A method for detecting highly toxic and drug-resistant Klebsiella pneumoniae

Abstract

The present invention discloses a method for detecting highly toxic and drug-resistant Klebsiella pneumoniae, the method comprising preparing a concanavalin A-magnetic nanoparticle complex; enriching Klebsiella pneumoniae using the concanavalin A-magnetic nanoparticle complex; putting the target solution into the RPA reaction system to amplify the Klebsiella pneumoniae nucleic acid; putting the RPA reaction solution into the CRISPR Cas12a detection system to cut and amplify the nucleic acid obtained to obtain a detection solution; performing detection limit determination or fluorescence detection on the detection solution, and outputting the detection result. The present invention can detect the target bacteria Klebsiella pneumoniae nucleic acid more quickly and specifically in actual clinical work, with high determination efficiency, simple operation and short detection time.

Description

Technical Field

[0001] The invention relates to the field of biological detection, and in particular to a method for detecting highly toxic and drug-resistant Klebsiella pneumoniae. Background Art

[0002] Klebsiella pneumoniae is a common pathogen of community-acquired and hospital-acquired infections. Klebsiella pneumoniae has thicker capsular polysaccharides, which can effectively inhibit neutrophil phagocytosis and the effects of antibiotics, making it more likely to cause pneumonia, bloodstream infections, and urinary tract infections.

[0003] Lectins are a class of carbohydrate-binding proteins of non-immune origin that can specifically recognize and reversibly bind to carbohydrates and have the ability to agglutinate cells or precipitate polysaccharides and glycoconjugates. The legume lectin family is a member of the lectin family and is mainly found in the seeds of leguminous plants. Concanavalin A (Con A), as the most famous representative of this family, has received increasing attention due to its various biological effects. Con A is specific for mannose and glucose. Con A adsorbs and fixes bacteria by specifically recognizing α-linked mannose that exists as part of the "core oligosaccharide" in many serum and membrane glycoproteins.

[0004] CRISPR / Cas technology is a widely used gene editing technology. It uses RNA to specifically bind to the target sequence on the genome and cut DNA to produce double-strand breaks, and uses biological non-homologous end joining or homologous recombination for site-specific gene editing. The CRISPR-Cas system has the ability to efficiently recognize nucleic acids. Nucleic acid targets are amplified to obtain a large number of amplicons. The non-specific cutting activity (trans-cutting) of the Cas enzyme is activated. Cutting fluorescent probes are used to detect the target. PCR-CRISPR-based detection methods have been developed and used for nucleic acid diagnosis.

[0005] AIE technology refers to a class of molecules that do not emit light or emit light weakly in solution, and their light emission is significantly enhanced in an aggregated state or solid film. The AIE method is based on the principle of aggregation-induced emission under the basic principle of nucleic acid amplification to achieve real-time monitoring of the amplification reaction. Due to the strong hydrophilicity of the oligonucleotide chain, the AIE probe does not produce fluorescence because it is very easy to dissolve in water. When the nucleic acid amplification reaction is carried out, the AIE probe is degraded by enzyme cleavage, and the free AIE exhibits extremely strong hydrophobicity, greatly reduces solubility and aggregates, thereby generating a fluorescent signal from nothing. The accumulation of the fluorescent signal is in a synchronous linear relationship with the amount of DNA amplification product, which can realize real-time monitoring of the reaction. Combined with the photostability of the AIE material, the effect of the fluorescence intensity after the photoexcitation fluorescence detection at the end of multiple cycles is minimal, which truly achieves real-time monitoring of the product amount.

[0006] For example, a Chinese invention patent (application number CN202311770952.7) discloses a method for detecting highly virulent and drug-resistant Klebsiella pneumoniae, which uses loop-mediated isothermal amplification, multiple LAMP reactions and other methods to detect highly virulent and drug-resistant Klebsiella pneumoniae, but its detection sensitivity is not high and its specificity is poor, with a minimum detection limit of 2.5×10 1 CFU / ml.

[0007] For the prior art, the methods for detecting Klebsiella pneumoniae include colony morphology, wire drawing test, nematode test, neutrophil anti-phagocytosis test, serum resistance test, etc. These methods are time-consuming, cannot be quickly reported to the clinic, are easy to delay the condition, and their detection sensitivity is relatively low, and the specificity is not strong. Especially for strains with similar sources, it is difficult for traditional methods to distinguish them by physiological and biochemical methods. At present, the traditional PCR method is generally used to detect highly toxic and resistant Klebsiella pneumoniae, but the equipment required for the traditional PCR method is expensive, the steps are complicated, the requirements for personnel are high, and it is not easy to promote on a large scale. Therefore, it is necessary to develop an efficient and rapid detection method for Klebsiella pneumoniae. Summary of the invention

[0008] In view of the problems of the existing detection methods of Klebsiella pneumoniae, the present invention proposes a detection method of highly toxic and drug-resistant Klebsiella pneumoniae to solve the problems raised in the above background technology.

[0009] A method for detecting highly toxic and drug-resistant Klebsiella pneumoniae, the method comprising the following steps:

[0010] S1, taking a preset amount of magnetic nanoparticles and concanavalin A, and coating the magnetic nanoparticles with concanavalin A to obtain a concanavalin A-magnetic nanoparticle complex;

[0011] S2, adding the concanavalin A-magnetic nanoparticle complex into a sample to be detected, and using the concanavalin A-magnetic nanoparticle complex to enrich Klebsiella pneumoniae to obtain a target solution;

[0012] S3, determining an RPA reaction system, and adding the target solution into the RPA reaction system to amplify Klebsiella pneumoniae nucleic acid to obtain an RPA reaction solution;

[0013] S4, determining a CRISPR Cas12a detection system, and placing the RPA reaction solution into the CRISPR Cas12a detection system to cut and amplify the nucleic acid to obtain a detection solution;

[0014] S5, testing the detection solution in a multifunctional microplate reader for 15 minutes, reading once per minute, and using the fluorescence value of the negative control group plus 3 times the standard deviation as the detection limit to determine the detection result, or observing the fluorescence color of the detection solution under ultraviolet light, if it is green, the sample to be detected contains highly toxic and drug-resistant Klebsiella pneumoniae;

[0015] The CRISPR Cas12a detection system includes Cas12a protein, a peg- 344 Gene primers, for CRISPR Cas12a reaction kpc-2 Gene primers, AIEgens fluorescent probe, AlEgens reporter, double distilled water, reaction buffer;

[0016] The CRISPR Cas12a reaction peg-344 The sequence of the gene primer is shown in SEQ ID NO.5, and the kpc-2 The sequence of the gene primer is shown in SEQ ID NO.6;

[0017] Wherein, the sequence shown in SEQ ID NO.5 is:

[0018] TAATTTCTACTAAGTGTAGATTCATCTTCCCTCTAATTGCAGTA (SEQ ID NO.5);

[0019] The sequence shown in SEQ ID NO.6 is:

[0020] TAATTTCTACTAAGTGTAGATGCGGCTCCATCGGTGTGTACGCG (SEQ ID NO. 6).

[0021] According to the method for detecting highly toxic and drug-resistant Klebsiella pneumoniae proposed by the present invention, the beneficial effects of the present invention are:

[0022] First of all, the existing detection methods are based on the detection after obtaining the pathogens, which is time-consuming, labor-intensive, low-sensitivity, and cannot be directly detected in the sample. In order to avoid the shortcoming of long-term bacterial culture and effectively improve the detection efficiency, the present invention proposes to directly capture the pathogens in the specimen through magnetic separation technology. In terms of enriching target bacteria, in the prior art, immunomagnetic beads are often directly modified to directly couple antibodies to the surface of magnetic nanomaterials through covalent bonds with amino groups, carboxyl groups, etc. of nanomagnetic beads, thereby targeting and enriching bacteria. However, this modification has the problem of improper antibody orientation and limited antibody site space, resulting in low binding efficiency between antibody-modified nanoparticles and pathogens, resulting in low capture efficiency and high antibody prices. The present invention prepares a concanavalin A-magnetic nanoparticle complex, uses biotinylated concanavalin A to organically bind to the tryptophan residue of streptavidin through biotin, and then combines concanavalin A with glycoprotein on the surface of Klebsiella pneumoniae, thereby eliminating interference from a matrix and common bacteria, having high separation efficiency and short enrichment time; and compared with immunogenic nanomagnetic beads, concanavalin A reduces costs during the synthesis of the complex, and the one-step method takes less time, thereby shortening the overall detection time;

[0023] Secondly, in terms of gene detection, the present invention targets the virulence genes of highly toxic and drug-resistant Klebsiella pneumoniae peg-344 and drug resistance genes kpc-2 A specific primer set was designed, and multiple RPA reactions were performed by optimizing the reaction system. The operation was simple, and the enhanced Cas12a detection had better stability, which could make up for the low efficiency and false positives of RPA, so that the enhanced Cas12a detection achieved satisfactory reaction activity and specificity. At the same time, the combination of RPA and Cas12a detection was designed and realized, and the results could be obtained within 30 minutes at a constant temperature of 37°C or 39°C, and could also be directly observed by fluorescence under ultraviolet light. Not only was the result judgment simple, but also the disadvantage of RPA detection being prone to false positives was overcome, and the purpose of highly sensitive and specific detection of highly toxic and drug-resistant Klebsiella pneumoniae was achieved. In addition, the detection system established by the present invention was prepared. peg-344 Genes and kpc-2 The high-performance primer set of the gene is used to improve the sensitivity and specificity of the detection. At the same time, it integrates functional nano-magnetic bead enrichment, RPA amplification, and CRISPR technology, with a specificity of up to 99.5%, a sensitivity of up to 97.6%, and a detection limit of less than 10 CFU / ml, which not only reduces the minimum detection limit but also shortens the detection time to less than 1 hour.

[0024] Finally, the present invention can rapidly detect highly toxic and drug-resistant Klebsiella pneumoniae, solving the long-standing problem of false positives caused by nonspecific amplification reactions caused by mutual interference or pairing between primers, and achieving high detection sensitivity for each target under multiple amplification conditions. It can be further promoted in primary medical units, and can also be used as a rapid initial screening test for primary epidemic prevention departments to monitor the catering industry environment and food safety, and to detect whether materials such as field soil contain Klebsiella pneumoniae, which is of great significance in epidemiology.

[0025] In addition, the method for detecting highly toxic and drug-resistant Klebsiella pneumoniae provided by the present invention may also have the following additional technical features:

[0026] Preferably, step S1 specifically includes:

[0027] S11, washing the magnetic nanoparticles uniformly with a sterile PBS solution, separating the magnetic nanoparticles under an external magnetic field after washing, repeating this process three times, and then resuspending the magnetic nanoparticles in a sterile PBS solution to obtain a first solution;

[0028] S12, dissolving ethyldimethylaminocarbodiimide and N-hydroxysulfosuccinimide in sterile PBS solutions respectively, and then adding the two solutions to the first solution for activation, mixing and washing the activated magnetic nanoparticles with a sterile PBS solution, and then separating them under an external magnetic field, repeating the process three times and then resuspending the particles in a sterile PBS solution to obtain a second solution;

[0029] S13, adding streptavidin to the second solution, coupling in a vertical mixer at room temperature, then separating on a magnetic stand to remove the supernatant solution, mixing and washing with a sterile PBS solution, and then separating under an external magnetic field, repeating 3 times and resuspending in a sterile PBS solution to obtain a streptavidin-magnetic nanoparticle complex;

[0030] S14, dissolving concanavalin A and long-chain biotin in sterile PBS solution respectively, then adding the dissolved long-chain biotin to the dissolved concanavalin A for incubation, performing refrigerated centrifugation using an ultrafiltration tube and continuously washing with a sterile PBS solution to obtain biotinylated concanavalin A;

[0031] S15, adding the biotinylated concanavalin A to the streptavidin-magnetic nanoparticle complex for incubation, washing with a sterile PBS solution for 3 times after the incubation, and resuspending in a sterile PBS solution to obtain a concanavalin A-magnetic nanoparticle complex.

[0032] Preferably, step S2 is specifically as follows:

[0033] The concanavalin A-magnetic nanoparticle complex is put into the sample to be tested, placed in an incubator for incubation, inserted into a magnetic rack for magnetic separation after the incubation, washed with a sterile PBS solution after the magnetic separation, and resuspended in a sterile PBS solution after the washing to obtain a target solution.

[0034] Preferably, the Concanavalin A-magnetic nanoparticle complex has an average particle size of 180 nm and has carboxyl groups on its surface.

[0035] Preferably, in step S3, the RPA reaction system includes RPA peg-344 Upstream amplification primers, RPA peg-344 Downstream amplification primers, RPA kpc-2 Upstream amplification primers, RPA kpc-2 Downstream amplification primers, Rehydration buffer, MgOAc solution, water.

[0036] Preferably, the RPA lung peg-344 The sequence of the upstream amplification primer is shown in SEQ ID NO.1. peg-344 The sequence of the downstream amplification primer is shown in SEQ ID NO.2. kpc-2 The sequence of the upstream amplification primer is shown in SEQ ID NO.3. kpc-2 The sequence of the downstream amplification primer is shown in SEQ ID NO.4.

[0037] Wherein, the sequence shown in SEQ ID NO.1 is:

[0038] GCGTTACCGTGTTTTATAGCTGGGGTTATTC (SEQ ID NO. 1).

[0039] The sequence shown in SEQ ID NO.2 is:

[0040] TCCAAGCTTACTGCAATTAGAGGGAAGATGA (SEQ ID NO. 2).

[0041] The sequence shown in SEQ ID NO.3 is:

[0042] CGGCTTGCTGGACACACCCATCCGTTACGGC (SEQ ID NO. 3).

[0043] The sequence shown in SEQ ID NO.4 is:

[0044] GGAGTTCAGCTCCAGCTCCCAGCGGTCCAGA (SEQ ID NO. 4).

[0045] Preferably, the AIEgens fluorescent probe is composed of dsDNA modified with a quenching group and specifically loaded with AIEgens, wherein the dsDNA modified with the quenching group is specifically a dsDNA obtained by complementarity between the DNA shown in SEQ ID NO.7 and the DNA shown in SEQ ID NO.8.

[0046] Wherein, the sequence shown in SEQ ID NO.7 is:

[0047] TTATTAAAAAAAAAAAAAAA (SEQ ID NO. 7).

[0048] The sequence shown in SEQ ID NO.8 is:

[0049] TTTTTTTTTTTTTTT (SEQ ID NO. 8).

[0050] Preferably, the ssDNA extended from the dsDNA end of the modified quencher group is used as a trans-cleavage site for Cas12a activated by Klebsiella pneumoniae nucleic acid.

[0051] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0053] Figure 1 Characterization diagram of the magnetic nanoparticles, concanavalin A-magnetic nanoparticle complexes, highly virulent and drug-resistant Klebsiella pneumoniae, and concanavalin A-magnetic nanoparticle complexes capturing highly virulent and drug-resistant Klebsiella pneumoniae provided by the embodiments of the present invention;

[0054] Figure 2 An evaluation diagram of the capture of target bacteria from different matrices by the concanavalin A-magnetic nanoparticle complex provided in an embodiment of the present invention;

[0055] Figure 3 A diagram showing the results of nucleic acid electrophoresis for RPA primer screening provided in an embodiment of the present invention;

[0056] Figure 4 A sensitivity comparison chart of the RPA technology and the PCR technology provided in the embodiment of the present invention;

[0057] Figure 5 The RPA-specific verification diagram provided by the embodiment of the present invention;

[0058] Figure 6 The embodiment of the present invention provides KPC-2 , peg-344 Figure of clinical strains screened by RPA;

[0059] Figure 7 A graph showing specificity detection results provided by an embodiment of the present invention;

[0060] Figure 8 A sensitivity analysis result diagram provided by an embodiment of the present invention;

[0061] Fig. 9 A secondary sensitivity analysis result diagram provided in an embodiment of the present invention.

[0062] The embodiments of the present invention will be further described below with reference to the accompanying drawings. DETAILED DESCRIPTION

[0063] In order to make the purpose, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the examples. Several embodiments of the present invention are given in the examples. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present invention more thorough and comprehensive.

[0064] Example 1

[0065] In Example 1 of the present invention, a method for detecting highly toxic and drug-resistant Klebsiella pneumoniae is provided, the method comprising the following steps:

[0066] S1, taking a preset amount of magnetic nanoparticles and concanavalin A, and coating the magnetic nanoparticles with concanavalin A to obtain a concanavalin A-magnetic nanoparticle complex;

[0067] Wherein, the step S1 comprises:

[0068] S11, washing the magnetic nanoparticles uniformly with a sterile PBS solution, separating the magnetic nanoparticles under an external magnetic field after washing, repeating this process three times, and then resuspending the magnetic nanoparticles in a sterile PBS solution to obtain a first solution;

[0069] First, the reagents used in this application are exemplified: magnetic nanoparticles (180 nm) (purchased from Shanghai Aorun Chemical Co., Ltd.), streptavidin (CAS No. 9013-20-1, Shanghai Aorun Chemical Co., Ltd.), long-chain biotin (CAS No. PA1-73177, Thermo Fisher Scientific (Rockford, USA) Co., Ltd.), N-hydroxysulfosuccinimide, ethyldimethylaminocarbodiimide, etc. are all conventional reagents, and Cas12a protein is purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0070] Specifically, 9 ml of sterile PBS solution is used to uniformly wash 1 ml of magnetic nanoparticles and then separated under an external magnetic field. This is repeated three times and then resuspended in 10 ml of sterile PBS solution to obtain the first solution.

[0071] S12, dissolving ethyldimethylaminocarbodiimide and N-hydroxysulfosuccinimide in sterile PBS solutions respectively, and then adding the two solutions to the first solution for activation, mixing and washing the activated magnetic nanoparticles with a sterile PBS solution, and then separating them under an external magnetic field, repeating the process three times and then resuspending the particles in a sterile PBS solution to obtain a second solution;

[0072] Specifically, 2.9 mg of ethyldimethylaminocarbodiimide and 3.25 mg of N-hydroxysulfosuccinimide were weighed and dissolved in 290 μl and 325 μl of sterile PBS solutions, respectively. The two solutions were then added to the washed magnetic nanoparticle solution and activated at 37°C and 15 r / min for 1 h. The activated magnetic nanoparticles were mixed and washed with a sterile PBS solution and then separated under an external magnetic field. This was repeated three times and then resuspended in 10 ml of a sterile PBS solution to obtain a second solution.

[0073] S13, adding streptavidin to the second solution, coupling in a vertical mixer at room temperature, then separating on a magnetic stand to remove the supernatant solution, mixing and washing with a sterile PBS solution, and then separating under an external magnetic field, repeating 3 times and resuspending in a sterile PBS solution to obtain a streptavidin-magnetic nanoparticle complex;

[0074] Specifically, 800 μg of streptavidin (SA) was added to the activated magnetic nanoparticle resuspension, coupled at room temperature for 2 h in a vertical mixer (15 r / min), then separated on a magnetic rack to remove the supernatant, mixed and washed with sterile PBS solution, and separated under an external magnetic field. After repeating 3 times, the mixture was resuspended in 10 ml sterile PBS solution to obtain a streptavidin-magnetic nanoparticle complex.

[0075] S14, dissolving concanavalin A and long-chain biotin in sterile PBS solution respectively, then adding the dissolved long-chain biotin to the dissolved concanavalin A for incubation, performing refrigerated centrifugation using an ultrafiltration tube and continuously washing with a sterile PBS solution to obtain biotinylated concanavalin A;

[0076] Specifically, 10 mg of concanavalin A was weighed and dissolved in 400 μl of sterile PBS solution, 1 mg of long-chain biotin was dissolved in 100 ml of sterile PBS solution, and then the dissolved long-chain biotin was added to the dissolved concanavalin A, incubated for 2 hours, and centrifuged at 8°C and 3000 rpm using a 30 kDa ultrafiltration tube, and continuously washed with 10 volumes of sterile PBS solution to obtain biotinylated concanavalin A.

[0077] S15, adding the biotinylated concanavalin A to the streptavidin-magnetic nanoparticle complex for incubation, washing with a sterile PBS solution for 3 times after the incubation, and resuspending in a sterile PBS solution to obtain a concanavalin A-magnetic nanoparticle complex;

[0078] Specifically, biotinylated concanavalin A was added to the streptavidin-magnetic nanoparticle complex and incubated for 45 minutes. After the reaction was completed, it was washed three times with a sterile PBS solution and resuspended in 10 ml of a sterile PBS solution to obtain a concanavalin A-magnetic nanoparticle complex with a final concentration of 2 mg / ml, which was used to enrich Klebsiella pneumoniae.

[0079] The ratio of the magnetic nanoparticles, the ethyldimethylaminocarbodiimide, the N-hydroxysulfosuccinimide and the streptavidin is: 1 ml: 2.9 mg: 3.25 mg: 800 μg.

[0080] The PBS solution mentioned in the above content has a concentration of 0.01M and a pH value of 7.4. The preparation process is as follows: 8.0g NaCl, 0.2g KCl, 0.24g KH2PO4, and 1.44g Na2HPO4 are dissolved in 800ml distilled water, the pH is adjusted to 7.4 with 5M NaOH, and the volume is then fixed to 100ml to obtain a 0.01M PBS solution;

[0081] The average particle size of the concanavalin A-magnetic nanoparticle complex is 180 nm, and carboxyl groups are connected to the surface.

[0082] S2, adding the concanavalin A-magnetic nanoparticle complex into a sample to be detected, and using the concanavalin A-magnetic nanoparticle complex to enrich Klebsiella pneumoniae to obtain a target solution;

[0083] Wherein, the step S2 specifically comprises: putting the concanavalin A-magnetic nanoparticle complex into the sample to be tested, placing it in an incubator for incubation, inserting it into a magnetic stand for magnetic separation after the incubation is completed, washing it with a sterile PBS solution after the magnetic separation is completed, and resuspending it in a sterile PBS solution after the washing is completed to obtain a target solution;

[0084] Specifically, 100 μl of concanavalin A-magnetic nanoparticle complex was added to 100 μl of the sample solution to be tested, and the mixture was mixed by blowing, incubated in an incubator (37°C, 180 r / min) for 20 min, and separated by inserting a magnetic stand for 4 min. The supernatant was transferred to a sterile centrifuge tube, and the remaining Klebsiella pneumoniae complex was washed twice with a sterile PBS solution and resuspended in 1 ml of a sterile PBS solution to obtain a target solution.

[0085] S3, determining an RPA reaction system, and adding the target solution into the RPA reaction system to amplify Klebsiella pneumoniae nucleic acid to obtain an RPA reaction solution;

[0086] Wherein, the RPA reaction system includes RPA lung peg-344 Upstream amplification primers, RPA peg-344 Downstream amplification primers, RPA kpc-2 Upstream amplification primers, RPA kpc-2 Downstream amplification primers, Rehydration buffer, MgOAc solution, water.

[0087] For a 20μl RPA reaction system, it includes 0.50μM RPA upstream amplification primer, 0.50μM RPA downstream amplification primer, 1×Rehydration Buffer, 14mM MgOAc, 2μl target solution, and the rest is made up to 20μl with water. For a complete reaction system, it specifically includes the genomic DNA of the sample to be detected, that is, the target solution. Therefore, the above-mentioned RPA reaction system is only a pre-reaction system. After adding the target solution, a complete RPA reaction system can be formed, and the RPA upstream amplification primer includes RPA lung gram peg-344 Upstream amplification primers, RPA kpc-2 The upstream amplification primers and the downstream amplification primers of RPA include RPA-Lung peg-344 Downstream amplification primers, RPA kpc-2 The downstream amplification primers are kept at a constant temperature of 37°C or 39°C for 30 minutes.

[0088] The RPA lung peg-344 The sequence of the upstream amplification primer is shown in SEQ ID NO.1. peg-344 The sequence of the downstream amplification primer is shown in SEQ ID NO.2. kpc-2 The sequence of the upstream amplification primer is shown in SEQ ID NO.3. kpc-2 The sequence of the downstream amplification primer is shown in SEQ ID NO.4.

[0089] Wherein, the sequence shown in SEQ ID NO.1 is:

[0090] GCGTTACCGTGTTTTATAGCTGGGGTTATTC (SEQ ID NO. 1).

[0091] The sequence shown in SEQ ID NO.2 is:

[0092] TCCAAGCTTACTGCAATTAGAGGGAAGATGA (SEQ ID NO. 2).

[0093] The sequence shown in SEQ ID NO.3 is:

[0094] CGGCTTGCTGGACACACCCATCCGTTACGGC (SEQ ID NO. 3).

[0095] The sequence shown in SEQ ID NO.4 is:

[0096] GGAGTTCAGCTCCAGCTCCCAGCGGTCCAGA (SEQ ID NO. 4).

[0097] S4, determining a CRISPR Cas12a detection system, and placing the RPA reaction solution into the CRISPR Cas12a detection system to cut and amplify the nucleic acid to obtain a detection solution;

[0098] Wherein, the CRISPR Cas12a detection system includes Cas12a protein, a peg-344 Gene primers, for CRISPR Cas12a reaction kpc-2 Gene primers, AIEgens fluorescent probe, AlEgens reporter, double distilled water, reaction buffer.

[0099] Specifically, for a 10μl CRISPR Cas12a detection system, it specifically includes 0.5μl Cas12a protein (1μM), 0.5μl crRNA (1μM), 1μl AlEgens reporter (2μM), 7μl double distilled water, and 1μl reaction buffer.

[0100] The Cas12a protein is specifically pGEX-4T-1-Cas12a recombinant protein, the reaction buffer is NEBuffer2.1 (10x), and the crRNA includes a CRISPR Cas12a reaction. peg-344 Gene primers, for CRISPR Cas12a reaction kpc-2 Gene primers.

[0101] The CRISPR Cas12a reaction peg-344 The sequence of the gene primer is shown in SEQ ID NO.5, and the kpc-2 The sequence of the gene primer is shown in SEQ ID NO.6.

[0102] Wherein, the sequence shown in SEQ ID NO.5 is:

[0103] TAATTTCTACTAAGTGTAGATTCATCTTCCCTCTAATTGCAGTA (SEQ ID NO. 5).

[0104] The sequence shown in SEQ ID NO.6 is:

[0105] TAATTTCTACTAAGTGTAGATGCGGCTCCATCGGTGTGTACGCG (SEQ ID NO. 6).

[0106] Specifically, for CRISPR Cas12a reactions peg-344 Gene primers, for CRISPR Cas12a reaction kpc-2 As for the sequence of gene primers, both are crRNA. At the same time, because ATGC is commonly used in the guide sequence, when synthesizing RNA, the default sequence designed is U, so the sequence used for CRISPR Cas12a reaction peg-344 The specific sequences of the gene primers and the DNA sequences used in the CRISPR Cas12a reaction kpc-2 The specific sequence of the gene primer is specifically T is U, and in the CRISPR Cas12a reaction peg-344 The specific sequences of the gene primers and the DNA sequences used in the CRISPR Cas12a reaction kpc- 2 In the specific sequence of the gene primer, the front part of the two sequences is the same, which is specifically a guide sequence of cas12a protein.

[0107] The AIEgens fluorescent probe is composed of dsDNA modified with a quenching group and specifically loaded with AIEgens, wherein the dsDNA modified with the quenching group is specifically a dsDNA obtained by complementation of the DNA shown in SEQ ID NO.7 and the DNA shown in SEQ ID NO.8.

[0108] Wherein, the sequence shown in SEQ ID NO.7 is:

[0109] TTATTAAAAAAAAAAAAAAA (SEQ ID NO. 7).

[0110] The sequence shown in SEQ ID NO.8 is:

[0111] TTTTTTTTTTTTTTT (SEQ ID NO. 8).

[0112] The ssDNA extended at the end of the dsDNA modified quenching group is used as a trans-cleavage site for Cas12a activated by Klebsiella pneumoniae nucleic acid.

[0113] S5, testing the detection solution in a multifunctional microplate reader for 15 minutes, reading once per minute, and using the fluorescence value of the negative control group plus 3 times the standard deviation as the detection limit to determine the detection result, or observing the fluorescence color of the detection solution under ultraviolet light, if it is green, the sample to be detected contains highly toxic and drug-resistant Klebsiella pneumoniae;

[0114] Specifically, in the actual detection process, the detection is carried out for 15 minutes in a multifunctional microplate reader with an excitation light of 460nm and an emission light of 650nm. The temperature is set to 37°C and the reading is once per minute. The fluorescence value of the negative control group plus 3 times the standard deviation is used as the detection limit to determine the test result. At the same time, the fluorescence color of the solution after the reaction can also be observed under ultraviolet light. If it is green, the sample solution contains highly virulent and drug-resistant Klebsiella pneumoniae.

[0115] In order to further verify the effect of the present invention, a series of experiments were performed for auxiliary verification, wherein the sterile blood and sterile cerebrospinal fluid involved in the embodiments of the present invention were provided by the First Affiliated Hospital of Nanchang University, and the 6 strains of highly toxic and resistant Klebsiella pneumoniae (AY9630, AY10553, AY6353, BY657, CP15824, GZK20) and 2 strains of non-highly toxic and resistant Klebsiella pneumoniae (NTUH-K2044, ATCC700603) and 4 non-Klebsiella pneumoniae (Escherichia coli (E.coli 0157:H7), Staphylococcus aureus (S. aureus), Listeria (L.monocytogenes), Pseudomonas aeruginosa (P. aeruginosa)) involved in the embodiments of the present invention were respectively from the First Affiliated Hospital of Nanchang University.

[0116] First, the enrichment of Klebsiella pneumoniae was tested, and 1 ml of the solution was taken as 10 5 cfu / ml of Klebsiella pneumoniae AY9630 was placed in a 1.5 ml sterile centrifuge tube and centrifuged at 12000 rpm for 5 min. The supernatant was discarded and resuspended with an equal volume of sterile PBS solution to obtain the sample solution to be tested. The sample solution to be tested was subjected to 10 6 -10 1 After gradient dilution, count each gradient using a plate and calculate the capture efficiency of the target bacteria according to the following formula. Repeat each experiment three times:

[0117] Capture efficiency = [total number of enriched and adsorbed colonies / (total number of colonies in the supernatant + total number of enriched and adsorbed colonies)] × 100%;

[0118] Secondly, the Concanavalin A-magnetic nanoparticle complex was tested for capturing target bacteria from different matrices:

[0119] Sample 1: Sterile PBS solution diluted Klebsiella pneumoniae AY9630 to a colony concentration of 10 5 cfu / ml;

[0120] Sample 2: Sterile 10% blood diluted Klebsiella pneumoniae AY9630 to a colony concentration of 10 5 cfu / ml;

[0121] Sample 3: Sterile 10% cerebrospinal fluid was added with Klebsiella pneumoniae AY9630 and the colony concentration was adjusted to 10 5 cfu / ml.

[0122] The resuspension of target bacteria enriched in samples 1-3 was heated for 10 6 -10 1After gradient dilution, the capture efficiency of the concanavalin A-magnetic nanoparticle complex prepared in Example 1 for the target bacteria in samples 1-3 was obtained according to the above magnetic bead enrichment effect experimental operation. The results are shown in Tables 1 and Figure 1 , Figure 2 ,exist Figure 1 For the convenience of description, the concanavalin A-magnetic nanoparticle complex is denoted as concanavalin A-magnetic beads, and the magnetic nanoparticles are denoted as bare magnetic beads. Figure 1 A in Figure 1 B in Figure 1 The C in the figure represents the characterization diagrams of naked magnetic beads, concanavalin-magnetic beads and highly virulent and resistant Klebsiella pneumoniae, Figure 1 D in the figure represents the characterization diagram of concanavalin-magnetic beads capturing highly virulent and resistant Klebsiella pneumoniae.

[0123]

[0124] From the results in Table 1 and Figure 2 From the results in , it can be seen that the enrichment method of the present invention can capture the target bacteria in the PBS solution up to 98%, the target bacteria in the blood sample (sample 2) simulated with Klebsiella pneumoniae infection The capture rate is 84%, and the target bacteria in the cerebrospinal fluid sample (sample 3) simulated with Klebsiella pneumoniae infection The capture rate is 95%, which is slightly lower than the target bacteria capture rate in the PBS solution, but the capture rate can still reach 85% or above, indicating that the enrichment method of the present invention can efficiently enrich and separate Klebsiella pneumoniae in samples of different matrices.

[0125] Meanwhile, in the present invention, kpc-2 It is the most common carbapenemase in CRKP, accounting for more than 50%. Based on its accuracy, sensitivity and specificity, peg-344 is the main marker of hvKp, so this method selects virulence peg-344 Genes and drug resistance kpc-2 The gene is the target sequence to be detected.

[0126] At the same time, when selecting RPA upstream and downstream amplification primers, the sequence parameters are: primer length between 28-36bp, amplification product length between 100-200bp, GC content between 30-70%, Tm>50°C, so the upstream and downstream primers that meet the above conditions are shown in Table 2 below:

[0127] Table 2: RPA primer information

[0128]

[0129] Specifically, all the sequences in Table 2 above were put into the RPA reaction system for reaction. The reaction procedure was: constant temperature at 37°C or 39°C, reaction for 30 minutes, and the best RPA primers were screened according to the results of nucleic acid electrophoresis. The results were as follows: Figure 3 As shown, Figure 3 A in the filter peg-344 The nucleic acid electrophoresis diagram of the primers, Figure 3 In A, a is peg-344 The F1 and R1 primers, b are peg-344 The F2 and R2 primers, c are peg-344 The F3 and R3 primers, Figure 3 B in the filter kpc-2 The nucleic acid electrophoresis diagram of the primers, Figure 3 In B, a is kpc-2 The F1 and R1 primers, b are kpc-2 The F2 and R2 primers, c are kpc-2 In this embodiment, the sequence shown in SEQ ID NO.1 is selected as the RPA lung clone. peg-344 The sequence of the upstream amplification primer is selected as the sequence shown in SEQ ID NO.2 as the RPA lung clone. peg-344 The sequence of the downstream amplification primer is selected as the sequence shown in SEQ ID NO.3 as the RPA lung kpc-2 The sequence of the upstream amplification primer is selected as the sequence shown in SEQ ID NO.4 as the RPA lung kpc-2 Sequences of downstream amplification primers.

[0130] In order to verify the difference in sensitivity between the detection method provided by the present invention and the detection method in the prior art, the detection method provided by the present invention and the existing PCR method were used to perform sensitivity tests, and the test results are shown in FIG. Figure 4 As shown, Figure 4 A in the figure is the result of nucleic acid electrophoresis after RPA amplification. Figure 4 B in FIG. 1 is a sensitivity detection result diagram of the PCR method. Therefore, it can be seen that the sensitivity of the detection method provided by the present invention is significantly better than that of the PCR method.

[0131] It should be noted that in order to further illustrate the specificity and sensitivity of the detection method of the present invention, specificity experiments and sensitivity experiments were carried out respectively:

[0132] 1. Specificity experiment

[0133] The test strains included 8 strains of Klebsiella pneumoniae, including highly toxic and resistant Klebsiella pneumoniae (AY9630, AY10553, AY6353, BY657, CP15824, GZK20), non-highly toxic and resistant Klebsiella pneumoniae (NTUH-K2044, ATCC700603), and 4 strains of non-Klebsiella pneumoniae, including Escherichia coli (E.coli 0157:H7), Staphylococcus aureus (S. aureus), Listeria monocytogenes (L. monocytogenes), and Pseudomonas aeruginosa (P. aeruginosa). Among them, Klebsiella pneumoniae AY9630, AY10553, AY6353, BY657, CP15824 and GZK20 were clinical strains, and the others were standard strains;

[0134] Using the above-screened RPA primers, agarose nucleic acid electrophoresis was performed on 8 strains of Klebsiella pneumoniae, including highly toxic and resistant Klebsiella pneumoniae (AY9630, AY10553, AY6353, BY657, CP15824, GZK20), non-highly toxic and resistant Klebsiella pneumoniae (NTUH-K2044, ATCC700603), and 4 non-Klebsiella pneumoniae strains, including Escherichia coli (E.coli 0157:H7), Staphylococcus aureus (S. aureus), Listeria monocytogenes (L. monocytogenes), and Pseudomonas aeruginosa (P. aeruginosa). The results are shown in Table 1. Figure 5 , Figure 6 , Figure 5 a, b, c, d, and e in the figure represent CR-hvKP, Escherichia coli, Staphylococcus aureus, Listeria, and Pseudomonas aeruginosa, respectively. Figure 6 A in Figure 6 The B in the kpc-2, peg-344 RPA screening clinical strains diagram, Figure 6 a, b, c, d, e, and f are all clinical CR-hvKP strains. Figure 6 The g in the formula is highly virulent Klebsiella pneumoniae. Figure 6 The h in the sentence is clinical kpc-2 Klebsiella pneumoniae;

[0135] Take the product after the RPA reaction system and add it to the CRISPR Cas12a detection system. Observe the results under ultraviolet light for comparison. The results are shown in Figure 7 , Figure 7 A in Figure 7 The B in the peg-344 , kpc-2 The specificity test result diagram, Figure 7a, b, c, d, and e represent highly virulent and resistant Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, and Pseudomonas aeruginosa, respectively;

[0136] The results showed that the detection method had good specificity for highly toxic and drug-resistant Klebsiella pneumoniae, and had no cross-reaction to Escherichia coli (E.coli0157:H7), Staphylococcus aureus (S. aureus), Listeria monocytogenes (L. monocytogenes), and Pseudomonas aeruginosa (P.aeruginosa).

[0137] At the same time, in this application, in order to improve the sensitivity and specificity of highly toxic and drug-resistant Klebsiella pneumoniae detection, the present invention selects peg-344 and kpc-2 As highly specific virulence genes and drug resistance genes respectively, a dual-specific gene simultaneous detection method is adopted. peg-344 The accuracy, sensitivity and specificity of identifying highly virulent Klebsiella pneumoniae were 97%, 99% and 96%, respectively. peg-344 is a highly specific gene in highly virulent Klebsiella pneumoniae and is of great significance for detection. peg-344 In addition, other virulence plasmid genes such as iroB, iucA, rmpA, and rmpA2 can also be used as detection markers, but the test results show that peg-344 As a detection marker, it can achieve the highest accuracy, sensitivity and specificity, and is the best marker for detecting highly virulent Klebsiella pneumoniae. The test results are shown in Table 3 below:

[0138] Table 3: Results of using five virulence-related plasmid genes of highly virulent Klebsiella pneumoniae as markers

[0139]

[0140] 2. Sensitivity test

[0141] Take the product after the RPA reaction system and add it to the CRISPR Cas12a detection system. Observe the results under ultraviolet light for comparison. The results are shown in Figure 8 , Figure 8 A in Figure 8 The B in the peg-344 , kpc-2 A sensitivity test result diagram of

[0142] The results showed that the detection method had good sensitivity, and the sensitivity could reach 10 CFU / ml.

[0143] To further demonstrate the good sensitivity of the present invention, the product after the RPA reaction system was added to the CRISPR Cas12a detection system, and the results were observed under ultraviolet light for comparison, and a secondary sensitivity test was performed. The results are shown in Fig. 9 , Fig. 9 A in Fig. 9 The B in the peg-344 , kpc-2 Secondary sensitivity test result diagram;

[0144] The results showed that the detection method had good sensitivity, less than 10 CFU / ml.

[0145] In view of the above, the detection results of the highly toxic and drug-resistant Klebsiella pneumoniae proposed in the present invention for the drug resistance and virulence of 8 strains of Klebsiella pneumoniae are consistent with the PCR experiment. Except for the positive amplification of Klebsiella pneumoniae, the other 4 strains of non-Klebsiella pneumoniae were not amplified and the results were all negative. Therefore, the method for detecting highly toxic and drug-resistant Klebsiella pneumoniae established by the present invention has good specificity and sensitivity.

[0146] In summary, for the detection method of highly toxic and drug-resistant Klebsiella pneumoniae proposed in this embodiment, first of all, the existing detection method is based on the detection after obtaining the pathogen, which is time-consuming and labor-intensive, has low sensitivity, and cannot be directly detected in the sample. In order to avoid the shortcoming of long-term bacterial culture and effectively improve the detection efficiency, the present invention proposes to directly capture the pathogens in the specimen by magnetic separation technology. In terms of enriching target bacteria, in the prior art, immunomagnetic beads are often directly modified to directly couple antibodies to the surface of magnetic nanomaterials through covalent bonds with amino groups, carboxyl groups, etc. of nanomagnetic beads, thereby targeting and enriching bacteria. However, this modification has the problem of improper antibody orientation and limited antibody site space, resulting in low binding efficiency between antibody-modified nanoparticles and pathogens, resulting in low capture efficiency and high antibody prices. The present invention prepares a concanavalin A-magnetic nanoparticle complex, uses biotinylated concanavalin A to organically bind to the tryptophan residue of streptavidin through biotin, and then combines concanavalin A with glycoprotein on the surface of Klebsiella pneumoniae, thereby eliminating interference from a matrix and common bacteria, having high separation efficiency and short enrichment time; and compared with immunogenic nanomagnetic beads, concanavalin A reduces costs during the synthesis of the complex, and the one-step method takes less time, thereby shortening the overall detection time;

[0147] Secondly, in terms of gene detection, the present invention targets the virulence genes of highly toxic and drug-resistant Klebsiella pneumoniae peg-344 and drug resistance genes kpc-2A specific primer set was designed, and multiple RPA reactions were performed by optimizing the reaction system. The operation was simple, and the enhanced Cas12a detection had better stability, which could make up for the low efficiency and false positives of RPA, so that the enhanced Cas12a detection achieved satisfactory reaction activity and specificity. At the same time, the combination of RPA and Cas12a detection was designed and realized, and the results could be obtained within 30 minutes at a constant temperature of 37°C or 39°C, and could also be directly observed by fluorescence under ultraviolet light. Not only was the result judgment simple, but also the disadvantage of RPA detection being prone to false positives was overcome, and the purpose of highly sensitive and specific detection of highly toxic and drug-resistant Klebsiella pneumoniae was achieved. In addition, the detection system established by the present invention was prepared. peg-344 Genes and kpc-2 The high-performance primer set of the gene is used to improve the sensitivity and specificity of the detection. At the same time, it integrates functional nano-magnetic bead enrichment, RPA amplification, and CRISPR technology, with a specificity of up to 99.5%, a sensitivity of up to 97.6%, and a detection limit of less than 10 CFU / ml, which not only reduces the minimum detection limit but also shortens the detection time to less than 1 hour.

[0148] Finally, the present invention can rapidly detect highly toxic and drug-resistant Klebsiella pneumoniae, solving the long-standing problem of false positives caused by nonspecific amplification reactions caused by mutual interference or pairing between primers, and achieving high detection sensitivity for each target under multiple amplification conditions. It can be further promoted in primary medical units, and can also be used as a rapid initial screening test for primary epidemic prevention departments to monitor the catering industry environment and food safety, and to detect whether materials such as field soil contain Klebsiella pneumoniae, which is of great significance in epidemiology.

[0149] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0150] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A non-diagnostic detection method for highly toxic and drug-resistant Klebsiella pneumoniae, characterized in that: The method comprises the following steps: S1, taking a preset amount of magnetic nanoparticles and concanavalin A, and coating the magnetic nanoparticles with concanavalin A to obtain a concanavalin A-magnetic nanoparticle complex; S2, adding the concanavalin A-magnetic nanoparticle complex into a sample to be detected, and using the concanavalin A-magnetic nanoparticle complex to enrich Klebsiella pneumoniae to obtain a target solution; S3, determining an RPA reaction system, and adding the target solution into the RPA reaction system to amplify Klebsiella pneumoniae nucleic acid to obtain an RPA reaction solution; S4, determining a CRISPR Cas12a detection system, and placing the RPA reaction solution into the CRISPR Cas12a detection system to cut and amplify the nucleic acid to obtain a detection solution; S5, testing the detection solution in a multifunctional microplate reader for 15 minutes, reading once per minute, and using the fluorescence value of the negative control group plus 3 times the standard deviation as the detection limit to determine the detection result, or observing the fluorescence color of the detection solution under ultraviolet light, if it is green, the sample to be detected contains highly toxic and drug-resistant Klebsiella pneumoniae; The CRISPR Cas12a detection system includes Cas12a protein, a peg-344 Gene primers, for CRISPR Cas12a reaction kpc-2 Gene primers, AIEgens fluorescent probes, double distilled water, reaction buffer; The CRISPR Cas12a reaction peg-344 The sequence of the gene primer is shown in SEQ ID NO.5, and the kpc-2 The sequence of the gene primer is shown in SEQ ID NO.6, and the peg-344 Gene primers, the CRISPR Cas12a reaction kpc-2 Gene primers are all crRNA; In step S3, the RPA reaction system includes RPA peg-344 Upstream amplification primers, RPA peg-344 Downstream amplification primers, RPA kpc-2 Upstream amplification primers, RPA kpc-2 Downstream amplification primers, Rehydration buffer, MgOAc solution, water; The RPA lung peg-344 The sequence of the upstream amplification primer is shown in SEQ ID NO.

1. peg-344 The sequence of the downstream amplification primer is shown in SEQ ID NO.

2. kpc-2 The sequence of the upstream amplification primer is shown in SEQ ID NO.

3. kpc-2 The sequence of the downstream amplification primer is shown in SEQ ID NO.

4.

2. The non-diagnostic detection method for highly toxic and drug-resistant Klebsiella pneumoniae according to claim 1, characterized in that: Step S1 specifically includes: S11, washing the magnetic nanoparticles uniformly with a sterile PBS solution, separating the magnetic nanoparticles under an external magnetic field after washing, repeating this process three times, and then resuspending the magnetic nanoparticles in a sterile PBS solution to obtain a first solution; S12, dissolving ethyldimethylaminocarbodiimide and N-hydroxysulfosuccinimide in sterile PBS solutions respectively, and then adding the two solutions to the first solution for activation, mixing and washing the activated magnetic nanoparticles with a sterile PBS solution, and then separating them under an external magnetic field, repeating the process three times and then resuspending the particles in a sterile PBS solution to obtain a second solution; S13, adding streptavidin to the second solution, coupling in a vertical mixer at room temperature, then separating on a magnetic stand to remove the supernatant solution, mixing and washing with a sterile PBS solution, and then separating under an external magnetic field, repeating 3 times and resuspending in a sterile PBS solution to obtain a streptavidin-magnetic nanoparticle complex; S14, dissolving concanavalin A and long-chain biotin in sterile PBS solution respectively, then adding the dissolved long-chain biotin to the dissolved concanavalin A for incubation, performing refrigerated centrifugation using an ultrafiltration tube and continuously washing with a sterile PBS solution to obtain biotinylated concanavalin A; S15, adding the biotinylated concanavalin A to the streptavidin-magnetic nanoparticle complex for incubation, washing with a sterile PBS solution for 3 times after the incubation, and resuspending in a sterile PBS solution to obtain a concanavalin A-magnetic nanoparticle complex.

3. The non-diagnostic detection method of highly toxic and drug-resistant Klebsiella pneumoniae according to claim 1, characterized in that: Step S2 is specifically as follows: The concanavalin A-magnetic nanoparticle complex is put into the sample to be tested, placed in an incubator for incubation, inserted into a magnetic rack for magnetic separation after the incubation, washed with a sterile PBS solution after the magnetic separation, and resuspended in a sterile PBS solution after the washing to obtain a target solution.

4. The non-diagnostic detection method of highly toxic and drug-resistant Klebsiella pneumoniae according to claim 1, characterized in that: The average particle size of the concanavalin A-magnetic nanoparticle complex is 180 nm, and carboxyl groups are connected to the surface.

5. The non-diagnostic detection method of highly toxic and drug-resistant Klebsiella pneumoniae according to claim 1, characterized in that: The AIEgens fluorescent probe is composed of dsDNA modified with a quenching group and specifically loaded with AIEgens, wherein the dsDNA modified with the quenching group is specifically a dsDNA obtained by complementation of the DNA shown in SEQ ID NO.7 and the DNA shown in SEQ ID NO.

8.

6. The non-diagnostic detection method of highly toxic and drug-resistant Klebsiella pneumoniae according to claim 5, characterized in that: The ssDNA extended at the end of the dsDNA modified quenching group is used as a trans-cleavage site for Cas12a activated by Klebsiella pneumoniae nucleic acid.

Images