Universal sample nucleic acid release solution, nucleic acid extraction kit and extraction method

Abstract

The invention discloses a universal sample nucleic acid release solution, a nucleic acid extraction kit and an extraction method. The universal sample nucleic acid release solution comprises guanidine salt, sodium laurate, Tetronic 1307, tetrasodium iminodisuccinate and polyethylene glycol 200. The nucleic acid release solution of the invention is suitable for nucleic acid extraction of different pathogen samples such as viruses, bacteria, fungi, mycoplasmas, parasites, etc., has high nucleic acid yield and good extraction effect, and the nucleic acid extraction method of the invention is efficient, simple and safe.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid extraction, and more specifically, the present invention relates to a universal sample nucleic acid releasing solution, a nucleic acid extraction kit and an extraction method. Background Art

[0002] For bacteria, fungi, and mycoplasma, the standard identification process of clinical microbiology laboratories includes five steps: specimen collection, smear microscopy, isolation and culture, bacterial identification, and drug sensitivity testing. After collecting specimens, plate isolation culture or blood culture requires stable conditions (temperature, light environment, oxygen concentration, etc.) and equipment, which is highly dependent on manual labor. It generally takes 2 to 3 days, and sometimes multiple cultures are required, with a longer cycle. The positive detection rate of blood culture in China is about 10%, and that abroad is 10% to 15%. One reason is that more than 99% of pathogens in nature cannot be cultured or are difficult to culture, and the other is that the bacteria content in the sample is low, and antibiotics are injected or taken. And blood culture is suitable for sterile samples. Therefore, when the test results show multiple positive bacteria, or negative results but clinical symptoms, or the culture results are special species, repeated culture or plate isolation culture is required.

[0003] For parasites, a microscope can be used to directly confirm the worm body or eggs. However, direct observation of parasites under a microscope can only confirm the existence of the parasites, and cannot confirm the type of parasite more specifically. For parasites or larvae and eggs that cannot be observed in the microscope's field of view, molecular biology techniques are still needed for clinical diagnosis.

[0004] At present, there are several common ways to extract nucleic acids of pathogens in the laboratory:

[0005] 1. Traditional Trizol method for extracting viral nucleic acid

[0006] The reagent composition of the Trizol method is relatively simple. The reagents required are Trizol (the main components are phenol and guanidine isothiocyanate), chloroform, isopropanol, anhydrous ethanol and nuclease-free water. Trizol is generally used as a reagent for extracting total RNA and DNA. During the sample lysis or homogenization process, Trizol can maintain the integrity of RNA and DNA. After adding chloroform and centrifuging, the sample is divided into an aqueous layer and an organic layer. RNA and DNA are present in the aqueous layer. After collecting the upper aqueous layer, DNA and RNA can be precipitated by isopropanol or ethanol, so that the required nucleic acid can be obtained.

[0007] The main components of the Trizol reagent used in the traditional Trizol method for extracting nucleic acids are phenol and guanidine isothiocyanate, and chloroform needs to be added to separate DNA, RNA and protein. Phenol and chloroform are both hazardous chemicals. The purchase and use of hazardous chemicals are subject to strict national restrictions. The use of hazardous chemicals in production will have the risk of polluting the environment and may endanger the life, health and safety of workers in the production workshop.

[0008] 2. Nucleic acid extraction kit (silica gel column and magnetic beads method)

[0009] There are special nucleic acid extraction kits for different pathogens (viruses, bacteria, fungi, mycoplasmas, parasites, etc.). The main reagent components are: lysis solution, DNA / RNA carrier, nucleic acid washing solution, nuclease-free water, and 2mL collection tube with filter membrane or magnetic beads in the middle. In addition, you need to prepare 1.5mL EP tube, anhydrous ethanol, heater, etc. by yourself. The function of the lysis solution is to lyse the pathogen and release the nucleic acid in the pathogen. Subsequently, the nucleic acid is cleaned by adding nucleic acid washing solution and the nucleic acid precipitate is collected by centrifugation. Finally, the nucleic acid is dissolved in nuclease-free water to obtain a nucleic acid solution that can be used for downstream detection.

[0010] Nucleic acid extraction kits for different pathogens require strict experimental conditions. For example, you need to prepare EP tubes of specific specifications for nucleic acid extraction experiments, and you need to use a metal heater or water bath that can be heated at high temperatures. The magnetic bead method is more expensive and requires a professional magnetic bead separation instrument. In addition, easily damaged substances such as oligonucleotides and RNA may affect the separation effect of the magnetic bead method. If some of these instruments and equipment are missing in the laboratory, the experiment cannot be completed, or the experimental results may be biased.

[0011] 3. Other methods

[0012] For viruses, a virus sampling and nucleic acid extraction integrated tube can be used. Now new virus sampling and nucleic acid extraction kits are launched on the market, such as the virus sampling and nucleic acid extraction integrated tube (model: NM003) developed by Youkang Company, which can combine virus sampling and nucleic acid extraction into one, and can complete nucleic acid extraction while sampling, and obtain nucleic acid in a short time. Its intended use is for virus collection, inactivation and nucleic acid extraction of clinical samples. The kit contains a total of 4 tubes: sampling tube, extraction rod integrated tube, cleaning tube and purification tube. The sampling tube contains lysis solution for lysing viruses and releasing nucleic acids; the extraction rod integrated tube contains nucleic acid extraction rods, which can adsorb nucleic acids under lysis solution conditions; the cleaning tube contains cleaning solution, which can clean the nucleic acids adsorbed on the nucleic acid extraction rod; the purification tube contains purification solution, under the purification solution conditions, the nucleic acids adsorbed on the nucleic acid extraction rod can quickly release nucleic acids into the solution, and the obtained nucleic acid solution can be directly used for downstream experiments.

[0013] The applicable scope of the virus sampling and nucleic acid extraction integrated tube on the market is swab samples and sputum samples, which has a narrow scope of application. After the sample is collected, it needs to be sent for inspection within 48 hours and cannot be stored for a long time. The product packaging contains 4 tubes with a volume of more than 15mL, which takes up a lot of space and increases the production cost. In addition, the adsorption rod for adsorbing nucleic acid needs to be transferred between different tubes during use. Part of the nucleic acid will be lost during the transfer process, and it also brings inconvenience to the experimental operators. And because it is a 15mL centrifuge tube, the pipette goes deep into the tube for operation, which is very inconvenient and easy to contaminate the liquid in the tube. The integrated tube requires that after the sampling is completed, the sampling tube must be kept upright for more than 10 minutes to ensure that the nucleic acid extraction rod is fully in contact with the viral nucleic acid to complete the nucleic acid adsorption. In the nucleic acid purification link, the purification tube needs to be kept in a violent vortex for 3 minutes to obtain the purified nucleic acid. These steps are time-consuming, which significantly prolongs the entire experimental operation time. In actual experimental tests, it was found that although the nucleic acid extracted through the integrated virus sampling and nucleic acid extraction tube had a high purity, the nucleic acid content was very low and almost no obvious nucleic acid could be detected. In the fluorescent quantitative PCR experiment, the CT values ​​of the virus internal reference genes were high, indicating that the amount of nucleic acid extracted was very low, affecting the judgment of the entire result.

[0014] In summary, the nucleic acid extraction reagents currently used in the market and in clinical practice are mostly kits specifically designed for different pathogens. The current clinical diagnosis of pathogens requires the identification of the pathogen type before the next step of sample pretreatment. The pretreatment methods for different pathogens are different, which results in a waste of clinical samples and a lot of time. The clinical situation of unknown pathogens consumes more resources and time.

[0015] Therefore, there is a need for a nucleic acid extraction reagent that is universal in operation, has lysis, extraction, and purification effects on different pathogens (including unknown pathogens), does not contain hazardous chemicals, is environmentally friendly, and does not endanger life and health. Summary of the invention

[0016] Based on this, the purpose of the present invention is to provide a universal sample nucleic acid release solution, a nucleic acid extraction kit and an extraction method. The nucleic acid release solution of the present invention is suitable for the nucleic acid extraction of different pathogens such as viruses, bacteria, fungi, mycoplasmas, parasites, etc., and is efficient, simple and safe.

[0017] The technical solutions for achieving the above-mentioned invention objectives include the following.

[0018] In a first aspect of the present invention, a universal sample nucleic acid release solution is provided, which comprises the following components in concentrations: 0.01M to 0.1M guanidine salt, 0.1wt% to 1wt% sodium laurate, 0.1wt% to 2wt% Tetronic1307, 8mM to 20mM tetrasodium iminodisuccinate and 30wt% to 60wt% non-ionic water-soluble polymer.

[0019] The second aspect of the present invention provides a universal sample nucleic acid extraction kit, comprising the universal sample nucleic acid releasing solution and a nucleic acid lysing solution, wherein the nucleic acid lysing solution is a saturated sodium chloride solution containing 0.05-0.5M sodium hydroxide.

[0020] The third aspect of the present invention provides a method for extracting nucleic acid, using the universal sample nucleic acid extraction kit, comprising the following steps:

[0021] (1) Take a bacterial or fungal sample to be tested, centrifuge it, discard the supernatant, add nucleic acid release solution and nucleic acid lysis solution, vortex and shake, lyse at room temperature for 2 to 4 minutes, centrifuge it, and aspirate the supernatant; or

[0022] Add nucleic acid release solution and nucleic acid lysis solution to the virus, mycoplasma or parasite sample to be tested, vortex and shake, lyse at room temperature for 2 to 4 minutes, centrifuge, and aspirate the supernatant;

[0023] (2) adding the nucleic acid precipitate to the supernatant of step (1), pipetting and mixing, transferring to an adsorption column, standing, centrifuging, discarding the filtrate, and recovering the adsorption column to a collection tube;

[0024] (3) adding the nucleic acid purification solution to the adsorption column described in step (2), centrifuging, discarding the filtrate, centrifuging the empty column again, and discarding the filtrate;

[0025] (4) Add sterile water to the adsorption column of step (3), centrifuge and collect the filtrate.

[0026] The present invention has the following beneficial effects:

[0027] First, in the present invention, a certain concentration of guanidine salt, anionic surfactant sodium laurate, amphoteric surfactant Tetronic1307, chelating agent tetrasodium iminodisuccinate (IDS) and non-ionic water-soluble polymer polyethylene glycol 200 are used as sample nucleic acid releasers. The sample nucleic acid releaser can quickly inactivate viruses, destroy viral protein structures, destroy cell walls and cell membrane structures of bacteria and fungi, destroy cell membrane structures of mycoplasmas, destroy the body structure of parasites, separate nucleic acids from proteins, and is suitable for nucleic acid extraction from samples of different pathogens (including other unknown pathogens such as viruses, bacteria, fungi, mycoplasmas, parasites, etc.); and the nucleic acid releaser of the present invention can ensure the integrity of the primary structure of nucleic acids, and at the same time can inhibit nucleases released by cells to prevent nucleic acid degradation; at the same time, the operation time is significantly shortened, and most pathogens can be lysed to release nucleic acids after only 2 minutes of lysis, thereby obtaining a higher nucleic acid yield and purity. Among them, guanidine salt is a kind of powerful protein denaturant and also a powerful virus inactivator. It has the function of destroying the structure of viral proteins and has the characteristics of no RNAse and DNAse activity. It can destroy the molecular structure of RNAse and inactivate the nuclease that may exist in the sample, so as to stabilize and preserve the virus sample. Guanidine salt can improve the detection rate of the virus while inactivating the virus; sodium laurate is an anionic surfactant with good biodegradability. It not only has the function of clarifying and cleaning (it can well elute the secondary biomass such as polysaccharides, pigments and polyphenols in fungi), but also can promote sedimentation, so that the precipitated RNA / DNA has higher purity; Tetronic1307 has good interfacial activity and the advantages of both anionic and cationic surfactants, and also has good emulsification ability, dispersing ability and antistatic effect; Tetrasodium iminodisuccinate (IDS) is a new green and environmentally friendly alkaline chelating agent, which is an alternative product of aminopolycarboxylic acid chelating agents such as EDTA, DTPA and NTA, and has the characteristics of being phosphorus-free, non-toxic, pollution-free and easily biodegradable; polyethylene glycol (polyethylene glycol) Glycolyl (PEG), also known as polyoxyethylene glycol, is a type of high molecular weight compound with unique physical and chemical properties, with molecular weights ranging from hundreds to tens of thousands, formed by the polymerization of ethylene oxide and water under certain pressure and catalysts. PEG has strong hydrophilicity, which can dehydrate biological macromolecules or form complexes with biological macromolecules through hydrogen bond interaction and precipitation. It is often used for the separation and purification of bacteria, viruses, IgM monoclonal antibodies and other biological structures.

[0028] Second, in addition to the above-mentioned nucleic acid release solution, the nucleic acid extraction kit of the present invention also includes a nucleic acid lysing solution (a saturated sodium chloride solution containing sodium hydroxide). The nucleic acid lysing solution is added to the nucleic acid release solution. Sodium hydroxide provides an alkaline environment, which helps to lyse the cell walls of bacteria and fungi; the saturated sodium chloride solution precipitates most of the impurities other than nucleic acids, especially proteins. After centrifugation, the impurities are all precipitated at the bottom of the tube. At this time, the nucleic acid is still retained in the solution, so that the nucleic acid remains stable, and the solution can be sucked out to obtain preliminary purified nucleic acid. Under the same conditions, the nucleic acid extracted by the nucleic acid extraction kit of the present invention is lower than the nucleic acid extracted by the special nucleic acid extraction kit of the same type of sample, and the CT value detected by fluorescent quantitative PCR is lower, indicating that the amount of nucleic acid extracted is more and the effect is better.

[0029] Third, all components used in the nucleic acid extraction kit of the present invention do not contain hazardous chemicals such as phenol and chloroform, and are all non-toxic, harmless, safe and effective reagents; and the nucleic acid extraction kit of the present invention is small in size, and the required packaging conditions are also simpler, which saves packaging materials and space, reduces production costs, and is more environmentally friendly.

[0030] Fourth, the nucleic acid extraction method of the present invention does not require heating, proteinase K treatment, or other experimental instruments. As long as the laboratory is equipped with a high-speed centrifuge, the entire nucleic acid extraction process can be completed. The entire experimental operation process only requires transferring the liquid once, which reduces the risk of nucleic acid loss, reduces the experimental operation steps, and saves experimental operation time. The entire process only takes 8 to 10 minutes. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 These are the Ct values ​​of nucleic acids extracted from nucleic acid releasing solutions containing different concentrations of IDS in Example 3 of the present invention.

[0032] Figure 2 is the Ct value of the nucleic acid extracted from the nucleic acid releasing solution containing or not containing IDS in Example 4 of the present invention.

[0033] Figure 3 is the Ct value of nucleic acid extracted from nucleic acid releasing solution containing or not containing sodium laurate in Example 5 of the present invention.

[0034] Figure 4 is the Ct value of the nucleic acid extracted from the nucleic acid releasing solution containing or not containing guanidine isothiocyanate in Example 6 of the present invention.

[0035] Figure 5 The Ct values ​​of nucleic acids extracted from nucleic acid releasing solutions containing different concentrations of Tetronic 1307 in Example 7 of the present invention.

[0036] Figure 6is the Ct value of nucleic acid extracted from the nucleic acid releasing solution containing or not containing Tetronic 1307 in Example 8 of the present invention.

[0037] Figure 7 is the Ct value of the nucleic acid extracted by the kit containing or not containing sodium hydroxide in Example 9 of the present invention.

[0038] Figure 8 This is the nucleic acid extraction effect on other sample types and non-microbial tissues and cells in Example 10 of the present invention. DETAILED DESCRIPTION

[0039] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0040] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0041] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions, such as those described in Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0042] In some embodiments of the present invention, a universal sample nucleic acid release solution is disclosed, which includes components in the following concentrations: 0.01M~0.1M guanidine salt, 0.1wt%~1wt% sodium laurate, 0.1wt%~2wt% Tetronic1307, 8mM~20mM tetrasodium iminodisuccinate and 30wt%~60wt% non-ionic water-soluble polymer.

[0043] In some embodiments, it includes 0.04M-0.08M guanidine salt, 0.1wt%-0.5wt% sodium laurate, 1wt%-2wt% Tetronic1307, 8mM-10mM tetrasodium iminodisuccinate and 35wt%-50wt% nonionic water-soluble polymer.

[0044] In some embodiments, it includes 0.06M-0.07M guanidine salt, 0.25wt%-0.35wt% sodium laurate, 0.9wt%-1.1wt% Tetronic1307, 9.5mM-10.5mM tetrasodium iminodisuccinate and 39wt%-41wt% nonionic water-soluble polymer.

[0045] In some embodiments, the guanidine salt is guanidine hydrochloride or guanidine isothiocyanate, and / or the non-ionic water-soluble polymer is polyethylene glycol 200 (PEG-200).

[0046] In some embodiments, the universal sample nucleic acid release solution includes 0.06M-0.07M guanidine isothiocyanate, 0.25wt%-0.35wt% sodium laurate, 0.9wt%-1.1wt% Tetronic1307, 9.5mM-10.5mM tetrasodium iminodisuccinate and 39wt%-41wt% polyethylene glycol 200.

[0047] In other embodiments of the present invention, a universal sample nucleic acid extraction kit is disclosed, comprising the universal sample nucleic acid releasing solution and a nucleic acid lysing solution, wherein the nucleic acid lysing solution is a saturated sodium chloride solution containing 0.05-0.5M sodium hydroxide.

[0048] In some embodiments, the concentration of sodium hydroxide in the nucleic acid lysis solution is 0.08-0.12M.

[0049] In some embodiments, the universal sample nucleic acid extraction kit further includes a nucleic acid precipitation solution and a nucleic acid purification solution, wherein the nucleic acid precipitation solution is isopropanol, and the nucleic acid purification solution is 70% to 80% ethanol. The nucleic acid precipitation solution can precipitate the nucleic acid, and then the solution is centrifuged through an adsorption column, and the nucleic acid will be adsorbed on the filter membrane; the nucleic acid purification solution is added to the adsorption column and centrifuged to wash the nucleic acid, and then DEPC water or enzyme-free sterile water is added to dissolve the nucleic acid on the filter membrane, and the high-purity nucleic acid is collected by centrifugation.

[0050] In other embodiments of the present invention, a method for extracting nucleic acid is disclosed, comprising the following steps:

[0051] (1) Take a bacterial or fungal sample to be tested, centrifuge it, discard the supernatant, add nucleic acid release solution and nucleic acid lysis solution, vortex and shake, lyse at room temperature for 2 to 4 minutes, centrifuge it, and aspirate the supernatant;

[0052] Add nucleic acid release solution and nucleic acid lysis solution to the virus, mycoplasma or parasite sample to be tested, vortex and shake, lyse at room temperature for 2 to 4 minutes, centrifuge, and aspirate the supernatant;

[0053] (2) adding the nucleic acid precipitate to the supernatant of step (1), pipetting and mixing, transferring to an adsorption column, standing, centrifuging, discarding the filtrate, and recovering the adsorption column to a collection tube;

[0054] (3) adding the nucleic acid purification solution to the adsorption column described in step (2), centrifuging, discarding the filtrate, centrifuging the empty column again, and discarding the filtrate;

[0055] (4) Add sterile water to the adsorption column of step (3), centrifuge and collect the filtrate.

[0056] In some embodiments, in step (1), the amount of nucleic acid release solution added per mL of the bacterial liquid sample to be tested is 400-600 ul, preferably 450-550 ul, and most preferably 500 ul; the volume of the nucleic acid lysis solution added is 1 / 6-1 / 4 of the volume of the nucleic acid release solution, preferably 1 / 5.

[0057] In some embodiments, the volume of the nucleic acid releasing solution added in step (1) is 2 to 3 times, preferably 2.5 times, the volume of the virus, mycoplasma or parasite sample to be tested; the volume of the nucleic acid lysing solution added is 1 / 6 to 1 / 4, preferably 1 / 5, the volume of the nucleic acid releasing solution added.

[0058] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0059] Example 1 Universal Sample Nucleic Acid Extraction Kit and Nucleic Acid Extraction Method

[0060] This embodiment first provides a universal sample nucleic acid extraction kit, including the following components:

[0061] 1. Universal sample nucleic acid release solution (solution A): 0.064M guanidine isothiocyanate, 0.3% sodium laurate, 1% Tetronic 1307, 10mM IDS, 40% polyethylene glycol 200 (PEG-200) (with water as solvent)

[0062] 2. Nucleic acid lysis solution (Solution B): Saturated sodium chloride solution containing 0.1 M NaOH (saturated sodium chloride solution is used as a solvent to dissolve NaOH solid powder so that the final concentration of NaOH is 0.1 M).

[0063] 3. Nucleic acid precipitation solution: isopropanol.

[0064] 4. Nucleic acid purification solution: 75% ethanol.

[0065] This embodiment also provides a method for extracting nucleic acid from a sample to be tested using the nucleic acid extraction kit, comprising the following steps:

[0066] 1. For bacterial and fungal samples cultured in liquid culture medium, take 1 mL of the test bacterial solution in a centrifuge tube, centrifuge at 12,000 rpm for 30 seconds, and remove the supernatant of the culture medium; add 500 μL of nucleic acid release solution (i.e., solution A) and 100 μL of nucleic acid lysis solution (i.e., solution B) to the centrifuge tube, vortex and resuspend the bacteria, lyse for 2 minutes, and centrifuge at 15,000 rpm for 1 minute;

[0067] For other liquid samples, add 500 μL of nucleic acid release solution (i.e., solution A), 100 μL of nucleic acid lysis solution (i.e., solution B) to the centrifuge tube, then add 200 μL of the sample to be tested, vortex and mix, lyse for 2 minutes, and centrifuge at 15,000 rpm for 1 minute;

[0068] 2. Collect the supernatant after centrifugation into a new centrifuge tube, add nucleic acid precipitation solution at a volume ratio of 80% of the supernatant (e.g. collect 700 μL supernatant and add 560 μL nucleic acid precipitation solution), vortex to mix, and centrifuge for 3-5 seconds;

[0069] 3. Place the adsorption column in the collection tube, transfer 600-750 μL of the mixed solution from the previous step to the adsorption column, and centrifuge at 12,000 rpm for 30 seconds; discard the filtrate in the collection tube, and repeat this step until the mixed solution is filtered from the adsorption column;

[0070] 4. Reinstall the adsorption column in the collection tube, add 600 μL of nucleic acid purification solution to the adsorption column, and centrifuge at 12000 rpm for 30 seconds; pour out the filtrate in the collection tube, reinstall the adsorption column in the collection tube, empty the column, and centrifuge at 12000 rpm for 30 seconds to dry the adsorption column;

[0071] 5. Transfer the adsorption column to a new centrifuge tube, add 30-50 μL of DEPC water or enzyme-free sterile water to the center of the adsorption column membrane, let stand at room temperature for 2 minutes, and centrifuge at 12000 rpm for 30 seconds; collect the nucleic acid, discard the adsorption column, and store the nucleic acid at -80°C (it can be temporarily stored at -20°C if necessary, but subsequent experiments should be carried out as soon as possible).

[0072] Example 2 Fluorescence quantitative PCR verification of nucleic acid yields extracted from different samples

[0073] Fluorescence quantitative PCR was performed using the HiScript II One Step qRT-PCR SYBR Green Kit (Cat. No.: Q221-01) from Novozymes, including the following steps:

[0074] 1. Dilute the nucleic acid extracted in Example 1 10 times using DEPC water;

[0075] 2. Synthesize primer pairs

[0076] Cryptococcal 18S primers:

[0077] F:AGCGGAGGAAAAGAAAACTAACAAG(SEQ ID NO:1)

[0078] R:TTGAGCTCTTCCCGGTTCAC(SEQ ID NO:2)

[0079] Primers for the Aspergillus flavus gene beta-tubulin:

[0080] F:CTGGAGCGTATGAACGTCTAC(SEQ ID NO:3)

[0081] R:AAACCCTGGAGGCAGTCGC(SEQ ID NO:4)

[0082] Primers for 18S ribosomal RNA gene of Krusei:

[0083] F:GATAGAGGCCTACCATGGTTTT(SEQ ID NO:5)

[0084] R:CCTGCTTTGAACACTCTAA(SEQ ID NO:6)

[0085] Candida albicans gene ITS primers:

[0086] F:TTTATCAACTTGTCACACCAGA(SEQ ID NO:7)

[0087] R: GGTCAAAGTTTGAAGATATACGT (SEQ ID NO: 8) Staphylococcus aureus gene nuc primer:

[0088] F:TCGTCAAGGCTTGGCTAAGTTGC (SEQ ID NO: 9) R:GCCACTAGCAGCAGTGACACTT (SEQ ID NO: 10) Primers for 16S rRNA gene of Rhodococcus erythropolis:

[0089] F:GAGAGTTTGATCCTGGCTCAG(SEQ ID NO:11)

[0090] R:AAGGAGGTGATCCAGCC(SEQ ID NO:12)

[0091] Enterococcus gene ddl gene primers:

[0092] F: GAAAGATGTCGCTTTCTATGATTATGA (SEQ ID NO: 13) R: GCGACTTAAGCCACTTCCATCTA (SEQ ID NO: 14) Pseudomonas aeruginosa gene oprL gene primers:

[0093] F:AGCAGCCACTCCAAAGAAACC(SEQ ID NO:15)R:CCAGAGCTTCGTCAGCCTTG(SEQ IDNO:16)

[0094] Primers for Salmonella gene inv A:

[0095] F:CAGACATGCCACGGTACAAC(SEQ ID NO:17)

[0096] R:TAAATCGACGGACATCGACA(SEQ ID NO:18)

[0097] Primers for Klebsiella pneumoniae gene ureD:

[0098] F:CGGGCTGTTCACTACCTTTCATC(SEQ ID NO:19)R:GCTCATCGTCCACCCATACCT(SEQ IDNO:20)

[0099] Golden vesicular stomatitis virus (hereinafter referred to as VSV) IND primer: F: CAAGCAGACGGTTGGATGTG (SEQ ID NO: 21)

[0100] R:TGGAGTGAAGGATCGGATGG(SEQ ID NO:22)

[0101] Adenovirus HADV3 (hereinafter referred to as AD3) primers:

[0102] F:ATGCTTTCTGGGAAATGGTCG(SEQ ID NO:23)

[0103] R:CCTTTCGGAAGTTCCACTCGTA (SEQ ID NO: 24) Mycoplasma pneumoniae UAB CTIP strain genomic primer:

[0104] F:ACACCATGGGAGCTGGTAAT(SEQ ID NO:25)

[0105] R:CTTCTTCGACTTCCAGACCCAAGGCAT(SEQ ID NO:26)

[0106] Caenorhabditis elegans let-767 primers:

[0107] F:TTCAATGTCCTGCTCGTT(SEQ ID NO:27)

[0108] R:GACTCCAGCCTTTCGTG(SEQ ID NO:28)

[0109] Human β-actin Primers:

[0110] F:CTGGAACGGTGAAGGTGACA(SEQ ID NO:29)

[0111] R:AACGGACTTCCTGTAACAATGCA(SEQ ID NO:30)

[0112] Mouse β-actin Primers:

[0113] F:TCAGGTCATCACTATCGGCAAT(SEQ ID NO:31)

[0114] R:AAAGAAAGGGTGTAAAACGCA(SEQ ID NO:32)

[0115] 3. Prepare fluorescent quantitative PCR reaction solution

[0116] Element volume <![CDATA[RNase-freeddH2O]]> 3.2μl 2×OneStepSYBR Green Mix 10μl OneStepSYBR Green Enzyme Mix 1μl GeneSpecificPrimerForward(10μM) 0.4μl GeneSpecificPrimerReverse(10μM) 0.4μl Template RNA 5μl

[0117] 4. Perform fluorescence quantitative PCR reaction

[0118]

[0119] 5. Analyze the amplification curve and melting curve.

[0120] Example 3 Effect of IDS concentration

[0121] 1 mL of Cryptococcus bacterial solution shaken overnight was used as a sample, and nucleic acid was extracted using a control kit (the "Fungal RNA Extraction Kit|Fungal RNA Kit" of Guangzhou Jiebeis Biotechnology Co., Ltd., and the operation was performed according to its instructions) and different nucleic acid extraction kits (wherein, only the IDS concentration of the universal sample nucleic acid release solution in the kit was 5mM, 8mM, 10mM, 15mM, and 20mM, respectively, and the other components were the same). The method of nucleic acid extraction was the same as in Example 1, and the fluorescent quantitative PCR method of Example 2 was used to detect its Ct value. The results are shown in Figure 1 shown.

[0122] The results showed that compared with the fungus-specific nucleic acid extraction kit, when the IDS concentration in the nucleic acid release solution was between 8mM and 20mM, the Ct value was equivalent to or lower, and it had a better nucleic acid extraction effect. When the IDS concentration was between 8mM and 10mM, the Ct value was lower than that, and the effect was better. The most preferred concentration was 10mM.

[0123] Example 4: Effect of IDS

[0124] 1 mL of Aspergillus flavus (fungus), Candida krusei (fungus), Staphylococcus aureus (positive, bacteria), Pseudomonas aeruginosa (positive, bacteria), and Salmonella (negative, bacteria) bacterial liquid shaken overnight was used as a sample, and nucleic acid was extracted using different nucleic acid extraction kits (wherein the IDS concentrations of the universal nucleic acid release solution were 0 mM and 10 mM, respectively, and the other components were the same; the control kit was the same as Example 3). The method of nucleic acid extraction was the same as Example 1, and the fluorescent quantitative PCR method of Example 2 was used to detect its Ct value. The results are shown in FIG. Figure 2 shown.

[0125] The results showed that, except for Coccus krusei, the Ct values ​​obtained by qPCR detection of nucleic acids extracted by adding IDS to the universal sample nucleic acid release solution were better (lower Ct values) overall than the Ct values ​​obtained by qPCR detection of nucleic acids extracted without adding IDS.

[0126] Example 5 Effect of Sodium Laurate

[0127] 1 mL of Aspergillus flavus (fungus), Candida krusei (fungus), Staphylococcus aureus (positive, bacteria), Rhodococcus erythropolis (positive, bacteria), Enterococcus faecalis (positive, bacteria), Klebsiella pneumoniae (negative, bacteria), Pseudomonas aeruginosa (negative, bacteria), and Salmonella (negative, bacteria) bacterial liquid shaken overnight was used as a sample, and nucleic acid was extracted using a control kit (bacterial samples used the "Bacterial RNA Extraction Kit|Bacterial RNA Kit" of Guangzhou Jiebei Biotechnology Co., Ltd., and fungal samples used the "Fungal RNA Extraction Kit|Fungal RNA Kit" of Guangzhou Jiebei Biotechnology Co., Ltd., and the operation was performed according to the instructions) and different nucleic acid extraction kits (wherein, only the sodium laurate concentration of the universal sample nucleic acid release solution in the kit was 0 and 0.3% respectively, and other components were the same) The method of nucleic acid extraction was the same as in Example 1, and the Ct value was detected by the fluorescent quantitative PCR method of Example 2. The results are as follows Figure 3 shown.

[0128] The results show that, compared with the sample nucleic acids extracted by the control kit, except for Coccus krusei, the sample nucleic acids extracted by the universal sample extraction kit of the present invention have no significant difference in Ct value or lower Ct value (better effect) after qPCR detection. Compared with the universal sample nucleic acid release solution without 0.3% sodium laurate, the universal sample nucleic acid release solution containing 0.3% sodium laurate has better nucleic acid extraction effect for Coccus krusei, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, and Salmonella, and the effect is the same or slightly worse for Aspergillus flavus, Rhodococcus erythropolis, and Pseudomonas aeruginosa. Therefore, sodium laurate is preferably added to the universal nucleic acid release solution of the present invention.

[0129] Example 6 Effect of Guanidine Thiocyanate

[0130] The cultured VSV virus liquid and AD3 virus liquid were used as samples, and nucleic acid extraction was performed using a control kit (virus sampling and nucleic acid extraction integrated tube of Youkang Biotechnology (Beijing) Co., Ltd., according to its instructions) and different nucleic acid extraction kits (wherein only the guanidine isothiocyanate concentration of the universal sample nucleic acid release solution in the kit was 0 and 0.064M, respectively, and other components were the same) respectively. The method of nucleic acid extraction was the same as that in Example 1, and the Ct value was detected using the fluorescent quantitative PCR method of Example 2. The results are shown in FIG. Figure 4 shown.

[0131] The results show that the Ct values ​​obtained by qPCR detection of nucleic acids extracted using a universal nucleic acid extraction kit (containing or not containing guanidine isothiocyanate) are significantly lower than the Ct values ​​of nucleic acids extracted using a control kit; adding guanidine isothiocyanate to the universal nucleic acid release solution has a better effect on the nucleic acid extraction of VSV virus than not adding guanidine isothiocyanate, and there is no significant difference in the nucleic acid extraction effect of AD3 virus. Therefore, guanidine isothiocyanate is preferably added to the universal sample nucleic acid release solution of the present invention.

[0132] Example 7 Effect of Tetronic 1307 concentration

[0133] 1 mL of Cryptococcus bacterial solution shaken overnight was used as a sample, and nucleic acid was extracted using a control kit (the same as the control kit in Example 3, and the operation was performed according to its instructions) and different nucleic acid extraction kits (wherein only the Tetronic 1307 concentration of the universal nucleic acid release solution in the kit was 0.1%, 0.3%, 0.5%, 1%, and 2%, respectively, and the other components were the same). The method of nucleic acid extraction was the same as in Example 1, and the fluorescent quantitative PCR method in Example 2 was used to detect its Ct value. The results are shown in FIG. Figure 5 shown.

[0134] The results show that compared with the control kit, the nucleic acid extraction kit of the present invention has a lower Ct value and better effect. The concentration of Tetronic 1307 in the universal sample nucleic acid release solution can be 0.1-2%, preferably 1-2%, and more preferably 1%.

[0135] Example 8 Effect of Tetronic 1307

[0136] 1 mL of Aspergillus flavus (fungus) solution, Candida krusei (fungus) solution, Candida albicans (fungus) solution, Rhodococcus erythropolis (positive, bacteria) solution, Salmonella (negative, bacteria) solution, VSV virus solution and AD3 virus solution shaken overnight were used as samples, and nucleic acid extraction was performed using control kits (the same as the control kits in Examples 3, 5, and 6, and the operation was performed according to the instructions) and different nucleic acid extraction kits (wherein only the Tetronic 1307 concentration of the universal sample nucleic acid release solution in the kit was 0 and 1%, respectively, and other components were the same). The method of nucleic acid extraction was the same as in Example 1, and the Ct value was detected using the fluorescent quantitative PCR method in Example 2. The results are shown in FIG. Figure 6 shown.

[0137] The results show that compared with the nucleic acids of each sample extracted by the control kit, except for Rhodococcus erythropolis and Krusei, the Ct values ​​of the nucleic acids of other samples extracted by the universal sample nucleic acid extraction kit of the present invention have no significant difference or lower Ct values ​​(better effect) after qPCR detection. Compared with the universal sample nucleic acid release solution without Tetronic1307, the universal sample nucleic acid release solution containing 1% Tetronic1307 has better nucleic acid extraction effect for fungi, and no significant difference for bacteria and viruses. Therefore, Tetronic1307 is preferably added to the universal sample nucleic acid release solution of the present invention.

[0138] Example 9 Effect of alkaline environment

[0139] 1 mL of Aspergillus flavus (fungus) solution, Candida krusei (fungus) solution, Candida albicans (fungus) solution, Rhodococcus erythropolis (positive, bacteria) solution, Salmonella (negative, bacteria) solution, VSV virus solution and AD3 virus solution shaken overnight were used as samples, and nucleic acid extraction was performed using control kits (the same as the control kits in Examples 3, 5, and 6, and the operation was performed according to the instructions) and different nucleic acid extraction kits (wherein only the NaOH concentration of the nucleic acid lysis solution (B solution) in the kit was 0 and 0.1 M respectively, and the other components were the same). The method of nucleic acid extraction was the same as that in Example 1, and the Ct value was detected using the fluorescent quantitative PCR method in Example 2. The results are shown in FIG. Figure 7 shown.

[0140] The results show that for Krusei and Aspergillus flavus, the nucleic acid extracted by the nucleic acid lysate containing 0.1M sodium hydroxide is better (lower Ct value) than that by the nucleic acid lysate not containing 0.1M sodium hydroxide. For other sample types, there is no significant difference in the effect of nucleic acid extracted by the nucleic acid lysate containing 0.1M sodium hydroxide and that not containing 0.1M sodium hydroxide. Therefore, sodium hydroxide is preferably added to the nucleic acid lysate (liquid B) of the kit of the present invention.

[0141] Example 10 Effect of Nucleic Acid Extraction on Other Sample Types and Non-microbial Tissues and Cells

[0142] Mycoplasma pneumoniae, Caenorhabditis elegans, mouse heart tissue, and human THP1 macrophages were used as samples, and the universal sample nucleic acid extraction kit of Example 1 of the present invention was used to extract nucleic acid, and its effect on nucleic acid extraction of other sample types and tissues and cells was tested. The method of nucleic acid extraction is the same as that of Example 1, and the Ct value is detected by the fluorescent quantitative PCR method of Example 2. The control kit is a traditional Trizol extraction method (total RNA extraction reagent (same as Trizol) and RNA extraction auxiliary reagent (Trizol method) purchased from Guangzhou Yanyi Biotechnology Co., Ltd.). The results are as follows Figure 8 shown.

[0143] The results showed that, except for human THP1 macrophages, the Ct values ​​obtained by using the universal sample nucleic acid extraction kit of the present invention to extract nucleic acids from Mycoplasma pneumoniae, Caenorhabditis elegans and mouse heart tissue were better than the Ct values ​​of nucleic acids extracted by the control kit, indicating that the universal sample nucleic acid extraction kit of the present invention can effectively extract nucleic acids from other sample types and non-microbial tissues and cells.

[0144] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0145] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A universal sample nucleic acid extraction kit, characterized in that: The invention comprises a sample nucleic acid release solution and a nucleic acid lysis solution, wherein the sample nucleic acid release solution is composed of components with the following concentrations: 0.04 M to 0.08 M guanidine isothiocyanate, 0.1 wt% to 0.5 wt% sodium laurate, 1 wt% to 2 wt% Tetronic1307, 8 mM to 10 mM tetrasodium iminodisuccinate and 35 wt% to 50 wt% polyethylene glycol 200; and the nucleic acid lysis solution is a saturated sodium chloride solution containing 0.08 to 0.12 M sodium hydroxide.

2. The universal sample nucleic acid extraction kit according to claim 1, characterized in that: The sample nucleic acid release solution is composed of the following components: 0.064 M guanidine isothiocyanate, 0.3 wt % sodium laurate, 1 wt % Tetronic 1307, 10 mM IDS, and 40 wt % polyethylene glycol 200.

3. The universal sample nucleic acid extraction kit according to claim 2, characterized in that: The concentration of sodium hydroxide in the nucleic acid lysing solution is 0.1M.

4. The universal sample nucleic acid extraction kit according to any one of claims 1 to 3, characterized in that: The universal sample nucleic acid extraction kit also includes a nucleic acid precipitation solution and a nucleic acid purification solution, the nucleic acid precipitation solution is isopropanol, and the nucleic acid purification solution is 70% to 80% ethanol.

5. A method for extracting nucleic acid, characterized in that: Using the universal sample nucleic acid extraction kit according to any one of claims 1 to 4 comprises the following steps: (1) Take a bacterial or fungal test liquid sample, centrifuge it and discard the supernatant, add the nucleic acid release solution and nucleic acid lysis solution, vortex and shake, lyse at room temperature for 2 to 4 minutes, centrifuge it, and aspirate the supernatant; or Add the nucleic acid release solution and nucleic acid lysis solution to the virus, mycoplasma or parasite sample to be tested, vortex and shake, lyse at room temperature for 2-4 minutes, centrifuge, and aspirate the supernatant; (2) adding the nucleic acid precipitate to the supernatant of step (1), pipetting and mixing, transferring to an adsorption column, standing, centrifuging, discarding the filtrate, and recovering the adsorption column to a collection tube; (3) adding the nucleic acid purification solution to the adsorption column described in step (2), centrifuging, discarding the filtrate, centrifuging the empty column again, and discarding the filtrate; (4) Add sterile water to the adsorption column of step (3), centrifuge and collect the filtrate.

6. The method for extracting nucleic acid according to claim 5, characterized in that: In step (1), the amount of nucleic acid release solution added to each mL of the bacterial sample to be tested is 400-600 ul; the volume of the nucleic acid lysis solution added is 1 / 6-1 / 4 of the volume of the nucleic acid release solution; or The volume of the nucleic acid release solution added in step (1) is 2 to 3 times the volume of the virus, mycoplasma or parasite sample to be tested; the volume of the nucleic acid lysis solution added is 1 / 6 to 1 / 4 of the volume of the nucleic acid release solution added.

7. The method for extracting nucleic acid according to claim 6, characterized in that: The amount of nucleic acid release solution added to each mL of the bacterial sample to be tested is 450~550ul.

Images