HPV16 / 18 therapeutic vaccine, preparation method and application

Abstract

The present invention belongs to the field of bioengineering technology, in particular to a HPV16 / 18 therapeutic vaccine, preparation method and application. The present invention discloses a fusion protein, which is a protein as follows a) or b): a) the amino acid sequence is a fusion protein of SEQ ID No.2; b) the amino acid sequence shown in SEQ ID No.2 is replaced and / or deleted and / or added to obtain a fusion protein with HPV16 / 18E6-E7 activity. The recombinant adenovirus that can express the fusion protein HPV16 / 18E7 protein provided by the present invention is used as an HPV16 / 18 therapeutic vaccine (MATV3), which has good immunogenicity in a mouse model and can induce a strong cellular immune response in a short time. The study on the tumor inhibition effect of the TC-1 mouse subcutaneous tumor model showed that the growth of TC-1 tumors can be significantly inhibited after two inoculations of MATV3, and HPV 16E7 and HPV18E7-specific cellular immune responses can be generated in mice. The vaccine preparation method is fast and simple, and can be mass-produced for community populations.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular to an HPV16 / 18 therapeutic vaccine, a preparation method and an application thereof. Background Art

[0002] Human papillomavirus (HPV) is a small, non-enveloped, skin-tropic and mucosal double-stranded DNA virus belonging to the family Papillomaviridae. Human papillomavirus (HPV) is a highly prevalent human pathogen in the world and one of the most common sexually transmitted infections. To date, more than 200 HPV types have been identified, of which more than 40 are associated with female reproductive tract infections. Some strains can infect the mucosa and cause epithelial malignancies, which are important pathogenic factors for cervical cancer and cervical intraepithelial neoplasia (CIN). More than 95% of cervical cancer cases are caused by HPV infection. Cervical cancer is the fourth most common cancer in women worldwide, and the WHO estimates that there will be 604,000 new cases in 2020. Of the more than 342,000 deaths from cervical cancer in 2020, approximately 90% occurred in low- and middle-income countries. More than two-thirds of patients come from underdeveloped regions such as South Africa and Latin America, and it has become the main cause of cancer deaths in the region.

[0003] Screening can detect precancerous lesions at a stage when they are easily treatable. However, in low- and middle-income countries, people have limited access to relevant preventive measures and the disease is not detected until it has already developed to a late stage with symptoms. In addition, limited access to treatments for cancerous lesions such as surgery, radiotherapy and chemotherapy contributes to the high cervical cancer mortality rate in these countries. The high global cervical cancer mortality rate can be reduced if effective interventions are implemented at different stages.

[0004] Different types cause different clinical manifestations. According to the different tissue sites invaded, they can be divided into: low-risk skin type, high-risk skin type, low-risk mucosal type and high-risk mucosal type, etc. According to the carcinogenic potential of HPV and its correlation with cervical cancer, HPV that infects the cervix can be divided into high-risk and low-risk types. Although HPV infection is common in all women, most genital HPV infections remain asymptomatic and can be cleared on their own. However, persistent infection of the cervix with one or more high-risk HPV types has been recognized as a necessary but not sufficient factor for cervical cancer and its precursors. Among them, HPV16 and HPV18 have been identified as the main oncogenic types, causing approximately 70% of cervical cancer cases worldwide.

[0005] High-risk HPV16 / 18 has the highest detection rate in patients with cervical lesions, accounting for about 71% of all HPV subtypes. Research on the pathogenic mechanism, detection methods and prevention methods of high-risk HPV is of great significance for the early screening and treatment of cervical cancer. The HPV infection rate and type distribution vary in different regions. High-risk HPV16 / 18 / 52 / 58 is the most common infection type in my country.

[0006] Over the past three years, there have been a number of important guideline updates, including the American Cancer Society (ASC)'s "2020 Guideline Update: Screening Recommendations for People at Average Risk for Cervical Cancer"; the American Society for Colposcopy and Cervical Pathology (ASCCP)'s "2019 ASCCP Risk-Based Consensus Guidelines for the Management of Abnormal Cervical Cancer Screening and Precancerous Lesions"; and the World Health Organization's "WHO Guidelines for Screening and Treatment of Cervical Precancerous Lesions (2nd Edition)" (hereinafter referred to as the new guidelines) released in July 2021. The new guidelines propose different screening and treatment management strategies for different populations from different perspectives, identify key points for increasing screening and treatment, and their core is to increase the screening rate of cervical cancer and the treatment of precancerous lesions, and strengthen the prevention and treatment of cervical cancer, so as to achieve the WHO's goal of eliminating cervical cancer by 2030.

[0007] However, there is no specific medicine for HPV so far. The current clinical treatment method is to eliminate the virus by reducing inflammation, enhancing immunity, and destroying the living environment of the virus. Some traditional therapies for treating HPV in clinical practice, such as laser, freezing, surgery, etc., have disadvantages such as incomplete treatment, long course of treatment, and easy scarring. Among them, the most difficult to overcome is the problem of repeated recurrence of HPV after treatment. At present, all HPV vaccines are preventive vaccines and have no therapeutic effect on existing infections or lesions. In addition, existing vaccines cannot prevent all persistent infections of high-risk HPV and the cervical lesions caused. Even if the HPV vaccine is vaccinated, regular cervical cancer screening should be carried out in accordance with the recommendations of relevant departments. Therefore, the development of therapeutic vaccines has broad application prospects in the treatment of HPV.

[0008] At present, therapeutic HPV vaccines are basically in the preclinical research stage. Therapeutic vaccines mainly include attenuated vectors, nucleic acids, peptides, proteins and cell vaccines. They deliver target genes and target antigens of high-risk HPV subtype-related tumor proteins through various vectors, rely on inducing CD8+ toxic T cell-mediated cellular immune responses to eliminate infected viruses and block precancerous lesions. Compared with traditional surgical treatment of HPV infection, the successful development of therapeutic vaccines will become a minimally invasive and efficient immunotherapy method. The research and development of therapeutic HPV vaccines is mostly concentrated in developed regions such as Europe and the United States. Currently, only VGX3100, a DNA plasmid vector HPV16E6-E7 and HPV18E6-E7 HPV therapeutic vaccine developed by Inovio Pharma, a US vaccine-cancer immunotherapy company, has entered phase III clinical trials. The main disadvantage of DNA vaccines is that they are easily taken up by myocardial cells during intramuscular injection, blocking the induction of sustained immunogenicity. In addition, DNA vaccines are expensive and the vaccine recipients feel obvious pain during electroporation. Peptide vaccines are safe, highly stable, and easy to produce, but their immunogenicity is weak, and they often need to use immune adjuvants or liposomes to enhance their therapeutic efficacy. Protein vaccines also have weak immunogenicity and high production costs. Live vector attenuated vaccines mainly include recombinant bacteria and virus vectors, which replicate in large quantities in host cells by infecting the body and can induce strong cellular and humoral immunity against vaccine antigens. However, the use of live vector vaccines in immunocompromised patients still has some risks.

[0009] Recently, non-replicating adenoviral vectors have once again attracted great attention as the main vector for the anti-new coronavirus vaccine. The main advantages of non-replicating adenoviral vectors are high titer growth ability, easy operation, no integration into the human genome, strong immunogenicity, and easy clinical large-scale production. And now Ad vector vaccines for COVID-19 have been approved and used worldwide. Large-scale clinical data show the great potential and safety of Ad vectors as a vaccine platform for emerging and re-emerging infectious diseases. Based on the current status of HPV infection and treatment, as well as the research background of our laboratory, we designed an HPV therapeutic vaccine targeting HPV16 / 18E6-E7 protein, which is mainly used in people with persistent HPV infection, cervical, anal and vulvar neoplasia.

[0010] Based on the above purpose, the present invention provides a gene-optimized polynucleotide for encoding HPV16 E7 and HPV18 E7 fusion protein, the sequence of which is shown in SEQ ID No. 1. The polynucleotide is a replication-deficient human adenovirus type 5 with E1 and E3 co-deficient as a vector, and HEK293 cells with integrated adenovirus E1 gene as a packaging cell line, and a recombinant adenovirus vector novel HPV16 / 18 therapeutic vaccine is obtained by packaging. Summary of the invention

[0011] The present invention first provides a fusion protein, which is the protein of a) or b) as follows:

[0012] a) a fusion protein whose amino acid sequence is SEQ ID No. 2;

[0013] b) A fusion protein having HPV16 / 18E6-E7 binding activity obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2.

[0014] The present invention also provides a biological material related to the above fusion protein, which is any one of the following B1) to B8):

[0015] B1) a nucleic acid molecule encoding the above fusion protein;

[0016] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0017] B3) a recombinant vector containing the nucleic acid molecule described in B1),

[0018] B4) a recombinant vector containing the expression cassette described in B2);

[0019] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0020] B6) a recombinant microorganism containing the expression cassette described in B2);

[0021] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0022] B8) a recombinant microorganism containing the recombinant vector described in B4);

[0023] Optionally, the vector comprises an adenoviral vector;

[0024] Optionally, the recombinant microorganism comprises HEK293A cells.

[0025] In certain embodiments, the nucleic acid molecule is a nucleic acid molecule as shown in 1) or 2) or 3) or 4) below:

[0026] 1) The coding sequence is a DNA molecule or cDNA molecule of SEQ ID No. 2 in the sequence list;

[0027] 2) The nucleic acid sequence is the DNA molecule of SEQ ID No. 1 in the sequence list;

[0028] 3) a cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) or 2) and encodes the above-mentioned protein;

[0029] 4) A cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the above-mentioned fusion protein.

[0030] The present invention also provides the use of the above fusion protein in the preparation of vaccines or drugs for treating HPV16 / 18.

[0031] The present invention also provides the use of the above-mentioned biological material in the preparation of vaccines or drugs for treating HPV16 / 18.

[0032] The present invention also provides a primer pair for amplifying the nucleic acid molecule fragment encoding the fusion protein.

[0033] In certain embodiments, the amplification primer pair is as follows: the forward primer is as shown in SEQ ID NO.3, and the reverse primer is as shown in SEQ ID NO.4.

[0034] The present invention also provides a method for preparing the above-mentioned biomaterial, comprising the following steps: (1) cloning the HPV16 / 18 sequence; and (2) homologously recombinating the sequence in step 1 to construct a new plasmid.

[0035] The present invention also provides a method for preparing a vaccine or medicine for treating HPV16 / 18, which is obtained by cloning, breeding and purifying the above-mentioned biological materials.

[0036] The present invention also provides a vector containing the polynucleotide.

[0037] In a preferred embodiment, the shuttle vector is the Padeasy system.

[0038] The present invention also provides a human replication-deficient recombinant adenovirus capable of expressing the polynucleotide.

[0039] In a preferred embodiment, the recombinant adenovirus is derived from the Padeasy adenovirus system.

[0040] The present invention also provides the use of the above-mentioned recombinant adenovirus in the preparation of HPV16 / 18 therapeutic vaccine.

[0041] In a preferred embodiment, in the above application, the recombinant adenovirus is prepared as an injection.

[0042] In a more preferred embodiment, the recombinant adenovirus is prepared as an intramuscular injection.

[0043] The present invention also provides a method for preparing the above-mentioned fusion protein recombinant adenovirus capable of expressing fusion proteins HPV16 E7, HPV18 E7 and reticulin, the method comprising the following steps: (1) constructing a shuttle plasmid vector containing polynucleotides encoding HPV16 E7 and HPV18 E7; (2) transfecting the shuttle plasmid vector and the backbone plasmid described in step (1) into host cells; (3) culturing the host cells described in step (2); (4) harvesting the human replication-deficient recombinant adenovirus released from the cells described in step (3); (5) amplifying the recombinant adenovirus in step (4); (6) purifying the culture product in step (5). Preferably, the shuttle plasmid vector described in step (1) is pDC3.1.

[0044] Preferably, the backbone plasmid in step (2) is pad-pshuttle-BstbI, and both plasmids belong to the padeasy adenovirus system and are used together to package recombinant adenovirus containing the encoded fusion protein HPV16 / 18E7 protein in host cells.

[0045] Preferably, the cells in step (3) are HEK293 cells.

[0046] Preferably, the expanded culture method in step (5) is suspension culture.

[0047] Preferably, the purification method in step (6) is Source 30Q chromatography.

[0048] Finally, the present invention provides a vaccine or medicine for treating HPV16 / 18, wherein the product comprises the above-mentioned protein or the above-mentioned biological material.

[0049] Compared with the prior art, the present invention has at least the following beneficial effects:

[0050] The recombinant adenovirus expressing the fusion protein HPV16 / 18E7 protein provided by the present invention is used as an HPV16 / 18 therapeutic vaccine (MATV3), which has good immunogenicity in a mouse model and can induce a strong cellular immune response in a short period of time. The study on the tumor inhibition effect in the TC-1 mouse subcutaneous tumor model showed that two inoculations of MATV3 could significantly inhibit the growth of TC-1 tumors, and could produce HPV 16E7 and HPV18 E7-specific cellular immune responses in mice. The vaccine preparation method is fast and simple, and can be mass-produced for community populations. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 .Shuttle plasmid and MATV3 genome map;

[0052] Figure 2. Western blot analysis of the expression of the vaccine MATV3 fusion protein HPV16 E7-HPV18 E7-Calreticulin in cells;

[0053] Figure 3 .Western blot analysis of the effect of MATV3 vaccine fusion protein on P53 and Rb proteins.

[0054] Figure 4 Healthy C57 mice were vaccinated with MATV3 vaccine and given booster injections two weeks apart. They were divided into the following groups: MATV0, MATV3 I 14D (mice were killed 14 days after the first injection), MATV3 II 7D (mice were killed 7 days after the booster injection two weeks apart), and MATV3 II 21D (mice were killed 21 days after the booster injection two weeks apart). Statistical graph of the activation of HPV16 E7-specific mouse peripheral blood lymphocytes and spleen lymphocytes detected by multicolor flow cytometry.

[0055] Figure 5 . Healthy C57 mice were vaccinated with MATV3 vaccine and booster shots were given two weeks apart (groups were the same Figure 4 ) Flow cytometry of specific CD4+ and CD8+ cell responses induced by HPV16 E7.

[0056] Figure 6 . Healthy C57 mice were vaccinated with MATV3 vaccine and booster shots were given two weeks apart (groups were the same Figure 4 ), Statistical diagram of the activation of HPV18 E7-specific mouse peripheral blood lymphocytes and spleen lymphocytes detected by multicolor flow cytometry.

[0057] Figure 7 . Healthy C57 mice were vaccinated with MATV3 vaccine and booster shots were given two weeks apart (groups were the same Figure 4 ) Flow cytometry of specific CD4+ and CD8+ cell responses induced by HPV18 E7.

[0058] Figure 8 . Healthy C57 mice were vaccinated with MATV3 vaccine and booster shots were given two weeks apart (groups were the same Figure 4 ), Comparison of Elispot reaction statistics specific to HPV16 E7 and HPV18 E7.

[0059] Fig. 9Healthy C57 mice were vaccinated with MATV3 vaccine and given a booster shot one month later. The mice were divided into the following groups: MATV0, MATV3 I 37D (mice were killed 37 days after the first vaccination), and MATV3 II 7D (mice were killed 7 days after the booster shot one month later). The spleen lymphocytes of mice were isolated and the activation flow cytometric plots of HPV16 E7-specific CTL, Th1, Th2, CD8+CD107a+, and CD8+Ki67+ cells were detected by multicolor flow cytometry.

[0060] Fig.10 . Healthy C57 mice were vaccinated with MATV3 vaccine and boosted with a 1-month interval. Fig. 9 , Multicolor cell flow cytometry detection of HPV18 E7-specific CTL, Th1, Th2, CD8+CD107a+, and CD8+Ki67+ cell activation flow cytometric graph.

[0061] Fig.11 . Healthy C57 mice were vaccinated with MATV3 vaccine and boosted with a 1-month interval. Fig. 9 , Comparison of Elispot reaction statistics specific to HPV16 E7 and HPV18 E7.

[0062] Fig.12 .The trend of changes in HPV16 E7-specific IFN-γ production detected by Elispot after booster injections in the second and fourth weeks after healthy C57 mice were vaccinated with MATV3.

[0063] Fig.13 .The trend of changes in HPV18 E7-specific IFN-γ production detected by Elispot after booster injections in the second and fourth weeks after healthy C57 mice were vaccinated with MATV3.

[0064] Fig.14 Healthy C57 mice were inoculated with TC-1 subcutaneous tumors and the growth trend of TC-1 tumors after MATV3 vaccination on days 5 and 12.

[0065] Fig.15 .exist Fig.14 In the animal model, mice inoculated with MATV3 had almost no tumor formation. On the 40th day, TC-1 cells were inoculated again, and the growth of TC-1 subcutaneous tumors was observed and recorded.

[0066] Fig.16 Healthy C57 mice were inoculated with TC-1 subcutaneous tumors and the growth trend of TC-1 tumors after MATV3 vaccination on days 12 and 19.

[0067] Fig.17 .exist Fig.16In the animal model, MATV0 and MATV3 mice were taken on the 30th day, spleen lymphocytes were isolated, and Elispot was used to detect the production statistics of HPV16 E7 and HPV18 E7-specific IFN-γ.

[0068] Fig.18 .exist Fig.16 In the animal model, MATV0 and MATV3 mice were taken on the 30th day, spleen lymphocytes were isolated, and lymphocyte activation statistics of HPV16 E7 and HPV18 E7-specific cell responses were detected by multicolor flow cytometry. DETAILED DESCRIPTION

[0069] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0070] Recombinant protein nucleotide sequence SEQ ID NO.1: atgcacggcgatacacctacactgcacgagtacatgctggatctgcagccagagacaaccgatctctacggctacggccagctgaacgacagcagcgaggaggaggacgagatcgatggcccagctggccaggccgagccggaccgcgc ccactacaacatcgtgaccttttgttgcaagtgtgacagcacgctgcggctgtgcgtgcagagcacacgtggacatccgcaccctggaggacctgctgatgggcacactgggcatcgtgggccccatctgtagccagaagccaggatcccac ggccctaaggccacactgcaggacatcgtgctgcacctggagccccagaacgagatcccggtggacctgctgggccacggccagctgagcgacagcgaggaggagaacgatgagatcgatggcgtgaaccaccagcacctgccagcccgccgcg ccgagccacagcgccacacaatgctgtgtatgtgttgtaagtgtgaggcccgcatcgagctggtggtggagagcagcgccgacgacctgcgcgccttccagcagctgtttctgaacaccctgtcctttgtgggcccgtggtgtgcctcccagcag

[0071] ggatcccaccagaagcgcaccgccatgtttcaggacccacaggagcgcccccgcaagctgccacagctgtgcacag

[0072] agctgcagacaaccatccacgatatcatcctggagtgtgtgtactgcaagcagcagctgctgcgcagggaggtgtacg

[0073] actttgctttccgggacctgtgcatcgtgtaccgcgatgggaacccatacgctgtgggcgataagtgtctgaagttttaca

[0074] gcaagatcagcgagtaccgccactactgttacagcctgtacggcacaacactggagcagcagtacaacaagccgctg

[0075] tgtgatctgctgatcaggtgtatcaacggccagaagccactgtgtcctgaggagaagcagcgccacctggacaagaa

[0076] gcagcgcttccacaacatcaggggccggtggaccggccgctgtatgagctgttgccgcagcagccgcacacgcgga

[0077] tccgcgcgctttgaggacccaacacggcgcccctacaagctgcctgatctgtgcacggagctgaacaccagcctgca

[0078] ggacatcgagatcacctgtgtgtactgcaagacagtgctggagctgacagaggtgtttgagtttgcctttaaggatctgtt

[0079] tgtggtgtaccgcgacagcatcccccacgctgccggccacaagtgtatcgatttttacagccgcatccgcgagctgcgc

[0080] cactacagcgacagcgtgtacggcgacacactggagaagctgaccaacaccgggctgtacaacctgctgatcaggtg

[0081] cctgcggggccagaagccgctgaacccagccgagaagctgcgccacctgaacgagaagcgccgctttcacaacatc

[0082] gctgggcactaccgcggccagtgccactcgtgctgcaaccgcgcccgccaggagcgcctccagcgccgcggatcc

[0083] ctgctgtccgtgccgctgctgctcggcctcctcggcctggccgtcgccgagcctgccgtctacttcaaggagcagtttct

[0084] ggacggcgacgggtggacctcccgctggatcgagtccaagcacaagagcgattttggcaagttcgtgctcagctccg

[0085] gcaagttctacggcgacgaggagaaggataagggcctgcagacaagccaggacgcgcgcttctacgcactgtcggc

[0086] cagcttcgagcctttcagcaacaagggccagacgctggtggtgcagttcacggtgaagcacgagcagaacatcgact

[0087] gtgggggcgggtacgttaagctgttcccaaacagcctggaccagacagacatgcacggcgacagcgagtacaacat

[0088] catgtttggccccgacatctgtggccctggcaccaagaaggtgcacgtcatcttcaactacaagggcaagaacgtgctg

[0089] atcaacaaggacatccgctgcaaggatgatgagtttacacacctgtacacactgatcgtgcggccagacaacacctac

[0090] gaggtgaagatcgacaacagccaggtggagtccggctcccctggaggacgattgggacttcctgccacccaagaagaat

[0091] caaggaccctgatgctagcaagccggagactgggatgagcgggccaagatcgatgatcccacagactccaagcct

[0092] gaggactgggacaagccccgagcacatccctgaccctgatgctaagaagcccgaggactgggatgaggagatggac

[0093] ggcgagtgggagcccccagtgatccagaaccctgagtacaagggcgagtggaagccccggcagatcgacaaccca

[0094] gattacaagggcacctggatacacccagagatcgacaaccccgagtacagccccgatcccagcatctacgcctacga

[0095] taactttggcgtgctgggcctggacctctggcaggtcaagagcggcaccatctttgacaacttcctcatcaccaacgatg

[0096] aggcctacgctgaggagtttggcaacgagacgtggggcgtgacaaaggccgccgagaagcagatgaaggacaagc

[0097] aggacgaggaggagggctgaaggaggaggagaagaagcgcaaggaggaggaggccgaggac

[0098] aaggagtgatgagcaaggatgagtgaggaggatgaggaggagcaaggaggaggattgaggaggatgt

[0099] ccccggccaggccaaggacgagctgTGA;

[0100] Amino acid sequence of the recombinant protein SEQ ID NO.2: MHGDTPTLHEYMLDLQPETTDLYGYGQLNDSSEEEDEIDGPAGQAEPDRAHYNIVTFCCKCDSTLRLCVQSTHVDIRTLEDLLMGTLGIVGPICSQKPGSHGPKATLQDIVLHLEPQNEIPVDLLGHGQLSDSEEENDEIDGVNHQHLPARRAEPQRHTMLCMCCKCEARIELVVESSADDLRAFQQLFLNTLSFVGPWCASQQGSHQKRTAMFQDPQERPRKLPQLCTELQTTIHDIILECVYCKQQLLRREVYDFAFRDLCIVYRDGNPYAVGDKCLKFYSKISEYRHYCYSLYGTTLEQQYNKPLCDLLIRCINGQKPLCPEEKQRHLDKKQRFHNIRGRWTGRCMSCCRSSRTRGSARFEDPTRRPYKLPDLCTELNTSLQDIEITCVYCKTVLELTEVFEFAFKDLFVVYRDSIPHAAGHKCIDFYSRIRELRHYSDSVYGDTLEKLTNTGLYNLLIRCLRGQKPLNPAEKLRHLNEKRRFHNIAGHYRGQCHSCCNRARQERLQRRGSLLSVPLLLGLLGLAVAEPAVYFKEQFLDGDGWTSRWIESKHKSDFGKFVLSSGKFYGDEEKDKGLQTSQDARFYALSASFEPFSNKGQTLVVQFTVKHEQNIDCGGGYVKLFPNSLDQTDMHGDSEYNIMFGPDICGPGTKKVHVIFNYKGKNVLINKDIRCKDDEFTHLYTLIVRPDNTYEVKIDNSQVESGSLEDDWDFLPPKKIKDPDASKPEDWDERAKIDDPTDSKPEDWDKPEHIPDPDAKKPEDWDEEMDGEWEPPVIQNPEYKGEWKPRQIDNPDYKGTWIHPEIDNPEYSPDPSIYAYDNFGVLGLDLWQVKSGTIFDNFLITNDEAYAEEFGNETWGVTKAAEKQMKDKQDEEQRLKEEEEDKKRKEEEEAEDKEDDEDKDEDEEDEEDKEEDEEEDVPGQAKDEL;

[0101] Example 1 Preparation of recombinant HPV therapeutic vaccine MATV3 using human replication-deficient adenovirus as vector

[0102] 1. Optimization and synthesis of HPV16 E7, HPV18 E7 and reticulin genes. The target antigen of the recombinant HPV therapeutic vaccine MATV3 is the fusion protein of HPV16 E7 and HPV18 E7. The vaccine adjuvant is reticulin. By optimizing the HPV16 E7 and HPV18 E7 proteins and reticulin genes, the expression level of the fusion protein is increased, thereby improving the immunogenicity of the vaccine.

[0103] First, codon optimization was performed using Upgene software (Gao et al., A. UpGene: Application of a web-based DNA codon optimization algorithm. Biotechnol Prog, 2004. 20 (2): p. 443-8.), and most of the rare codons of HPV16 E7, HPV18 E7 proteins, and reticulin genes were changed to high-frequency codons. Secondly, considering that software optimization may mechanically change codons to codons with the highest frequency of use, protein translation efficiency may not be significantly improved due to the influence of tRNA usage efficiency, mRNA secondary structure, etc. In this case, we used a method of replacing some high-frequency and low-frequency codons by manual analysis, and evenly distributed high-frequency codons and low-frequency codons in the fusion protein gene. At the same time, considering that increasing the GC content in mRNA helps to enhance the stability of mRNA, we appropriately increased the GC content of the fusion protein gene, and distributed G and C nucleotides as evenly as possible throughout the GP gene.

[0104] After the fusion protein gene is optimized, a Kozak sequence is added in front of the translation start codon, and a restriction site EcoRI is inserted upstream of the entire sequence and a restriction site HindIII is inserted downstream to synthesize the gene sequence.

[0105] 2. Vector construction The above synthesized gene sequence was used to obtain the target gene fragment by PCR. The primers used in PCR are as follows:

[0106] As shown in SEQ ID NO.3, Forwardprimer:

[0107] GCTCGAGCCTAAGCTTCGAGCCACCATGGATGCACGGCGATACACCTAC SEQ ID NO.4 is shown, Reverse primer:

[0108] GATCGGATATCTTATTTCGTCAGAGCTTGAGCAGGCCAAAGG, the PCR product was sequenced and verified. After verification, the PCR product was purified using a PCR product purification kit (OMEGA, REF, D6492-02); the pad-pshuttle-BstbI recombinant backbone plasmid was digested with BSTBI restriction endonuclease (NEB, REF, R0519S), and DNA agarose gel electrophoresis was performed to verify it. The digested plasmid was purified using the traditional method (phenol, chloroform, isopropanol), and the target gene was connected to the pad-pshuttle-BstbI recombinant backbone plasmid of the padeasy adenovirus system using DNA ligase (NEB, REF, E2621L), transformed into T1 competent cells, coated on Kanar LB plates, single clones were picked for colony PCR identification, and DNA agarose gel electrophoresis was performed on the PCR products, and the positively identified single clones were sequenced and verified.

[0109] 3. Recombinant Adenovirus Packaging, Preparation and Identification

[0110] 3.1 Recombinant adenovirus packaging. The correctly identified single clones were shaken and the plasmid was extracted (QIAGEN, REF, 12362). The plasmid was digested with PacI restriction endonuclease (NEB, REF, R0547L). The digested plasmid was purified by conventional methods after electrophoresis verification. The digested and purified plasmid was transfected into HEK293 cells for recombinant adenovirus packaging.

[0111] The process is as follows: One day before transfection, HEK293 cells were seeded in 25 cm 2 In the cell culture flask, 1*10 6 The cells were cultured in DMEM + 10% FBS in a 37°C cell culture incubator containing 5% CO2 overnight.

[0112] On the day of transfection, the purified plasmid was taken and transfected using Lipofectamine 3000 transfection reagent (Invitrogen, Ref, L3000-001) according to the attached instructions. The specific steps are as follows:

[0113] Take 5ug of enzyme-cleaved purified plasmid from each transfection bottle, mix with 10ul P3000, and dilute with 500ulOpti-MEM. Take 15ul Lipofectamine 3000 transfection reagent and dilute with 500ulOpti-MEM. Add Lipofectamine 3000 system to the enzyme-cleaved purified plasmid, mix well, let stand at room temperature for 15 minutes, and then add to the cells.

[0114] Observe the cell toxin secretion phenomenon every day - the cells become round, swollen and translucent, resembling grape clusters, and a large number of plaques appear. When most of the cells in the transfection bottle have fallen off due to lesions, collect the toxins.

[0115] The collected virus-producing cells and supernatant were placed in a -80°C refrigerator and a 37°C water bath and repeatedly frozen and thawed three times. Centrifuged at 4000 rpm for 20 minutes, the virus-containing supernatant was collected, and the virus seed was frozen in a -80°C refrigerator.

[0116] 3.2 Identification of recombinant adenovirus

[0117] 3.2.1 PCR amplification of fusion protein and full sequence of fusion protein and sequencing identification

[0118] Take 500ul of viral supernatant and use a DNA extraction kit (QIAGEN, REF, 51104) to extract viral DNA for PCR identification and sequencing verification. The primers used are as follows:

[0119] As shown in SEQ ID NO.5, Pshuttle-CMV-F: GGTCTATATAAGCAGAGCTG

[0120] As shown in SEQ ID NO.6, Pshuttle-CMV-R: GTGGTATGGCTGATTATGATCAG PCR amplification conditions are:

[0121]

[0122]

[0123] The reaction procedure is:

[0124]

[0125] The results of DNA agarose gel electrophoresis showed that the virus strain could be amplified to a single target band with the correct fragment size. The target band was recovered and sequenced, and the comparison results indicated that the sequencing sequence was completely correct.

[0126] 3.2.2 Identification of target antigen expression HEK293 cells were infected with different recombinant adenovirus constructs, and cells were collected 48 hours later for Western blot detection of target antigens. MATV3 could detect obvious expression of the target protein. Figure 2 As shown, 1: pre-stained with Marker; 2: blank control 293 cells; 3: empty control adenovirus vector transfected 293 cells; 4: MATV3 transfected 293 cells;

[0127] 3.2.3 Recombinant adenovirus culture

[0128] HEK293 cells were cultured at 37°C and 5% CO2 using a Corning 10-layer cell factory. When the cells were cultured to a confluency of 90%, the virus was inoculated. The culture medium was replaced, and the P5 generation recombinant adenovirus was used to infect HEK293 cells at an MOI of 1, and the cells were cultured at 37°C and 5% CO2. 72 hours after the virus inoculation, when 100% of the cells showed cytopathic effect (CPE), the cells were gently shaken down, centrifuged at 100g for 5 minutes, the supernatant was discarded, and the cell residues were resuspended in 40mL of fresh culture medium. After repeated freezing and thawing in a -80°C refrigerator and a 37°C water bath for 3 times, the supernatant was taken after centrifugation at 3000RPM for 30 minutes and stored in a 4°C refrigerator for purification.

[0129] 3.2.4 Recombinant adenovirus purification

[0130] The recombinant adenovirus was purified by cesium chloride gradient centrifugation. Cesium chloride solutions of different densities were prepared: 1.5 g / mL A solution, 1.35 g / mL B solution, and 1.25 g / mL C solution. The solutions of different densities were spread in an ultracentrifuge tube in the order of solution A, solution B, solution C, and recombinant adenovirus. After centrifugation at 35,000 RPM for 1 hour using a Beckmen ultracentrifuge and a SW41 Ti horizontal rotor, the lower virus ring was aspirated, the aspirated recombinant adenovirus was mixed with cesium chloride B solution in a 1:1 ratio, and ultracentrifugation was continued. After centrifugation at 35,000 RPM for 18 hours, the virus ring was aspirated and dialyzed. The dialysate was 2mM magnesium chloride + 10mM Tris-base + 5% sucrose solution. Dialysis was performed using a dialysis bag with a molecular weight cutoff of 14KDa and a magnetic stirrer at a speed of 600RPM. The dialysate was changed every 6 hours for a total of 3 times. The recombinant adenovirus storage medium was dialyzed into a dialysate with cesium chloride. The dialyzed recombinant adenovirus was packaged and stored in a -80°C refrigerator for later use.

[0131] 3.3 Identification and titer determination of Ad5-nCoV

[0132] 3.3.1 PCR amplification of the full sequence of the target protein gene and sequencing identification

[0133] The experimental method and process are the same as 3.2.1. The results of agarose gel electrophoresis showed that all virus strains could be amplified to a single target band with the correct fragment size. The target band was recovered and sequenced, and the comparison results showed that the sequencing result sequence was completely correct.

[0134] 3.3.2 Determination of infectious titer

[0135] The recombinant adenovirus titer was determined using Takara Adeno-X TM Rapid Titer Kit. The operation was carried out according to the instructions attached to the kit. The specific method is as follows:

[0136] a) HEK293 cells were seeded in 24-well plates at a cell density of 2.5×10 5 cells / mL, 1 mL was inoculated into each well, and the culture medium was DMEM+10% FBS.

[0137] b) Use the culture medium to transfer the virus to be tested from 10 -2 Up to 10 -7 A series of virus sample dilutions were prepared by 10-fold dilution and 50 μL was added to each well.

[0138] c) The cells were cultured in a 37°C, 5% CO2 incubator for 48 hours.

[0139] d) Aspirate the culture medium of the cells and let the cells dry slightly (not too dry). Gently add 0.5 mL of ice methanol to each well and place at -20°C for 10 minutes to fix the cells.

[0140] e) Aspirate methanol and gently wash the cells three times with PBS + 1% BSA. Add 0.25 mL of anti-Hexon antibody dilution (1:1000 dilution) to each well and incubate at 37°C for 1 hour.

[0141] f) Aspirate and discard the anti-Hexon antibody, gently wash the cells three times with PBS + 1% BSA, add 0.25 mL of HRP-labeled Rat Anti-Mouse Antibody (1:500 dilution) to each well, and incubate at 37° C. for 1 hour.

[0142] g) Before discarding 0.25 mL of HRP-labeled RatAnti-MouseAntibody, dilute 10×DAB substrate with 1×Stable Peroxidase Buffer to 1×DAB working solution and allow it to reach room temperature.

[0143] h) Aspirate and discard the RatAnti-MouseAntibody dilution solution, gently wash the cells 3 times with PBS + 1% BSA, add 0.25 mL DAB working solution to each well, and leave at room temperature for 10 minutes.

[0144] i) Aspirate and discard the DAB working solution, and gently wash the cells twice with PBS.

[0145] j) Count the brown / black positive cells under a microscope. Count at least 3 fields of view randomly in each well and calculate the average number of positive cells.

[0146] k) Calculate the infectious titer (ifu / mL).

[0147] The formula is as follows: Infectious titer (ifu / mL) = number of positive cells in the field of view × number of fields per well / (virus volume (mL) × dilution).

[0148] The titer determination results showed that the infection titer of the purified recombinant adenovirus reached 1.0×10 10 ifu / mL or above.

[0149] 3.3.3 Determination of viral particle number

[0150] Mix equal volumes of 20mmol / LTris-Cl, 2mmol / L EDTA (pH 7.5) solution and 2.0% SDS solution to prepare a virus lysis solution. Take an appropriate volume of the virus sample to be tested, add 1 / 19 volume of virus lysis solution, mix it by pipetting repeatedly 10 times, and vortex for 1 minute. Place it in a 56℃ constant temperature water bath and shake it for 10 minutes, centrifuge it at 12000rpm for 5 minutes, take the supernatant, and measure the OD value at 260nm and 280nm. Calculate the number of adenovirus particles.

[0151] The results of the viral particle number determination showed that the purified recombinant adenovirus reached 1.0×10 11 VP / mL and above.

[0152] Example 2 Immunological evaluation of the recombinant adenovirus vector HPV therapeutic vaccine MATV3 in a mouse model.

[0153] Detection of specific cellular immune response induced by vaccination with a booster shot two weeks apart.

[0154] 1.1 40 healthy C57BL / 6 female mice, 10 mice in each group. Inject MATV3 virus 1*10 11 vp, and the same dose as the booster injection was injected two weeks later. The control group was empty virus MATV0. The groups were as follows: MATV0, MATV3 I 14D (mice were killed 14 days after vaccination with 1 injection), MATV3 II 7D (mice were killed 7 days after the booster injection) and MATV3 II 21D (mice were killed 21 days after the booster injection). The mice were killed, spleen and peripheral blood lymphocytes were separated, and the HPV16 E7 protein overlapping peptide library and HPV18 E7 protein overlapping peptide library were used to stimulate and culture for 6 hours, respectively, and protein secretion blockers were added to block cytokine secretion. After 6 hours, the Fc receptor was blocked, and dead cells and cell surface molecular markers were stained. After the cells were fixed and perforated, the intracellular cytokines were stained. Cell surface markers include CD3, CD4, CD8 and CD45 molecules, and intracellular cytokines include IFNγ and IL4. Flow cytometry (BD FACS CantoTM) was used to analyze the levels of IFNγ and IL4 expressed by CD4+T cells and CD8+T cells after stimulation with specific peptides. Figure 4 , Figure 5 , Figure 6 and Figure 7 As shown in Figure 2, after vaccination, spleen lymphocytes and peripheral blood lymphocytes were activated into HPV16 E7-specific CTL and Th1 cells compared with MATV0, but there was no difference in Th2 cell activation ( Figure 4 and Figure 5 ). The strongest activation group was MATV3 I 14D, followed by MATV3 II 7D, and finally MATV3II 21D. Compared with the antigenicity of HPV16 E7, the ability of HPV18 E7 peptide pool to activate effector T cells was slightly weaker, but compared with the control group, the CTL of spleen lymphocytes and peripheral blood lymphocytes in the MATV3 I 14D group was significantly activated ( Figure 6 and Figure 7 ). This shows that a specific cellular immune response against HPV16 E7 and HPV18 E7 can be produced in the body one week after vaccination, reaching a peak two weeks after vaccination. As time goes by, the effectiveness of the immune response decreases, and there is basically no obvious enhancement effect even in the second week.

[0155] 1.2 In the animal model of 1.1 above, spleen lymphocytes were isolated for Elispot experiment to further explore the production of IFN-γ specific to HPV16 E7 and HPV18 E7 after vaccination. Compared with the control group MATV0, the production of IFN-γ specific to HPV16 E7 after vaccination with MATV3 vaccine was 7 times that of the control group. However, the production of IFN-γ specific to HPV18 E7 was not significantly different between the control group and the experimental group. This may be because the number of antigen epitopes against HPV18 E7 in mice is not as many as that of HPV16 E7, which is also similar to other literature reports, such as Figure 8 shown.

[0156] Detection of specific cellular immune response induced by vaccination after a booster injection at an interval of 1 month.

[0157] 30 healthy C57BL / 6 female mice, 10 mice in each group. MATV3 virus 1*10 11 vp, with a booster shot one month later. The experimental groups were as follows: MATV0, MATV3 II 7D (killed 7 days after a booster shot one month later) and MATV3 I 37D (killed 37 days after I shot of the vaccine). The spleen and peripheral blood of the mice were taken as above, lymphocytes were separated, and the activation of lymphocytes was detected by multicolor flow cytometry after stimulation with HPV16 E7 and HPV18 E7 peptide pools. It can be seen that the booster shot after a one-month interval can significantly enhance the activation of specific CTLs, and the specific activated CD8+ cells also increased significantly, as shown in Figure 2. Fig. 9 and Fig.10 Elispot results of spleen lymphocytes are as follows Fig.11The results showed that compared with the control group MATV0, MATV3 II 7D and MATV3 I37D could produce IFN-γ against HPV16 E7 and HPV18 E7, and booster injections at an interval of one month could significantly enhance the production of specific IFN-γ.

[0158] 3. Detect the changes in cellular immune response in mice at different time points after vaccination.

[0159] Healthy C57 mice were sacrificed at one, two, three and five weeks after intramuscular injection of MATV3 I, and spleen lymphocytes were isolated and tested for changes in antigen-specific IFN-γ production by Elispot assay. In addition, Elispot assay was performed to detect changes in cellular immune responses in mice after booster injections at 2 and 4 weeks. Fig.12 and 13 . Compared with the control group, the production of specific IFN-γ against HPV16 E7 reached the positive standard one week after vaccination, reached a peak 2 weeks after vaccination, and then gradually declined. One week after the booster injection in the second week, a large amount of specific IFN-γ production was activated again, and then gradually declined. After the booster injection in the fourth week, a large amount of IFN-γ production was activated again, and it was significantly higher than the effect of a single injection. The time pattern of the production of specific IFN-γ against HPV18 E7 is basically similar to that of HPV16 E7, but the degree is significantly lower, which may be related to the small number of antigenic epitopes against HPV18 E7 in mice.

[0160] Example 3 The tumor-suppressing effect of the recombinant adenovirus vector HPV therapeutic vaccine MATV3 in a mouse subcutaneous tumor model.

[0161] 3.1 The inhibitory effect of MATV3 on TC-1 early subcutaneous tumors.

[0162] Twenty healthy female C57 mice were selected and inoculated subcutaneously with TC-1 cells at the right hip, with a density of 1×10 5 Each mouse was randomly divided into two groups, MATV0 and MATV3, on the fifth day after subcutaneous tumor inoculation. The virus was injected intramuscularly at 1*10 11 vp, the same dose of virus was inoculated on the 12th day after the subcutaneous tumor inoculation, and the size of the mouse TC-1 subcutaneous tumor was observed and measured every other day, and the tumor growth curve was drawn. Fig.14 During the entire observation period, 86% (13 / 15) of the mice in the MATV3 group had no tumors at all; the control group began to develop rice-sized tumors from the 12th day, with a tumor formation rate of 100%. The tumor inhibition rate of the MATV3 vaccine was as high as over 95%.

[0163] 3.2 Memory protection effect of MATV3.

[0164] In the animal model of 3.1 above, mice in the MATV3 group without tumor formation were transplanted with TC-1 cells again on day 40, with 1*10 5 Cells were added to each mouse. Healthy C57 female mice of the same age were selected for transplantation of TC-1 cells. The size of the TC-1 subcutaneous tumors in the mice was observed and measured every other day, and the tumor growth curve was drawn. Fig.15 As shown, the memory effect of MATV3 vaccine can 100% protect mice from tumor occurrence.

[0165] 3.3The inhibitory effect of MATV3 on TC-1 advanced subcutaneous tumors.

[0166] Twenty healthy female C57 mice were selected and inoculated subcutaneously with TC-1 cells at 1×10 5 Each mouse was randomly divided into two groups, MATV0 and MATV3, on the 12th day after subcutaneous tumor inoculation. The virus was injected intramuscularly at 1*10 11 vp, the same dose of virus was inoculated with a booster injection on the 17th day after the subcutaneous tumor inoculation, and the size of the mouse TC-1 subcutaneous tumor was observed and measured every other day, and the tumor growth curve was drawn. Fig.16 The results showed that MATV3 could effectively inhibit the growth of TC-1 advanced tumors, with a tumor inhibition rate of 81.8%.

[0167] 3.4MATV3 induces specific cellular immune response in TC-1 subcutaneous tumor-bearing mice.

[0168] The TC-1 subcutaneous tumor late stage model was established as described in 6.3 above. The mice in the MATV0 and MATV3 groups were killed on the 31st day after the subcutaneous tumor inoculation. The tumors of the mice were dissected, spleen lymphocytes were isolated, and Elispot assay and multi-color flow cytometry were performed to detect the activation of spleen lymphocytes. Fig.17 As shown in the figure: Compared with the control group MATV0, MATV3 vaccine can effectively activate the production of IFN-γ of lymphocytes against HPV16 E7 and HPV18 E7. The results of multicolor flow cytometry are shown in the figure. Fig.18 It shows that MATV3 vaccine can also effectively activate the production of CTL and Th2 cells in mice, and the activated CD8+ cells also increase significantly.

[0169] 4. Summary of the immune response of recombinant adenovirus vector MATV3 in mice.

[0170] The adenovirus vector MATV3 bivalent vaccine can effectively induce the activation of lymphocyte-specific CTL and TH cells when injected into mice intramuscularly, and can effectively inhibit the growth of TC-1 subcutaneous tumors, and can produce effective memory protection. However, experiments in mice found that the activation of HPV18 E7-specific immune response was slightly poor, which may be related to the small number of HPV18 E7 antigen epitopes in lymphocytes in mice, but the response in humans is acceptable.

[0171] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A fusion protein, wherein the fusion protein is a fusion protein whose amino acid sequence is SEQ ID No.

2.

2. The biological material related to the fusion protein according to claim 1 is any one of the following B1) to B8): B1) a nucleic acid molecule encoding the fusion protein of claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) a recombinant microorganism containing the recombinant vector described in B4); Wherein, the vector comprises an adenovirus vector; Wherein, the recombinant microorganism includes HEK293A cells.

3. The biomaterial according to claim 2, characterized in that: The nucleic acid molecule is the nucleic acid molecule shown in 1) or 2) or 3) below: 1) The coding sequence is a DNA molecule or cDNA molecule of SEQ ID No. 2 in the sequence list; 2) The nucleic acid sequence is the DNA molecule of SEQ ID No. 1 in the sequence list; 3) A cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) or 2) and encodes the protein of claim 1.

4. Use of the fusion protein according to claim 1 in the preparation of a drug for treating HPV16 / 18.

5. Use of the biomaterial according to claim 2 in the preparation of drugs for treating HPV16 / 18.

6. A primer pair for amplifying a nucleic acid molecule fragment encoding the fusion protein of claim 1.

7. The primer pair according to claim 6, characterized in that The amplification primer pair is as follows: the forward primer is shown in SEQ ID NO.3, and the reverse primer is shown in SEQ ID NO.

4.

8. A method for preparing the biomaterial according to claim 2, characterized in that: The method comprises the following steps: (1) cloning the HPV16 / 18 sequence; and (2) constructing a new plasmid by homologous recombination of the sequence in step 1.

9. A method for preparing a drug for treating HPV16 / 18, characterized in that: The biomaterial according to claim 2 is used for cloning, propagation and purification.

10. A drug for treating HPV16 / 18, characterized in that: The drug comprises the fusion protein according to claim 1 or the biomaterial according to claim 2.

Images