Use of cinnamon essential oil in inhibiting airborne fungi

Abstract

The invention belongs to the field of microbial technology, and specifically relates to a use of cinnamon essential oil in inhibiting air fungi. The antibacterial test results show that cinnamon essential oil has obvious inhibitory effects on five kinds of air fungi, including Cladosporium oxysporum, Aspergillus tubingensis, Aspergillus fumigatus, Aspergillus fumigatus and Penicillium stuartii, with an inhibition rate of up to 100%.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to use of cinnamon essential oil in inhibiting air fungi. Background Art

[0002] Essential oil is a kind of aromatic fat-soluble oily substance with special smell, high concentration and low boiling point. It is generally extracted from flowers, leaves, fruits and other structures by steam distillation. Essential oil is known as liquid gold because of its natural, green and safe, diverse biological activities and easy extraction. At the same time, essential oil has a wide bactericidal spectrum and has a certain inhibitory effect on bacteria, fungi and actinomycetes. Therefore, it is widely used in medicine, pesticides, food preservation and fresh-keeping, and beauty and skin care products.

[0003] Plant essential oils are widely distributed in nature, and their chemical components are as high as hundreds of kinds, mainly terpenoid active substances, fatty acid derivatives, alcohols, aldehydes, ketone bodies and phenols and other organic compounds, such as geraniol, cinnamaldehyde, etc. The chemical active ingredients of different essential oils are not the same, and the inhibitory effects on different bacteria are also different. Terpene compounds containing integer multiples of isoprene and phenolic compounds containing benzene rings play an extremely important role in the activity of essential oils. For example, carvacrol in winter mint essential oil is highly effective in curbing the reproduction of Escherichia coli, and camphene in turmeric essential oil can effectively inhibit Bacillus subtilis. At the same time, it is generally believed that aldehydes in essential oils have a particularly significant inhibitory effect on fungi.

[0004] Cinnamon belongs to the Lauraceae family and is a traditional Chinese medicine with high medicinal value. Cinnamon essential oil (CEO) is mostly extracted from cinnamon bark and cinnamon leaves. It is safe for organisms, has a low boiling point, and contains a variety of antibacterial and free radical scavenging ingredients, such as trans-cinnamaldehyde, which has the highest content in cinnamon essential oil, accounting for about 55%, in addition to polyphenols, flavonoids, etc. Studies have shown that cinnamaldehyde, the main component of CEO, has the following functions: inhibiting microorganisms, resisting viruses, and reducing the incidence of tumors. Studies have found that cinnamon essential oil can effectively kill the hyphae and spores of Aspergillus flavus and can completely inhibit its growth.

[0005] Laboratory plant tissue culture strictly abides by the laboratory's aseptic operating procedures, and regularly turns on ultraviolet sterilization, sprays disinfectants and other sterilization measures, but some airborne fungi still infect and erode plant tissues, or fall into the culture medium, multiply rapidly, and compete with plants for limited nutrients, seriously affecting the growth of tissue culture plants. The existing method is to prevent and control microbial contamination by adding broad-spectrum antibiotics to the culture medium, but the effect is not obvious, and some chemical antibacterial agents can also poison tissue culture seedlings.

[0006] Therefore, the present invention separates and identifies the air fungi that infect plant tissues in the laboratory, with the intention of seeking a plant essential oil that can effectively inhibit these air fungi. Summary of the invention

[0007] Based on the above technical objectives, the present invention provides a use of cinnamon essential oil in inhibiting airborne fungi. The results of the antibacterial test show that cinnamon essential oil has a significant inhibitory effect on Cladosporium oxysporum, Aspergillus tubingensis, Aspergillus fumigatus, Aspergillus fumigatus and Penicillium stuartii, with an inhibition rate of up to 100%.

[0008] The technical solution provided by the present invention is as follows:

[0009] The first aspect of the present invention provides a use of cinnamon essential oil in inhibiting airborne fungi. The cinnamon essential oil is extracted according to the following steps: taking cinnamon medicinal materials, extracting by steam distillation, and collecting essential oil.

[0010] Preferably, the airborne fungus is Cladosporium oxysporum, Aspergillus tubingensis, Aspergillus fumigatus, Aspergillus flavus or Penicillium stuartii.

[0011] Preferably, the dosage ratio of cinnamon bark to water is 1 g: 20-30 mL.

[0012] Preferably, the cinnamon essential oil is prepared as an antibacterial agent for plant tissue culture.

[0013] Preferably, the cinnamon essential oil is made into a preservative for preserving fruits and vegetables.

[0014] Preferably, the cinnamon essential oil is prepared into a medicament for preventing and controlling plant diseases.

[0015] Preferably, the cinnamon essential oil is prepared into an air antibacterial agent.

[0016] Preferably, acceptable excipients are included.

[0017] Preferably, the medicament is a 250-2000 times dilution of cinnamon essential oil.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] The invention provides the use of cinnamon essential oil in inhibiting air fungi. The antibacterial test results show that cinnamon essential oil has obvious inhibitory effect on 5 kinds of air fungi (Cladosporium oxysporum, Aspergillus tubingensis, Aspergillus fumigatus, Aspergillus fumigatus and Penicillium stuartii), and the inhibition rate is as high as 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the colony morphology of 5 types of airborne fungi;

[0021] Figure 2It is Cladosporium oxysporum treated with cinnamon essential oil; a to e in the figure are CK, diluted 250 times, 500 times, 1000 times, and 2000 times respectively;

[0022] Figure 3 This is Aspergillus fumigatus treated with cinnamon essential oil; a to e in the figure are CK, diluted 250 times, 500 times, 1000 times, and 2000 times respectively;

[0023] Figure 4 This is Penicillium stuartii treated with cinnamon essential oil; a to e in the figure are CK, diluted 250 times, 500 times, 1000 times, and 2000 times respectively;

[0024] Figure 5 This is Aspergillus tubingensis treated with cinnamon essential oil; a to e in the figure are CK, diluted 250 times, 500 times, 1000 times, and 2000 times respectively;

[0025] Figure 6 This is Aspergillus flavus treated with cinnamon essential oil; a to e in the figure are CK, diluted 250 times, 500 times, 1000 times, and 2000 times respectively;

[0026] Figure 7 It is the antibacterial rate of cinnamon essential oil with different dilutions. The four dilution multiples corresponding to each bacterium on the horizontal axis are 250 times, 500 times, 1000 times and 2000 times from left to right. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below through the accompanying drawings and examples, but the protection scope of the present invention is not limited to the contents described. The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercially available reagents or reagents prepared according to conventional methods unless otherwise specified.

[0028] 1. Experimental Materials

[0029] Cinnamon was purchased from the Anguo Chinese Medicine Market in Hebei Province. When collecting samples from three culture bottles contaminated by bacteria in the tissue culture laboratory of Taishan College, contaminants with greater differences in colony morphology were selected as experimental materials as much as possible.

[0030] German eppendorf pipettes 1000μL, 200μL, 100μL (Beijing Haifeng Zhiyuan Technology Co., Ltd.); GI54T vertical automatic pressure steam sterilizer (Zhiwei Xiamen Instrument Co., Ltd.); constant temperature and humidity incubator (Suzhou Peiying Equipment Co., Ltd.); VA214 electronic balance (Shanghai Jingtian Electronic Instrument Co., Ltd.); BHC-1300IIA2 clean bench (Altai Laboratory Equipment Beijing Co., Ltd.); PCR instrument (USA ABI-2720).

[0031] PDA potato dextrose agar medium (Shanghai Bowei Microbiology Technology Co., Ltd.) and Tween-20 were both domestic analytical grade, and DP305-02 plant genomic DNA extraction kit was (Tiangen Biotechnology Co., Ltd.).

[0032] 2. Experimental methods

[0033] 2.1. Extraction of cinnamon essential oil

[0034] Weigh 100g of cinnamon bark and extract essential oil in four times. Take 25g of the plant in a 1000mL round-bottom flask, add 500mL of distilled water at a ratio of 1:20, and stir with a glass rod to make the water submerge the material. Connect the rubber tube connected to the lower end of the condenser to the faucet, let the water fill the entire condenser, and the water flows out from the upper outlet of the condenser. Connect the condenser to the essential oil extractor and fix the essential oil extractor with an iron stand. Put the round-bottom flask in the electric heating mantle and heat it slowly, adjust the voltage to 220V, and keep it slightly boiling for 2h when the essential oil starts to drip out, and stop heating until the amount of essential oil no longer increases. After the device cools down, open the piston at the lower end of the essential oil extractor, slowly release the essential oil, collect the essential oil in the extractor into a centrifuge tube, record the volume and name of the essential oil, and store it in a cool place. The remaining 75g of cinnamon bark extracts essential oils in the same way, and the obtained essential oils are combined and used as cinnamon essential oil stock solution.

[0035] Finally, 6 mL of cinnamon essential oil was extracted. The color of cinnamon essential oil is yellow, and the essential oil has a strong plant scent.

[0036] 2.2 Identification of airborne fungi

[0037] 2.2.1. Isolation and purification of air pollution fungi

[0038] Weigh 8.4g of PDA culture medium powder, mix it with 200mL ddH2O, and place the conical flask in a high-pressure sterilizer at 121℃ for 20 minutes. Take a sterile culture dish, pour 15ml of PDA culture medium that is conducive to the growth of mold and other fungi, let it solidify, and make a plate. Use a sterilized inoculation needle to pick out the mycelium of the pathogen from the contaminated plant, apply it to the middle of the PDA plate, and seal it with a sealing film to prevent other microorganisms from entering through the gap and causing contamination by miscellaneous bacteria. Then place it in a constant temperature and light incubator. When the grown white bacteria account for about half of the entire culture medium, use a high-temperature sterilized inoculation needle to dip the mycelium or spores at the edge of the colony to obtain a single colony. The mycelium here is highly active and has high purity. After the second inoculation, seal the culture dish with a sealing film, mark the numbers 36, 38, 39, 40, and 83, and invert it in a constant temperature incubator at 28℃ for 5 to 7 days.

[0039] 2.2.2 Morphological identification

[0040] Conventional microbial separation and identification techniques mainly use selective culture media and culture under ideal conditions to give the microorganisms their own growth advantages, thereby separating and purifying them. The present invention makes a preliminary judgment based on the morphological characteristics of the colonies on the culture medium, such as the color and smoothness of the colonies, as well as microscopic observation of the mycelium, conidia and other microstructures.

[0041] 2.2.3 Molecular Biological Identification

[0042] The prior art found that the ITS segment of rDNA (i.e., the transcribed spacer within the ribosome) of eukaryotic organisms is both conservative and exhibits specific sequences at the genus level, thus successfully developing a new method for identifying fungi, and designing three pairs of specific primers for rRNA-ITS: ITS1, 4, and 5. The specific fragments of most basidiomycetes and ascomycetes can be amplified by the above three ITS primers. Since intraspecific gene mutations are common and strain diversity is widespread, in order to more accurately identify air fungi to species, the present invention follows the principle of consistency within the genus and gene specificity between species, and supplements the use of the microtubule protein gene (β-tubulin) for identification.

[0043] (1) DNA extraction

[0044] Use an inoculation needle to scrape the hyphae on the surface of the culture medium and transfer them to an EP tube. Use the Tiangen Plant Genomic DNA Extraction Kit to extract DNA. Since the raw material of PDA culture medium is also eukaryotic, try to avoid contact with the culture medium when scraping the hyphae to avoid extracting DNA from the PDA culture medium.

[0045] (2) PCR amplification

[0046] The universal primers ITS-4 and ITS-5 were used to amplify the ITS fragment, and the specific primers Bt2a and Bt2b were used to amplify the tubulin gene fragment.

[0047] The PCR reaction system (30 μL) of the ITS fragment was: 2.5 μL of genomic DNA, 1.25 μL each of primer ITS-4 and primer ITS-5, 15.0 μL of 2×TaqPCR MasterMix, and 10.0 μL of ddH2O.

[0048] The PCR reaction system (30 μL) of the tubulin gene was as follows: 2.5 μL of genomic DNA, 1.25 μL each of primer Bt2a and primer Bt2b, 15.0 μL of 2×TaqPCR MasterMix, and 10.0 μL of ddH2O.

[0049] The PCR reaction conditions using ITS-4 / ITS-5 and Bt2a / Bt2b as primers were: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 10 min, for a total of 35 cycles, and storage at 4°C.

[0050] The PCR products were sequenced by the Institute of Animal Science of the Beijing Academy of Agricultural Sciences, and the sequencing results were compared with the sequences in the database using the BLAST program in the GeneBank of NCBI to find the bacterial species with the highest similarity.

[0051] Table 1 Primers and their sequences

[0052] Primers Primer sequence (5'-3') ITS-4 TCCTCCGCTTATTGATATGC, as shown in SEQ ID NO: 1 ITS-5 GGAAGTAAAAGTCGTAACAAGG, as shown in SEQ ID NO: 2 Bt2a GGTAACCAAATCGGTGCTGCTTTC, as shown in SEQ ID NO: 3 Bt2b ACCCTCAGTGTAGTGACCCTTGG, as shown in SEQ ID NO: 4

[0053] 3. Essential oil dilution antibacterial experiment

[0054] 3.1. Gradient dilution of essential oils

[0055] When the temperature of the sterilized PDA culture medium drops to about 50°C, add 0.5% Tween-20 to the cinnamon essential oil stock solution and blow with a pipette to mix it thoroughly. After emulsification, the hydrophobic essential oil will have better dispersibility in the aqueous solution and can be mixed more evenly with the culture medium in the later stage. Then add a certain amount of PDA culture medium and dilute the mixture to four concentrations of 250 times, 500 times, 1000 times, and 2000 times, and set up a group of blank controls.

[0056] Dilution process of mother solution 1: Use a 1000 μL pipette to draw 2 mL of cinnamon essential oil stock solution and add it to a 50 mL No. 1 centrifuge tube, add 1 mL of Tween-20 and 18 mL of ddH2O to prepare mother solution 1 (diluted 10 times).

[0057] 250-fold dilution process: Use a 1000μL pipette to draw 6mL of stock solution 1 into a 200mL volumetric flask, add 144mL of PDA medium to make 150mL. The essential oil concentration is 4mL / L.

[0058] 500-fold dilution process: Use a 1000μL pipette to draw 3mL of stock solution 1 into a 200mL volumetric flask, add 144mL of PDA medium to make 150mL. The essential oil concentration is 2mL / L.

[0059] 1000-fold dilution process: Use a 1000μL pipette to draw 1.5mL of stock solution 1 into a 200mL volumetric flask, add 144mL of PDA medium to make 150mL. The essential oil concentration is 1mL / L.

[0060] 2000-fold dilution process: Use a 1000μL pipette to draw 0.75mL of stock solution 1 into a 200mL volumetric flask, add 144mL of PDA medium to make 150mL. The essential oil concentration is 0.5mL / L.

[0061] Pour the prepared PDA medium containing essential oil into a disposable culture dish, with the height of the medium being between 1 and 2 mm. Make three replicates for each of the five strains at five concentrations of essential oil. Cultivate at 28°C for 7 to 10 days and record the mycelial growth.

[0062] 3.2 Preparation of bacterial suspension

[0063] Take out the frozen preserved bacteria and thaw them. Use a high temperature sterilized inoculation needle to transfer the bacterial block to the PDA culture medium in a clean bench and culture for 5 to 7 days to generate a large number of spores. Add 2 mL of 0.5% Tween-20 dilution to the culture dish containing the bacteria and use a pipette to continuously blow and mix and wash the spores. Add double distilled water to a concentration of 106 to 10 8 CFU / mL bacterial suspension was used for subsequent experiments.

[0064] Pour the bacterial suspensions of the five bacteria into three parallel experimental groups with five different dilution concentrations. Invert the plates and culture them in a constant temperature incubator at 28°C for 5 to 10 days. When the mycelium of the colony in the CK concentration culture dish no longer grows significantly, this is the most suitable time to measure the diameter of the bacteria. Use the cross method to measure the longest and shortest diameters of the bacteria and take photos to record the results. Repeat each experiment three times, record the average value of each repeated experimental group, which is the average diameter of the colony, and use the formula to calculate the inhibition rate.

[0065] 4. Data processing

[0066] The DNA sequences of five air fungi obtained from a sequencing company were imported into NCBI-BLAST for comparison to obtain the strain with the highest overlap rate.

[0067] Import the data into Excel and calculate the colony growth diameter: [colony growth diameter (mm) = average colony diameter (average value of three experimental groups) - 5 mm]

[0068] Inhibition rate of fungal growth, inhibition rate (%) = [(average growth diameter of colonies in the CK group) - (average growth diameter of colonies in the essential oil treatment group)] / (average growth diameter of colonies in the CK group) × 100%.

[0069] 5. Results and Analysis

[0070] 5.1. Identification results of five airborne fungal species

[0071] 5.1.1 Morphological identification results

[0072] When cultured at 28°C for 7 days, the colony morphology on PDA medium is as follows:

[0073] The fungal colony No. 36 is round, with a convex and wrinkled surface and radial lines. It is dark olive in color, with white edges, sparse velvety hyphae, and the colony is compact and difficult to separate. It is covered with dark green spores, and the back of the culture medium is often cracked. It was initially identified as Cladosporium.

[0074] Fungal colony No. 38 is circular with concentric circles, initially yellow-brown and then cyan, with green sclerotia in the center, white edges with fluff, and dry surface covered with powder. It belongs to the genus Penicillium or Aspergillus.

[0075] Fungal colony No. 39 is similar to No. 38. The colony is round with concentric circles, gray-green in color, with white flocculent hyphae on the edge, wrinkled on the surface, relatively more moist, with less powder content but denser hyphae and tighter combination. The inner circle of the colony has radial lines, and the outer circle is distributed in concentric circles. It belongs to the genus Penicillium or Aspergillus.

[0076] Fungal colony No. 40 is a round, concentric yellow-white colony with yellow spores in the inner circle, covered with white hyphae, sparse between hyphae, and moist colony. It was initially identified as Aspergillus.

[0077] Fungal colony No. 83 is round and yellow, with dense white hyphae in the outer circle and dense yellow hyphae and spores in the inner circle. There are radial lines on the surface of the colony. It was initially identified as Aspergillus.

[0078] 5.1.2 Molecular Biological Identification Results

[0079] The extracted DNA of five fungi numbered 36, 38, 39, 40, and 83 were used as templates, and the fragments amplified by ITS and β-tubulin as primers were sent for sequencing, and the sequences were compared for similarity.

[0080] Table 2 Species of five airborne fungi

[0081]

[0082]

[0083] 5.2. Inhibitory effect of plant essential oils on airborne fungi

[0084] Observe the growth of fungal hyphae, measure the average diameter of the colonies, and take photos to record the growth of the colonies.

[0085] The test results show that under the conditions of 250 times (4mL / L), 500 times (2mL / L), 1000 times (1mL / L), and 2000 times (0.5mL / L), cinnamon essential oil has a significant inhibitory effect on five air fungi (Cladosporium oxysporum, Aspergillus tubingensis, Aspergillus fumigatus, Aspergillus flavus, and Penicillium stuartii), with an inhibition rate of up to 100%. Figures 2 to 7 shown.

[0086] The three types of air fungi identified by the present invention: Aspergillus, Penicillium, and Cladosporium are widely distributed in soil, air, spoiled and rotten food, and diseased plant tissues. They can reproduce and grow rapidly in a short time, and prevention and control are very difficult. In daily life, people often use chemical antibacterial agents to kill and inhibit bacteria. However, unlike natural, environmentally friendly, volatile and non-residue plant essential oils, most of the commonly used chemical antibacterial agents on the market, such as 84 disinfectant, alcohol, antibiotics, etc., in order to quickly kill bacteria, are extremely irritating and corrosive, causing damage to human skin and respiratory tract, and may seriously cause pulmonary fibrosis. The harmful components in chemical antibacterial agents continue to accumulate with the circulation of substances and the flow of energy, seriously endangering the life safety of humans and other animals; long-term use of chemical antibacterial agents will cause microbial gene mutations and produce drug resistance. Therefore, the development of safe and environmentally friendly environmentally friendly antibacterial agents has received unprecedented attention in recent years. The present invention finds that cinnamon essential oil has an inhibitory effect on the three types of air fungi separated and identified, providing a scientific reference for the application in the aspects of fruit and vegetable preservation, air antibacterial, and plant disease prevention and control.

[0087] The above is based on the ideal embodiment of the present invention. Through the above description, relevant personnel can make various changes and modifications without departing from the technical concept of the present invention. The technical scope of the present invention is not limited to the content in the specification, and the technical scope must be determined according to the scope of the claims.

Claims

1. A use of cinnamon essential oil in preparing a product for inhibiting airborne fungi, wherein the product is prepared according to the following steps: Weigh 100 g of cinnamon bark, put 25 g of cinnamon bark into a 1000 mL round-bottom flask, add 500 mL of distilled water, stir with a glass rod to make the water submerge the material, connect the rubber tube connected to the lower end of the condenser to the faucet, let the water fill the entire condenser, and the water flows out from the upper outlet of the condenser. Connect the condenser to the essential oil extractor, fix the essential oil extractor with an iron stand, put the round-bottom flask in an electric heating mantle and heat it slowly, adjust the voltage to 220 V, and when the essential oil starts to drip out, keep it slightly boiling for 2 hours, stop heating when the amount of essential oil no longer increases, wait until the device is cooled, open the piston at the lower end of the essential oil extractor, slowly release the essential oil, collect the essential oil in the extractor into a centrifuge tube, and save it. The remaining 75 g of cinnamon bark is extracted with essential oil according to the same method, and the obtained essential oils are combined as cinnamon essential oil stock solution, and the stock solution is diluted 2000 times to obtain the product, and the air fungus is Penicillium sternbergii.

2. The use according to claim 1, characterized in that The cinnamon essential oil is prepared into an antibacterial agent for plant tissue culture.

3. The use according to claim 1, characterized in that The cinnamon essential oil is made into a preservative for preserving fruits and vegetables.

4. The use according to claim 1, characterized in that The cinnamon essential oil is prepared into a medicament for preventing and controlling plant diseases.

5. The use according to claim 1, characterized in that: The cinnamon essential oil is prepared into an air antibacterial agent.

6. The use according to any one of claims 3 to 5, characterized in that: Includes acceptable excipients.

Images