacteria. The details are as follows:

[0038] (1) Soil sample collection: Soil samples were collected from frozen black soil in corn fields in Heihe City, Heilongjiang Province, and the date and other information were recorded.

[0039] (2) Preliminary isolation of target bacteria: Weigh 10 g of the soil sample collected above and add it to a pre-sterilized Erlenmeyer flask containing 100 ml of physiological saline under aseptic conditions. After fully shaking at 28°C and 180 rpm for 30 min, let it stand for 15 min and dilute it to 10 -5 , select a dilution concentration of 10 -3 , 10 -4 , 10 -5Dilutions of 0.1-0.2 ml were taken respectively, and coated on the plate in PDA solid medium. After the liquid was sucked out, the plate was inverted and cultured at 28°C for 3 days. Single clones were picked on the plate, and different colonies were picked and streaked for separation and purification (cultured according to the above culture conditions) 2-3 times according to the morphology of the microorganisms on the plate until the colonies were single, numbered, recorded, and stored.

[0040] (3) Preliminary identification: The isolated and purified strain (i.e., isolated strain) is examined and observed under a microscope. The results are as follows: Figure 1 shown.

[0041] Example 2—Single strain properties and ITS full sequence sequencing

[0042] This example provides the single strain properties and ITS full sequence sequencing results of the isolated strain obtained in Example 1. The details are as follows:

[0043] (I) Properties of single strains

[0044] (1) Morphological characteristics

[0045] Isolated strains: The colonies cultured on nutrient agar (PDA) at 28°C for 24 hours are transparent and fluffy. They can cover a 9-cm culture dish in about 48 hours. A dense conidia cluster will form around the middle bacterial disk. The color is milky white, and spores are produced, spreading outward in concentric circles. Yellow can be observed in the middle conidia cluster after about 72 hours, and the conidia cluster spreads to the edge of the culture dish. Light green, yellow-green, yellow, and white can be observed from the middle to the edge after about 96 hours. The entire colony turns green in 5-7 days, and then gradually turns dark green, with a brown back. The spore stalks are tree-like, alternate or oppositely branched, and the main axis is straight. There are generally 2 to 3 spore stalks in a group. The spore stalks are bottle-shaped and short, slightly thin at the bottom, swollen in the middle, and thin at the top. Conidia are spherical or ovoid, with a truncated base and smooth walls, and they are born one after another from the spore stalks. Figure 1 , 2 shown.

[0046] (2) Culture characteristics

[0047] The growth conditions of the strain are pH 5.5-7.0, temperature 23-28°C, liquid culture (PD culture medium) rotation speed 160-200r / min, and can utilize a wide range of carbon sources and nitrogen sources.

[0048] (II) ITS full sequence sequencing

[0049] In order to identify the phylogenetic status of this strain, the ITS complete sequence of the isolated strain was analyzed to obtain the ITS complete sequence of the isolated strain.

[0050] The genomic DNA of Trichoderma was extracted using a kit and amplified using primers ITS5 / ITS4 (ITS4 (TCCTCCGCTTATTGATATGC), ITS5 (GGAAGTAAAAGTCGTAACAAGG)). The PCR product was sequenced by Qingke Biotechnology.

[0051] The ITS sequence of the isolated strain was compared in the NCBI (GenBank) database, and the standard strain with high similarity was downloaded after BLAST comparison. The phylogenetic tree of the isolated strain and the standard strain was constructed using the software MEGA11.0. The comparison results showed that the similarity with Trichoderma harzianum was greater than 99%, thus confirming that the strain of the isolated strain was the strain of Trichoderma harzianum (such as Figure 3 ), the isolated strain CTCCSJ-F-AW10716 was identified as Trichoderma harzianum and named as Trichoderma harzianum CTCCSJ-F-AW10716.

[0052] Compared with the relevant existing technologies, the strain Trichoderma harzianum CTCCSJ-F-AW10716 isolated and obtained in the present application has the following effects: the strain or its fermentation liquid can effectively inhibit Helminthosporium, Fusarium graminearum, and Fusarium pseudoverticillium, can be used for the biological control of corn leaf blight and corn root rot, stem rot, and ear rot, and can adapt to low temperature or cool environment.

[0053] The strain Trichoderma harzianum CTCCSJ-F-AW10716 was deposited in the China Center for Type Microorganism Collection on June 15, 2023, with the deposit number CCTCC NO:M 20231036.

[0054] Example 3

[0055] This embodiment provides a fermentation broth or bacterial suspension of Trichoderma harzianum CTCCSJ-F-AW10716.

[0056] The preparation method of the above fermentation liquid or bacterial suspension is as follows:

[0057] The isolated strain obtained in Example 1 was activated, and 5 bacterial discs (diameter 5 mm) were inoculated into each 100 mL of PD culture medium. After culturing at 28°C and 180 r / min on a shaking table for 10 days, the mycelium and culture medium were filtered out with sterile filter paper, and the filtration was repeated 3 times to finally obtain the fermentation filtrate. The spore content in the fermentation broth was 10 6 .

[0058] Performance test 1 - pathogen antagonism test

[0059] The pathogen inhibition test was conducted on the fermentation broth of Trichoderma harzianum CTCCSJ-F-AW10716. The details are as follows:

[0060] (1) Test method

[0061] The plate confrontation method was used: a 5 mm diameter bacterial plate of Trichoderma harzianum CTCCSJ-F-AW10716 strain was inoculated into the liquid culture medium (PD), and 3 bacterial plates were inoculated into every 100 mL of liquid culture medium. After culturing at 28°C and 180 r / min shaking for 10 days, the mycelium and culture medium were filtered out with sterile filter paper, and filtered twice to finally obtain the fermentation filtrate. The PDA culture medium was cooled to about 40-45°C, and the PDA culture medium and the test CTCCSJ-F-AW10716 fermentation filtrate were mixed evenly at a volume ratio of 10:1 to prepare a plate with fermentation liquid. After solidification, a 5 mm diameter bacterial plate of Long Russo and Fusarium graminearum pathogens was inoculated in the center of the plate, and a blank PDA plate was used as a control, and repeated 3 times. After culturing at 28°C for 5 days, the colony diameters of Long Russo and Fusarium graminearum pathogens were determined by the cross method, and the inhibition rate was calculated.

[0062] Inhibition rate (%) = (control pathogen colony radius - treatment pathogen colony radius) / control pathogen colony radius × 100

[0063] (2) The test results are shown in Tables 1 and 2.

[0064] Table 1 Plate inhibition rate of Trichoderma harzianum CTCCSJ-F-AW10716 fermentation broth against the pathogenic bacteria of Long Russosporium

[0065]

[0066] Table 2 Plate inhibition rate of Trichoderma harzianum CTCCSJ-F-AW10716 fermentation broth against Fusarium graminearum pathogen

[0067]

[0068]

[0069] As shown in Tables 1 and 2, the fermentation broth of Trichoderma harzianum CTCCSJ-F-AW10716 has a significant inhibitory effect on the pathogens of Trichoderma longispora and Fusarium graminearum, with the inhibition rates reaching 40.89% and 34.80%, respectively.

[0070] Corn leaf spot, also known as corn spot disease, is one of the important diseases in my country's corn producing areas. It is a fungal disease caused by infection of Helminthosporium of the order Hyphomycetales of the class Hyphomycetes of the class Hyphomycetes of the class Ascomycetes. In addition to damaging leaves, bracts and leaf sheaths, this disease is also more pathogenic to female ears and stems than large leaf spot disease, which can cause ear rot and stem breakage. Its onset time is slightly earlier than large leaf spot disease. In the early stage of the disease, translucent water-soaked brown spots will appear on the leaves; in the middle stage of the disease, the water-soaked spots gradually expand into oval brown spots of (5-16) mm × (2-4) mm, the outline becomes clear from blurred, the edge color deepens to reddish brown, and two or three layers of concentric rings grow; in the late stage of the disease, the spots are further developed, the inside of the spots fades slightly, and then gradually turns dark brown. If the weather is humid, dark black mold (conidial discs) will grow on the spots, and the conidia inside are the culprits of corn leaf spot disease. Corn leaves are seriously damaged, resulting in damage to chlorophyll tissue, reduced chlorophyll, weakened photosynthesis of corn, and ultimately reduced corn yield. Generally, the occurrence of small leaf spot can reduce corn yield by 15% to 20%, and in severe cases, it can reduce corn yield by more than 50%, and the most serious cases can lead to total crop failure. It can be seen that small leaf spot is very harmful to corn production.

[0071] Fusarium graminearum is a soil-borne pathogen and one of the main pathogens that causes corn stalk rot and ear rot. The main part of corn stalk rot is the stalk at the bottom of the ear, which damages plant tissue, blocks nutrient transport, and is easy to break; the main part of corn ear rot is the ear, which rots and leads to a decrease in yield. After corn is infected by Fusarium graminearum, the ears and kernels will rot on a large scale, and obvious mold will appear in the diseased parts. Even in the case of more serious complications, the entire ear of the corn plant will rot as a whole. Both the ears and kernels of corn can produce ear rot. When the ear is diseased, the color of the top position changes, and a mold layer of different colors is formed; when the kernel is diseased, the most obvious feature is that the surface lacks gloss and is not full, which leads to a decrease in quality. Grains infected by toxin-producing fungi cannot be used as food and feed, and lose their economic value.

[0072] Therefore, as a biocontrol bacterium, the fermentation broth of Trichoderma harzianum CTCCSJ-F-AW10716 has application potential in the prevention and control of corn leaf blight and ear rot.

[0073] Example 4

[0074] The isolated strain obtained in Example 1 was activated, and a bacterial plate was taken and cultured on a PDA medium plate to verify its adaptability to a low temperature environment; and it was confronted with pathogenic bacteria to verify its antibacterial effect on pathogenic bacteria.

[0075] Performance test 1 - low temperature resistance test

[0076] The low temperature resistance of Trichoderma harzianum CTCCSJ-F-AW10716 was verified. The details are as follows:

[0077] (1) Test materials: Trichoderma harzianum CTCCSJ-F-AW10716 and Trichoderma harzianum T22

[0078] (2) Experimental method: The two bacterial strains were inoculated on PDA culture medium plates and cultured in incubators at 8°C, 10°C, and 28°C, and the colony diameters were counted.

[0079] (3) Test results: From the diameter of the plate colonies, it can be seen that Trichoderma harzianum CTCCSJ-F-AW10716 can grow normally at 8℃, 10℃ and 28℃, and can adapt quickly from low temperature to room temperature, proliferate quickly, and grow better at 28℃, and can produce spores in only 48 hours; while the control Trichoderma harzianum T22 enters a dormant state at 8℃, and hyphae growth cannot be seen with the naked eye. It can grow hyphae at 10℃, but the growth rate is slower than that of Trichoderma harzianum CTCCSJ-F-AW10716. It can grow normally at 28℃, and the hyphae growth rate is slightly faster than that of Trichoderma harzianum CTCCSJ-F-AW10716, but it starts to produce spores after 72 hours. This shows that Trichoderma harzianum CTCCSJ-F-AW10716 is more adaptable to low temperature environments than the control Trichoderma harzianum T22, and its spore production rate is faster than that of the control Trichoderma harzianum T22. Figure 4 , 5 shown.

[0080] The temperature, nutrition and pH of the environment in which biocontrol microorganisms are actually used in the field are very different from those in the laboratory under pure culture conditions. These changes will affect the growth and proliferation of the strains, and thus affect their survival and the effect of biological control. Therefore, the actual application effect of biocontrol strains is currently unstable. For example, in a low-temperature environment with large temperature fluctuations, such as the low-temperature environment in Northeast my country in winter, the growth of biocontrol bacteria is still significantly inhibited, affecting the biological control effect.

[0081] Biological control is the most powerful tool for preventing and controlling plant diseases, and the screening and cultivation of excellent biological control strains is an important guarantee for improving the biological control effect. The Trichoderma harzianum CTCCSJ-F-AW10716 screened by the present invention is derived from the frozen soil of the corn field in Heihe. It has stronger adaptability to the corn soil in the Northeast, more stable survival, and better performance. It can effectively reduce pathogens in the soil and is suitable for green control as a biological control bacterium in low-temperature corn planting areas such as the Northeast.

[0082] Performance test 2 - Inhibition of pathogens under low temperature environment

[0083] The inhibitory effect of Trichoderma harzianum CTCCSJ-F-AW10716 on common corn pathogens under low temperature environment was verified. The details are as follows:

[0084] The plate confrontation method was used to test the antagonistic effect of Trichoderma harzianum CTCCSJ-F-AW10716 on Fusarium graminearum and Fusarium pseudo-verticillium under 8°C environment. Trichoderma harzianum CTCCSJ-F-AW10716 was inoculated on PDA plate culture medium with Fusarium graminearum and Fusarium pseudo-verticillium, respectively. The diameter of the mycelium block at the inoculation point was 5mm, and the two inoculation points were 5cm apart. Then they were cultured at 8°C, and each treatment was repeated 3 times. The blank control was inoculated with only Trichoderma harzianum CTCCSJ-F-AW10716, Fusarium graminearum and Fusarium pseudo-verticillium. The growth rate and properties of each strain were observed regularly at 18d and 22d, and the control effect was statistically analyzed.

[0085] Antagonistic effect (%) = (radius of control pathogen colony - radius of treated pathogen colony directed to biocontrol fungus) / radius of control pathogen colony × 100

[0086] From the test results, we can know that:

[0087] After growing for 18 days at 8°C, the data are shown in Table 3. The antagonistic effect of Trichoderma harzianum CTCCSJ-F-AW10716 against Fusarium graminearum was 44.44%, and the antagonistic effect against Fusarium pseudoverticillium was 38.46%.

[0088] Table 3 Antagonistic effect of Trichoderma harzianum CTCCSJ-F-AW10716 against Fusarium spp. at 8°C for 18 days

[0089] deal with Pathogen colony radius (mm) Antagonistic effect (%) Trichoderma harzianum vs Fusarium graminearum 35 44.44 Trichoderma harzianum vs. Fusarium pseudoverticillium 16 38.46 Fusarium graminearum control 63 / Fusarium pseudoverticillium control 26 /

[0090] After 22 days of growth in low temperature environment, Figure 6 , 7 As shown in Table 4, the antagonistic effect of Trichoderma harzianum CTCCSJ-F-AW10716 against Fusarium graminearum was 45.33%, and the antagonistic effect against Fusarium pseudoverticillium was 41.94%.

[0091] Table 4 Antagonistic effect of Trichoderma harzianum CTCCSJ-F-AW10716 against Fusarium spp. at 8°C for 22 days

[0092] deal with Pathogen colony radius (mm) Antagonistic effect (%) Trichoderma harzianum vs Fusarium graminearum 41 45.33 Trichoderma harzianum vs. Fusarium pseudoverticillium 18 41.94 Fusarium graminearum control 75 / Fusarium pseudoverticillium control 31 /

[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A Trichoderma harzianum ( Trichoderma harzianum )CTCCSJ-F-AW10716, the deposit number is CCTCC NO:M 20231036.

2. A fermentation liquid for inhibiting pathogenic bacteria, characterized in that: Contains Trichoderma harzianum ( Trichoderma harzianum )The fermentation broth of CTCCSJ-F-AW10716, the preservation number of the Trichoderma harzianum is CCTCC NO:M 20231036.

3. The fermentation liquid for inhibiting pathogenic bacteria according to claim 2, characterized in that The pathogenic bacteria is at least one of Helminthosporium, Fusarium graminearum, and Fusarium pseudoverticillium.

4. A method for preparing a fermentation liquid for inhibiting pathogens according to claim 2 or 3, characterized in that: The liquid culture medium was inoculated with Trichoderma harzianum CTCCSJ-F-AW10716; after culturing at 23-28°C and 160-200 r / min in a shaking incubator for 7-12 days, the mycelium and the culture medium were filtered out to obtain the fermentation filtrate.

5. A Trichoderma harzianum as claimed in claim 1 ( Trichoderma harzianum )CTCCSJ-F-AW10716 or the use of the fermentation liquid for pathogen inhibition as described in claim 2 in the preparation of a product for controlling corn diseases; the corn disease is a corn disease caused by at least one of Helminthosporium, Fusarium graminearum, and Fusarium pseudoverticillium.

6. The use according to claim 5, characterized in that The corn disease is corn leaf blight.

7. The use according to claim 5, characterized in that The corn disease is at least one of corn root rot, stem rot and ear rot.

8. The use according to claim 5, characterized in that Used to prevent and control corn diseases caused by at least one of Fusarium graminearum and Fusarium solani in low temperature or cool environment.

Images