A high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol and its application

Abstract

The present invention belongs to the field of microbial technology, and particularly relates to a high-throughput screening method for phosphokinase mutants that can utilize isopentenol and its application. The present invention obtains a detection yeast that inactivates the mevalonate pathway by transforming brewer's yeast; the detection yeast can effectively detect highly active phosphokinase mutants in the presence of isopentenol. The high-throughput screening method is based on the characteristics of growth coupling, and can quickly screen effective mutants from a large number of mutants without the need for expensive instruments and complex methods. Compared with traditional screening methods, it has the advantages of high efficiency and simplicity. The method provides technical support for promoting the industrial production of terpenoid compounds.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a high-throughput screening method and application of a phosphokinase mutant capable of utilizing isopentenol. Background Art

[0002] Terpenoids, also known as isoprenoids, are the largest class of natural products in nature. Terpenoids are secondary metabolites that represent the largest group of natural compounds with different structures. All naturally occurring terpenoids are derived from the C5 building block, isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP). More than 70,000 terpenoids have been isolated from marine and terrestrial plants, fungi and liverworts, and terpenoids are known as a group of metabolites with a wide range of biological functions in plants, insects and animals. Although it has been determined that the commercial-scale extraction of plant terpenes and terpenoids can reach 3 million tons per year, the global sales growth rate is that demand is still growing at a rate of more than 5% per year.

[0003] Recently, a common precursor of terpenoids synthesized using the commodity chemical isopentenol as a substrate was reported, which was then used to synthesize various complex terpenoids. Therefore, this pathway is called the isopentenol utilization pathway, also known as the artificial pathway for terpenoid synthesis. Unlike the complex natural pathway (2-C-methyl-D-erythritol-4-phosphate pathway or mevalonate pathway), isopentenol only needs two steps of phosphorylation to generate precursors, and it only relies on ATP as a cofactor, is decoupled from central carbon metabolism and can maintain a high flux. As a non-natural substrate for the synthesis of terpenoids, the phosphorylation of isopentenol depends on the promiscuity of phosphokinase, so it is urgent to improve the efficiency of phosphokinase catalysis through enzyme engineering technology.

[0004] High-throughput screening techniques usually rely on expensive equipment, such as automated liquid handling systems, automated microbial screening systems, flow cytometers, and droplet microfluidics systems. High-throughput screening methods based on growth coupling can significantly reduce dependence on these instruments, and are characterized by low cost and high efficiency. Common types include synthetic nutrient deficiencies and toxic substrate detoxification, the former is used to study amino acid synthesis, cofactor regeneration, and unconventional carbon source utilization, and the latter refers to antibiotics and toxic metabolites. Growth coupling solutions can be designed using tools such as gcFront, RobustKnock, and gcOpt. Given that terpenoids are the building blocks of cells, replacing the valerate pathway with the isopentenol utilization pathway can establish a strong coupling relationship without complex calculations and cumbersome metabolic network reprogramming, and this coupling relationship makes the high-yield phenotype more evolutionarily robust. Summary of the invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a high-throughput screening method for phosphokinase mutants that can utilize isopentenol.

[0006] Another object of the present invention is to provide an application of the high-throughput screening method for the above-mentioned phosphokinase mutants capable of utilizing isopentenol.

[0007] Another object of the present invention is to provide a mutant with improved SmDAGK activity obtained by the above-mentioned high-throughput screening method and its application.

[0008] The object of the present invention is achieved by the following technical solution: A high-throughput screening method for phosphokinase mutants that can utilize isopentenol comprises the following steps:

[0009] (1) transforming a mutant gene of a phosphokinase that can utilize isopentenol into a test yeast, and spreading the resulting transformed bacterial liquid on a culture medium plate containing isopentenol for culture;

[0010] (2) selecting bacterial colonies with better growth potential and culturing them in a liquid medium containing isopentenol to obtain a culture solution;

[0011] (3) Determine the OD of the culture medium 600 The value was selected to be greater than the OD of wild-type Saccharomyces cerevisiae 600 The mutant with a value of 75% was measured for squalene accumulation by HPLC;

[0012] (4) Select mutants with higher squalene accumulation than the control and send them for sequencing to obtain mutation information.

[0013] The phosphokinase capable of utilizing isopentenol in step (1) is preferably at least one of SmDAGK and AtIPK.

[0014] The mutant gene described in step (1) is preferably obtained by site-directed mutagenesis; more preferably, by site-directed saturation mutagenesis.

[0015] The detection yeast described in step (1) is a strain obtained by using Saccharomyces cerevisiae as a starting strain and performing the following transformation: the 156th amino acid of the PRM10 gene in the Saccharomyces cerevisiae genome is mutated from leucine to glutamine (PRM10 L156Q ), and knocked out the ERG13 gene.

[0016] The Saccharomyces cerevisiae is preferably Saccharomyces cerevisiae of the CEN.PK series; more preferably Saccharomyces cerevisiae CEN.PK2-1C.

[0017] The mutation method is preferably gene editing technology; more preferably Crispr-Cas9 gene editing technology.

[0018] The specific 20nt sequence of the sgRNA used in the mutation is preferably 5'-TCATTGGCATTAATCCTGCC-3'.

[0019] The sequence of the donor DNA used in the mutation is preferably as shown in SEQ ID NO.2.

[0020] The knockout method is preferably gene editing technology; more preferably Crispr-Cas9 gene editing technology.

[0021] The specific 20nt sequence of the sgRNA used in the knockout is preferably 5'-GATTGGTTGACACATTGAGT-3'.

[0022] The sequence of the donor DNA used in the knockout is preferably as shown in SEQ ID NO.1.

[0023] The knockout is to delete the 135th to 225th bases of the ERG13 gene.

[0024] The transformation steps described in step (1) are preferably as follows: the test yeast, the mutant gene of the phosphokinase capable of utilizing isopentenol, the transformation liquid and the ssDNA are mixed evenly to obtain a transformation system; the transformation system is incubated in a 37±1°C water bath and then centrifuged to discard the supernatant; the obtained cells are resuspended in water to obtain a transformation bacterial solution.

[0025] The composition of the transformation system is preferably as follows: 2×10 7 ~1×10 8 cells, 100 μL of transformation solution, 1 μg of a mutant gene of phosphokinase that can utilize isopentenol, and 3 μL of ssDNA with a concentration of 10 mg / mL.

[0026] The conversion solution consists of 800 μL of 500 g / L PEG3350 solution, 200 μL of 2 M LiAc solution and 7.5 μL of β-mercaptoethanol.

[0027] The incubation time is preferably 20 to 40 minutes, and more preferably 30 minutes.

[0028] The centrifugal conditions are preferably 4000-8000g for 1-5 min; more preferably 6000g for 3 min.

[0029] The water is preferably deionized water.

[0030] The culture medium described in step (1) is a culture medium that is conducive to yeast growth; preferably, it is YPD culture medium.

[0031] The concentration of isopentenol in the culture medium in step (1) is preferably 0.4-0.6 g / L; more preferably 0.5 g / L.

[0032] The culture conditions in step (1) are preferably inverted culture at 30±2°C for 4 to 5 days.

[0033] The culture medium described in step (2) is a culture medium that is conducive to yeast growth; preferably, it is YPD culture medium.

[0034] The concentration of isopentenol in the culture medium in step (2) is preferably 4-6 g / L; more preferably 5 g / L.

[0035] The culture described in step (2) is shaking culture, and the culture conditions are preferably cultured at 30±2°C and 100-250rpm for 3-5 days; more preferably cultured at 30±2°C and 200-250rpm for 3-5 days.

[0036] The 75% mentioned in step (3) is based on the results of previous experimental studies. 600 The value is greater than the wild-type Saccharomyces cerevisiae OD 600 The value was 75%, and the squalene accumulation of the mutant was likely to be higher than that of the wild-type Saccharomyces cerevisiae.

[0037] The selection described in step (3) is preferably to select a yeast with an OD greater than that of the wild-type Saccharomyces cerevisiae. 600 Value mutant.

[0038] The high-throughput screening method for phosphokinase mutants that can utilize isopentenol is used in the screening of highly active phosphokinase mutants that can utilize isopentenol.

[0039] The highly active phosphokinase capable of utilizing isopentenol is preferably at least one of SmDAGK and AtIPK; preferably SmDAGK.

[0040] A mutant with improved SmDAGK activity, obtained by the above high-throughput screening method; a mutant SmDAGK S47A , mutant SmDAGK S47F , mutant SmDAGK L124A , mutant SmDAGK L124W , mutant SmDAGK S47M , mutant SmDAGK A51L , mutant SmDAGK G123R or mutant SmDAGK G123F .

[0041] The mutant SmDAGK S47A Refers to the mutation of amino acid 47 in SmDAGK from S to A. The meanings of other mutants are the same as mutant SmDAGK S47A .

[0042] The amino acid sequence of SmDAGK is shown in Genbank accession number AAA26867.1.

[0043] The use of the mutant with enhanced SmDAGK activity in the synthesis of terpenoid precursors or terpenoid compounds.

[0044] Compared with the prior art, the present invention has the following advantages and effects:

[0045] (1) The high-throughput screening method provided by the present invention does not rely on expensive instruments such as flow cytometers and droplet microfluidics, but only requires common laboratory equipment such as a constant temperature shaking table, an ELISA reader, and a high-performance liquid chromatography.

[0046] (2) The high-throughput screening method provided by the present invention is highly efficient, and triple screening can be achieved in one round of experiments. For saturation mutations at some sites, no single colony is grown during the plate screening stage because no effective mutants can be obtained, and no subsequent experiments are required.

[0047] (3) The high-throughput screening method provided by the present invention has a high throughput and can perform saturation mutations on dozens of sites at one time, which is sufficient to meet the requirements of enzyme engineering and provide a large amount of wet experimental data for deep learning. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of the construction of pYZ463-ERG13 plasmid in Example 2.

[0049] Figure 2Schematic diagram of the construction of pYZ463-PRM10 plasmid in Example 2.

[0050] Figure 3 This is a diagram of the sequencing results after the PRM10L156Q mutation was introduced into Saccharomyces cerevisiae in Example 2.

[0051] Figure 4 For Example 2, PRM10L L56Q Growth of mutant strains after ERG13 knockout; A is without PRM10L L56Q Mutation, B is PRM10L L56Q mutation.

[0052] Figure 5 For Example 2, PRM10L L56Q Figure 2. Sequencing results of the mutant strain after ERG13 knockout.

[0053] Figure 6 This is a flow chart of the high-throughput screening method of Example 3.

[0054] Figure 7 This is a graph showing the detection results of the activity-enhanced mutants obtained after mutation of the phosphokinase SmDAGK using a high-throughput method in Example 3. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0056] Yeast strain transformation: Unless otherwise specified, use Frozen-EZ Yeast Transformation II TM The kit (purchased from ZYMO RESEARCH, USA) was used for transformation according to the product instructions.

[0057] PCR amplification includes conventional denaturation, annealing and extension steps; the annealing temperature is based on the temperature recommended when the primers are designed, generally 56°C, and the extension time of the fragment is based on the instructions of the enzyme used.

[0058] The culture medium used in the present invention is as follows:

[0059] The composition of uracil-deficient medium is as follows: 1.7 g / L yeast nitrogen base, 5 g / L ammonium sulfate, 20 g / L glucose, 50 mg / L histidine, 50 mg / L leucine, and 50 mg / L tryptophan.

[0060] The primers used in the present invention are shown in Table 1:

[0061] Table 1

[0062] Primer Sequence (5’-3’) PRM10sg-F tcattggcattaatcctgccgttttagagctagaaatagcaagttaaaataaggctagt PRM10sg-R ggcaggattaatgccaatgagatcatttatctttcactgcggagaagttt PRM10-F tgcagttacacaaggctcattggcattaatccaaccaggttatattattctgtgtggtg PRM10-R gcaactaagcttcgactttgcagttctagtgcaccacacagaataatataacctggttg PRM10seq-F tcaaacgttttcgaaatttctgcatctattg PRM10seq-R gaaatttcgttagtggcattgtgatacatcc ERG13sg-F gattggttgacacattgagtgttttagagctagaaatagcaagttaaaataaggctagt ERG13sg-R actcaatgtgtcaaccaatcgatcatttatctttcactgcggagaagttt ERG13-F tgcaaatgactgaactaaaaaaacaaaagaccgctgaacaaaaaaccagcaaggtaaat ERG13-R aaaagacatgttggtttggcccagaccaattgtgtatttaccttgctggttttttgttc ERG13seq-F atgaaactctcaactaaactttgttggtgtg ERG13seq-R gacaaaacagttagggacatcg

[0063] Example 1: Rational Design

[0064] The mevalonate pathway is composed of genes such as ERG10, ERG13, HMG1 / 2, ERG12, and ERG8. We first used the genome-scale metabolic network model to simulate their knockout and found that the knockout of ERG13, HMG1 / 2, ERG12, and ERG8 genes all made the strain unable to grow (as shown in Table 2). Since ERG13 is upstream of the pathway, knocking out ERG13 can avoid the ineffective conversion of more cellular metabolites and save carbon flow. Therefore, the ERG13 gene was selected to inactivate the mevalonate pathway.

[0065] Table 2. MVA pathway gene knockout

[0066]

[0067] Example 2: Knockout of the ERG13 gene in the Saccharomyces cerevisiae genome to inactivate the MVA pathway

[0068] (1) Preliminary construction of yeast engineered strain with inactivated ERG13 gene

[0069] The specific 20nt of sgRNA for ERG13 gene knockout has a DNA sequence of 5'-GATTGGTTGACACATTGAGT-3'. ERG13sg-F and ERG13sg-R were used as primers, and pYZ463 plasmid (obtained from addgene global plasmid sharing platform, Plasmid#187971, TEF1p-Cas9-CYC1t and SNR52p-Not1-SUP4t) was used as a template for amplification. After nucleic acid gel electrophoresis verification, it was transformed into Escherichia coli DH5α and cultured for 12 hours. Two single colonies were randomly selected and cultured for 12 hours, and the plasmid was extracted and sent for sequencing verification to obtain the plasmid pYZ463-ERG13 ( Figure 1 ). Primers ERG13-F and RG13-R with 24 overlapping bases were used as templates for PCR amplification and purification to obtain the donor DNA of ERG13 (also shown in SEQ NO.1):

[0070] TGCAAATGACTGAACTAAAAAAACAAAAGACCGCTGAACAAAAAACCAGCAAGGTAAATACACAATTGGTCTGGGCCAAACCAACATGTCTTTT.

[0071] Yeast Transformation Kit (Frozen-EZ Yeast Transformation IITM Kit, purchased from ZYMORESEARCH, USA), 100ng Donor DNA and 1μg pYZ463-ERG13 plasmid were transformed into Saccharomyces cerevisiae CEN.PK2-1C and coated on uracil-deficient medium agar plate supplemented with 5mM mevalonic acid. However, we found that Saccharomyces cerevisiae could not grow even when mevalonic acid was added after knocking out the mevalonic acid pathway. Therefore, it is necessary to transform the yeast so that it can resume growth in a medium containing mevalonic acid after knocking out ERG13, so that yeast with ERG13 knockout can be screened.

[0072] (2) Reconstruction of ERG13 gene-inactivated yeast

[0073] The specific 20nt of sgRNA for PRM10 (Genbank accession number WNV73292.1, 383 amino acids) gene mutation has a DNA sequence of 5'-TCATTGGCATTAATCCTGCC-3'. Then, PRM10sg-F and PRM10sg-R were used as primers and pYZ463 plasmid was used as template for amplification. After verification by nucleic acid gel electrophoresis, it was transformed into Escherichia coli DH5α and cultured for 12 hours. Two single colonies were randomly selected and cultured for 12 hours, and the plasmid was extracted and sent for sequencing verification to obtain the plasmid pYZ463-PRM10 ( Figure 2 Primers PRM10-F and PRM10-R have 28 overlapping bases and serve as templates for PCR amplification and purification to obtain Donor DNA (also shown in SEQ NO.2):

[0074] TGCAGTTACACAAGGCTCATTGGCATTAATCCAACCAGGTTATATTATTCTGTGTGGTGCACTAGAACTGCAAAGTCGAAGCTTAGTTGC.

[0075] 100 ng of Donor DNA and 1 μg of plasmid pYZ463-PRM10 were transformed into Saccharomyces cerevisiae CEN.PK2-1C and plated on uracil-deficient medium agar plates supplemented with 5 mM mevalonic acid. After culturing in a 30°C incubator for about 4 days, 4 colonies were randomly selected and amplified by PCR using primers PRM10seq-F and PRM10seq-R and then sent for sequencing. After sequencing verification, PRM10 L156Q The mutant Saccharomyces cerevisiae strain was named IUP0. Figure 3 shown.

[0076] 100 ng of ERG13 Donor DNA and 1 μg of pYZ463-ERG13 were transformed into the IUP0 strain, and colonies were found to grow on the plate ( Figure 4 ), the corresponding colonies were amplified by PCR using ERG13seq-F / ERG13seq-R primers and then sequenced, and finally a Saccharomyces cerevisiae strain in which the MVA pathway was inactivated due to ERG13 knockout was obtained, and the strain was named IUP1( Figure 5 ).

[0077] Example 3: High-throughput screening method and application

[0078] (1) The method is as follows:

[0079] The IUP1 strain was inoculated into a sterile 12 mL culture tube containing 3 mL YPD medium (with 5 mm MVA added) and cultured at 30°C and 220 rpm for 36 to 48 hours. Then 250 μL of the culture solution was centrifuged at 6000 g for 3 minutes and the supernatant was discarded. Then 100 μL of the transformation solution, 1 μg of the purified phosphokinase site-saturated mutant DNA product and 3 μL of 10 mg / mL salmon sperm DNA (ssDNA) were added. The transformation solution consisted of 800 μL of 500 g / L PEG3350 solution, 200 μL of 2 M LiAc solution and 7.5 μL of β-mercaptoethanol. After vortex mixing for 10 seconds, incubate in a 37°C water bath for 30 minutes, centrifuge at 6000 g for 3 minutes, and discard the supernatant. The cell pellet was resuspended in 100 μL ddH2O, spread on a YPD agar plate supplemented with 0.5 g / L isoprenol, and incubated at 30°C for 4-5 days.

[0080] Since the efficiency of phosphokinase is coupled to cell growth, most of the inactive mutants could not grow on YPD agar plates containing 0.5 g / L isoprenol. The mutants grown were cultured in 48-well plates at 220 rpm and 30°C for 4 days (the culture medium was YPD containing 5 g / L isoprenol). 600 Less than wild-type Saccharomyces cerevisiae (CEN.PK2-1C) OD 600 75% of the mutants were further eliminated. Finally, a small number of mutants were used for squalene determination ( Figure 6 ), the higher the squalene accumulation, the higher the activity of the mutant.

[0081] To determine the amount of squalene accumulation, 0.2 mL of fermentation broth was added to a 2 mL crushing tube containing 0.7 g of 0.5 mm diameter glass beads and 1 mL of ethyl acetate. The cells were crushed using a Bioprep-24R homogenizer and then centrifuged at 10,000 g for 1 min. The upper ethyl acetate layer was filtered through a 0.22 μm syringe filter for HPLC analysis using an LC-16 equipped with a SPD-16 dual wavelength UV detector (Shimadzu Corporation, Japan) and an Agilent Poroshell 120EC-C18 2.1×100 mm column. The eluent was 100% acetonitrile, the flow rate was 0.5 mL / min, the injection volume was 2 μL, and the squalene detection wavelength was 210 nm.

[0082] (2) Applications are as follows:

[0083] Based on the degeneracy of codons, single-point mutations were performed on each site of SmDAGK using the NNK codon. The design rule of the primers is that the upstream and downstream primers have 25 overlapping bases as homology arms, and the NNK codon is designed in the homology arms. The saturated mutation DNA product of SmDAGK was obtained by PCR amplification and purification.

[0084] Using the established high-throughput screening method, 38 sites (G12, W15, R18, S23, G37, N40, G86, N87, V89, D90, S93, Y95, A101, A102, K105, A109, H44, S47, A48, L50, A51, A54, A120, T122, G123, L124, F127 and I131) of the prenol utilization pathway phosphokinase SmDAGK (diacylglycerol kinase, its amino acid sequence is shown in Genbank accession number AAA26867.1, 137 amino acids) were saturatedly mutagenized, and the squalene content was compared with that of the wild-type SmDAGK (control group), and 8 mutants with improved activity were obtained, such as Figure 7 As shown, they are SmDAGK S47A 、SmDAGK S47F 、SmDAGK L124A 、SmDAGK L124W 、SmDAGK S47M 、SmDAGK A51L 、SmDAGK G123R 、SmDAGK G123F .

[0085] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol, characterized in that The steps include: (1) Transforming a mutant gene of a phosphokinase that can utilize isopentenol into a test yeast, and spreading the resulting transformed bacterial liquid on a culture medium plate containing isopentenol for culture; (2) selecting colonies with better growth potential and culturing them in a liquid culture medium containing isopentenol to obtain a culture solution; (3) Determine the OD of the culture medium 600 The value was selected to be greater than the OD of wild-type Saccharomyces cerevisiae 600 The mutant with a value of 75% was measured for squalene accumulation by HPLC; (4) Select mutants with higher squalene accumulation than the control and send them for sequencing to obtain mutation information; The detection yeast is a strain obtained by using Saccharomyces cerevisiae as a starting strain and performing the following transformations: the 156th amino acid of the PRM10 gene in the Saccharomyces cerevisiae genome is mutated from leucine to glutamine, and the ERG13 gene is knocked out.

2. The high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to claim 1, characterized in that: The phosphokinase capable of utilizing isopentenol in step (1) is at least one of SmDAGK and AtIPK; The brewer's yeast is a brewer's yeast of the CEN.PK series.

3. The high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to claim 1, characterized in that: The mutation method described in the modification is gene editing technology; The sgRNA used in the mutation is TCATTGGCATTAATCCTGCC; The knockout method described in the transformation is gene editing technology; The sgRNA used in the knockout is GATTGGTTGACACATTGAGT.

4. The high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to claim 1, characterized in that: The transformation steps described in step (1) are as follows: the test yeast, the mutant gene of the phosphokinase capable of utilizing isopentenol, the transformation solution and the ssDNA are mixed evenly to obtain a transformation system; the transformation system is incubated in a 37±1°C water bath and then centrifuged to discard the supernatant; the obtained cells are resuspended in water to obtain a transformation bacterial solution; The transformation solution consists of 800 μL of 500 g / L PEG3350 solution, 200 μL of 2 M LiAc solution and 7.5 μL of β-mercaptoethanol.

5. The high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to claim 4, characterized in that: The transformation system is composed of 2×10 7 ~1×10 8 cells, 100 μL transformation solution, 1 μg of a mutant gene of phosphokinase that can utilize isopentenol, and 3 μL of ssDNA at a concentration of 10 mg / mL; The incubation time is 20 to 40 minutes; The centrifugal condition is 4000-8000g for 1-5 minutes.

6. The high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to claim 1, characterized in that: The culture medium in step (1) is YPD culture medium; The concentration of isopentenol in the culture medium in step (1) is 0.4-0.6 g / L; The culture medium in step (2) is YPD culture medium; The concentration of isopentenol in the culture medium described in step (2) is 4-6 g / L.

7. The high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to claim 1, characterized in that: The culture conditions described in step (1) are inverted culture at 30±2°C for 4 to 5 days; The culture conditions described in step (2) are 30±2° C. and 100-250 rpm for 3-5 days.

8. Use of the high-throughput screening method for phosphokinase mutants capable of utilizing isopentenol according to any one of claims 1 to 7 in screening highly active phosphokinase mutants capable of utilizing isopentenol.

Images