Laccase mutant with high catalytic activity and preparation method and application thereof
By mutating the amino acid sequence of laccase 275 into proline and expressing it in Pichia yeast, the catalytic activity and heat resistance of laccase are improved, and the problem of low lignin degradation efficiency of traditional laccase is solved. Significantly improves the whiteness and physical strength of the paper.
Patent Information
- Application Number
- CN202410877507.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-02
- Publication Date
- 2024-12-24
- Estimated Expiration
- 2044-07-02
AI Technical Summary
Traditional wild-type laccase has limited degradation efficiency on lignin, which makes it difficult to improve the whiteness and physical strength of the paper and is not environmentally friendly.
A highly catalytically active laccase mutant was designed to improve the activity and heat resistance of the enzyme by mutating glutamine at position 275 of the amino acid sequence of wild-type laccase into proline, and the enzyme activity and heat resistance was improved through recombinant technology in Bi The mutant laccase was expressed and purified in Chiba yeast and applied to the pulp process.
The catalytic activity of the mutant laccase Q275P is increased by 2.29 times, the temperature stability is increased by more than 20%, the catalytic efficiency is increased by 1.7 times, and the whiteness is increased by 2% after pulp treatment. The tensile index and fracture length are increased by 7.8% and 7.2 respectively. %, significantly improves the physical strength and bleaching effect of the paper.
Smart Images
Figure CN118703455B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of enzyme engineering, and in particular to a laccase mutant with high catalytic activity and a preparation method and application thereof. Background Art
[0002] Lignin is a large class of biopolymers composed of phenylpropane analogs. The structure of the units and their connecting bonds are complex and stable, making them difficult to degrade. In the pulp, lignin and xylan form a complex that is tightly attached to the fiber and difficult to remove. After the oxidation reaction of lignin, colored substances will be generated, causing the paper to turn yellow. At the same time, some researchers believe that the presence of lignin will make the pH value of the paper acidic, which will in turn aggravate the hydrolysis and breakage of the glycosidic bonds in the cellulose chain and cause a significant decrease in the mechanical strength of the paper. It can be seen that lignin is currently generally considered to be the main cause of the yellowing of paper and low physical strength.
[0003] In order to improve the whiteness and physical strength of paper, removing lignin is the main research direction at present. Traditional mechanical and chemical methods remove lignin. Mechanical methods consume energy and cannot remove lignin. Although chemical methods reduce energy consumption and reduce fiber content, they are not environmentally friendly. In contrast, biopulping has the characteristics of cleanliness and gentleness. Laccase can quickly break down lignin in pulp into soluble compounds and subunits with smaller molecular weights. Laccase has a good development prospect in the pulp and paper industry.
[0004] As an environmentally friendly biocatalyst, the application of laccase in pulp and papermaking can not only improve the production efficiency of the papermaking process, but also reduce energy consumption and environmental pollution. However, the degradation efficiency of traditional wild-type laccase on lignin is limited, and the bleaching effect and physical strength of pulp need to be improved. Summary of the invention
[0005] In order to overcome the above problems, the purpose of the present invention is to provide a laccase mutant with high catalytic activity and its preparation method and application. The obtained laccase mutant has the characteristics of high enzyme activity, good heat resistance and high catalytic efficiency, and is applied in pulping process to improve the whiteness and physical strength of paper.
[0006] To achieve the above object, the present invention designs a laccase mutant with high catalytic activity, the amino acid sequence of which is obtained by mutating the glutamine at position 275 of the wild-type laccase amino acid sequence shown in SEQ ID NO: 2 to proline, and the amino acid sequence of the laccase mutant is shown in SEQ ID NO: 1.
[0007] As a preferred embodiment, the amino acid sequence of the wild-type laccase is derived from Bacillus pumilus ZB1, and the base sequence of the wild-type laccase is shown in SEQ ID NO:3.
[0008] As a preferred embodiment, the wild-type laccase is obtained by recombining the gene shown in SEQ ID NO: 3 into plasmid pPICZαA to obtain a recombinant plasmid pPICZαA-CotA, and then transferring the recombinant plasmid pPICZαA-CotA into Pichia pastoris X33 to obtain a recombinant mutant strain X33-pPICZαA-CotA, and inducing expression of the recombinant mutant strain X33-pPICZαA-CotA.
[0009] A recombinant expression plasmid comprises the base sequence of a laccase mutant as shown in SEQ ID NO: 4, and the vector of the recombinant expression plasmid is pPICZαA.
[0010] A recombinant expression strain, characterized in that the host bacteria of the recombinant expression strain is Pichia pastoris X33, the genome sequence of the recombinant expression strain includes a recombinant expression plasmid gene, and the recombinant expression plasmid is obtained by recombining the gene shown in SEQ ID NO: 4 into a vector pPICZαA.
[0011] A method for preparing the laccase mutant according to claim 1, characterized in that it comprises the steps of:
[0012] S1. Obtaining and amplifying the gene of the laccase mutant as shown in SEQ ID NO: 4;
[0013] S2. Construction of recombinant expression vector:
[0014] The laccase mutant gene was inserted into the empty plasmid pPICZαA using double restriction enzyme digestion technology to obtain the recombinant expression vector pPICZαA-Q275P;
[0015] S3. Obtaining recombinant expression strains:
[0016] The recombinant expression vector pPICZαA-Q275P was integrated into the host bacteria Pichia pastoris X33 by Pichia pastoris electroporation technology to obtain the recombinant expression strain X33-pPICZαA-Q275P.
[0017] S4. Expression and purification of laccase mutants:
[0018] The recombinant expression strain X33-pPICZαA-Q275P was induced to express, and the crude enzyme solution was collected and purified using a nickel column to obtain the laccase mutant protein.
[0019] As a preferred embodiment, the primers for amplifying the laccase mutant in step S1 are: Lac-F: GCTGAATTCATGAACCTAGAAAAATTTG; Lac-R GTTCTAGAGAAATA ATATCCATCGGCCG.
[0020] An application of a laccase mutant, characterized in that the laccase mutant is applied to a pulp bleaching process, the laccase mutant is added to a pulp system, the pH of the pulp system is adjusted to 5-7, the temperature is 45-60°C, the pulp concentration is 0.1-0.5 g / L, the protein concentration of the laccase mutant is 0.2-0.3 mg / mL, the concentration of the laccase mutant added to the pulp system is 500-700 μg / L, and the reaction time is 10-14 hours.
[0021] The advantages of the present invention are as follows: the present invention mutates the amino acid sequence of the wild-type laccase derived from Bacillus pumilus ZB1, specifically mutates glutamine at position 275 of the amino acid sequence of the wild-type laccase to proline to obtain a laccase mutant Q275P, the laccase mutant Q275P has a specific enzyme activity of 453.9U / mg, which is 2.29 times that of the wild-type laccase; the temperature stability of the mutant laccase Q275P is significantly improved, and the residual enzyme activity after incubation at 40°C, 50°C, and 70°C for 4h is more than 20% higher than that of the wild-type laccase; the catalytic efficiency of the laccase mutant Q275P on the substrate ABTS is significantly improved, which is 1.7 times that of the wild-type laccase. It can be seen that the enzymatic performance of the mutant laccase Q275P is significantly improved compared with the wild-type laccase. In addition, in the application of pulp treatment, the mutant laccase Q275P reduced the Kappa value by 0.82, increased the brightness by 2% ISO, and increased the tensile index and breaking length by 7.8% and 7.2%, respectively, compared with the wild-type laccase treatment, indicating that the mutant laccase Q275P has a better effect on degrading poplar pulp lignin than the wild-type laccase. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is a molecular docking analysis model diagram of wild-type laccase;
[0023] Figure 2 The molecular docking analysis model diagram of laccase mutants;
[0024] Figure 3 The figure shows the purification result of mutant laccase in Pichia pastoris X33;
[0025] Wherein, M: protein molecular standard; 1: mutant laccase CotA-Q275P;
[0026] Figure 4 is the optimum temperature curve of mutant laccase and wild-type laccase;
[0027] Figure 5 The temperature stability curves of mutant laccase and wild-type laccase after 2 h of incubation;
[0028] Figure 6 The temperature stability curves of mutant laccase and wild-type laccase after 4 h of incubation;
[0029] Figure 7 The optimal pH curves of mutant laccase and wild-type laccase are shown;
[0030] Figure 8 is the pH stability curve of mutant laccase and wild-type laccase after 2 h of incubation;
[0031] Fig. 9 The pH stability curves of mutant laccase and wild-type laccase after 4 h of incubation;
[0032] Fig.10 The bar graph shows the effect of 25 mM metal ions on the catalytic activity of wild-type laccase and mutant laccase;
[0033] Fig.11 The bar graph is the effect of 20% organic solvent on the catalytic activity of wild-type laccase and mutant laccase;
[0034] Fig.12 The bar graph shows the effect of 40% organic solvent on the catalytic activity of wild-type laccase and mutant laccase. DETAILED DESCRIPTION
[0035] In order to better understand the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific examples.
[0036] The wild-type laccase in this example is a laccase derived from Bacillus pumilus, the wild-type laccase is named CotA, the amino acid sequence of the wild-type laccase is shown in SEQ ID NO: 2, and the base sequence of the wild-type laccase is shown in SEQ ID NO: 3; the laccase mutant is named CotA-Q275P; the base sequence of the laccase mutant is shown in SEQ ID NO: 4, and the amino acid sequence of CotA-Q275P is shown in SEQ ID NO: 1. Pichia pastoris X33 and plasmid pPICZαA are both conventional strains and plasmids, and the instruments and reagents required for constructing recombinant plasmids and recombinant strains can all be purchased from conventional commercial sources.
[0037] Example 1
[0038] Combination Figure 1 and Figure 2As shown in the figure, through the three-dimensional structure analysis of laccase, the wild-type laccase CotA and the laccase mutant CotA-Q275P were homologously modeled, the wild-type laccase CotA and the laccase mutant CotA-Q275P were docked with the substrate ABTS, and the protein structure was viewed and analyzed with the assistance of PyMol. The mutation sites of the laccase mutant CotA-Q275P are all located in domain II, among which the mutation site 275 of Q275P is located on the β fold. The mutant Q275P replaces the glutamine at position 275 with proline. The molecular weight of this position becomes smaller before and after the replacement of the amino acid, which reduces the steric hindrance to a certain extent, accelerates the electron transfer to improve the catalytic efficiency of the enzyme, and at the same time increases the degree of variability in this area, promoting the binding between the enzyme and the substrate.
[0039] The binding energies of wild-type laccase and laccase mutant CotA-Q275P are -5.72 and -6.1 kcal / mol, respectively. The binding energy of laccase mutant CotA-Q275P is lower than that of wild-type laccase, indicating that the binding of laccase mutant CotA-Q275P to substrate ABTS is more stable than that of wild-type laccase. In addition, the number of hydrogen bonds between laccase mutant CotA-Q275P and wild-type laccase is 3 and 2, and the number of amino acid residues is 3 and 2, respectively. The number of hydrogen bonds and amino acid residues between laccase mutant CotA-Q275P and wild-type laccase is more than that of WT, indicating that the binding ability of laccase mutant CotA-Q275P to ABTS is more stable than that of wild-type laccase. In summary, from the perspective of structural analysis, it can be seen that the mutant has stronger substrate affinity and higher catalytic activity than wild-type laccase.
[0040] The wild-type laccase gene can be purchased commercially or obtained through gene synthesis technology. The laccase mutant CotA-Q275P is obtained by mutating the glutamine at position 275 of the wild-type laccase amino acid sequence shown in SEQ ID NO: 2 to proline. It can be obtained by site-directed mutagenesis, which is a conventional method in the art.
[0041] Example 2 Construction of wild-type laccase CotA recombinant expression vector and mutant CotA-Q275P recombinant expression vector
[0042] (1) Amplification of CotA gene sequence and CotA-Q275P gene sequence
[0043] The upstream primer with EcoR I restriction site at N-terminus was designed: Primer-F (5'→3'): GCTGAATTCATGAACCTAGAAAAATTTG; the downstream primer with Xba I restriction site at C-terminus was designed: Primer-R (5'→3') GTTCTAGAGAAATAATATCCATCG GCCG. The PCR amplification system was 2×Pnhata MaxBuffera: 25μL; dNTPMix (10mM each): 1μL; Primer-F: 2μL; Primer-R: 2μL; Phanta enzyme: 1μL; Template: 1μL; ddH2O: 18μL. The PCR amplification program was: pre-denaturation at 95℃ for 30s; denaturation at 95℃ for 15s, annealing at 64℃ for 15s, extension at 72℃ for 4min, repeated 33 times; final extension at 72℃ for 5min.
[0044] (2) Construction of wild-type laccase recombinant expression vector pPICZαA-CotA and mutant recombinant expression vector pPICZαA-CotA-Q275P
[0045] The PCR product in step (1) was verified by electrophoresis on 0.7% agarose gel, and the sample with the correct band size was electrophoresed on 1% agarose gel, and the target DNA fragment was recovered using a DNA gel recovery kit. The empty plasmid pPICZαA was double-digested at 37°C for 3h using restriction endonucleases EcoR I and Xba I, and the target band was recovered. The PCR product was connected to the empty pPICZαA double-digested product using a ClonExpress II kit. The ligation product was transferred into Escherichia coli DH5α competent cells by heat shock method, spread on LB plates containing bleomycin resistance (25μg / mL), and cultured at 37°C overnight until single colonies grew. All single colonies grown on the plate were selected in LB liquid culture medium, and the plasmids were extracted after culture at 37°C 200rpm shaking for 12h to obtain wild-type laccase pPICZαA-CotA and mutant recombinant expression vector pPICZαA-CotA-Q275P, respectively.
[0046] Example 3 Obtaining and expressing wild-type laccase recombinant strains and mutant laccase recombinant strains
[0047] (1) pPICZαA-CotA and pPICZαA-CotA-Q275P were linearized by SacI, and 5 μL of the recovered product was electroporated into 100 μL of Pichia pastoris X33 competent medium, and then spread on a YPD plate containing bleomycin resistance. Colonies grew on the plate, thus obtaining the wild-type laccase recombinant strain X33-pPICZαA-CotA and the mutant recombinant strain X33-pPICZαA-Q275P. Ten colonies of the mutant recombinant strain X33-pPICZαA-Q275P were randomly selected and named X33-pPICZαA-Q275P-1 to X33-pPICZαA-Q275P-10.
[0048] (2) Expression: The wild-type laccase recombinant strain X33-pPICZαA-CotA and the mutant recombinant strain X33-pPICZαA-Q275P were cultured in a small system and induced with 0.5% methanol for 5 days, and the crude enzyme solution was collected and purified using a nickel column.
[0049] Example 4 Performance determination: In this example, the performance of the recombinant strain X33-pPICZαA-CotA of the wild-type laccase and 10 mutant recombinant strains X33-pPICZαA-Q275P were determined. The enzymatic performance data of the 10 mutant recombinant strains X33-pPICZαA-Q275P were basically consistent. Due to the large amount of data, the following X33-pPICZαA-Q275P data selected the strain with the smallest enzyme activity among the 10 mutant recombinant strains.
[0050] (1) Determination of protein size: The purified mutant laccase CotA-Q275P was subjected to SDS-PAGE electrophoresis. Figure 3 The molecular weight of the target band is about 70 kDa, which is consistent with the theoretical size.
[0051] (2) Determination of enzyme activity: The enzyme activity of the purified wild-type laccase CotA and mutant laccase CotA-Q275P was determined. The protein concentration of the purified wild-type and mutant laccases was determined according to the Braford method, and their enzyme activities were detected. The protein concentration and enzyme activity of the wild-type and mutant laccases are shown in Table 1. The specific enzyme activity of the wild-type laccase was 197.5 U / mg, while the specific enzyme activity of the mutant Q275P was 453.9 U / mg. The results showed that the specific enzyme activity of the mutant Q275P was 2.29 times that of the wild-type laccase.
[0052] Table 1 Comparison of enzyme activities of wild-type laccase and mutant laccase after purification
[0053]
[0054] (3) Analysis of optimal reaction temperature and temperature stability
[0055] like Figure 4 As shown, within the temperature range of 30℃~80℃, the relative enzyme activities of both wild-type laccase and mutant laccase increase with increasing temperature; the optimum temperature of wild-type laccase is 80℃, and the optimum temperature of mutant laccase Q275P is also 80℃, the same as that of wild-type laccase.
[0056] The temperature stability of laccase Figure 5 and Figure 6 As shown, the residual enzyme activity of the mutant laccase Q275P after incubation at 40℃, 50℃ and 70℃ for 4h was more than 20% higher than that of the wild-type laccase. The residual enzyme activity of the mutant laccase Q275P after incubation at 80℃ for 2h was 9.90509%, while that of the wild-type laccase was 0. The residual enzyme activity of the mutant laccase Q275P after incubation at 80℃ for 4h was 2.37966%, while that of the wild-type laccase was 0.
[0057] (4) Optimal reaction pH and pH stability
[0058] like Figure 7 As shown in Figure 2, the optimum pH of wild-type laccase is 4, and the optimum pH of mutant laccase Q275P is 4. The enzyme activities of wild-type laccase and mutant laccase are low in alkaline environment. The pH stability results of laccase are shown in Figure 2. Figure 8 and Fig. 9 As shown, the wild-type and mutant laccases are more stable in alkaline environments than in acidic environments. Both wild-type and mutant laccases have good tolerance under neutral to alkaline pH conditions; the residual enzyme activity is above 60% after incubation for 2 hours in the pH range of 7-10; the residual enzyme activity is above 40% after incubation for 4 hours in the pH range of 7-10. There is no significant difference in the stability of wild-type laccase and mutant laccase under different pH conditions.
[0059] (5) Effects of metal ions on enzyme activity
[0060] The effects of different metal ions on laccase activity are shown in Figure 2. Fig.10 As shown, in 25 mM Na + Mg 2+ 、Cd 2+ 、Co 2+ 、Zn 2 + , Mn 2+ , Ca 2+ , Cu 2+ , Fe 3+ , Li + The relative enzyme activity of mutant laccase Q275P was higher than that of wild-type laccase in the environment of 25 mM Fe 2+The mutant laccase Q275P lost its activity in 25 mM Fe 2+ The relative enzyme activity was about 20%, indicating that the mutant laccase had improved tolerance to many metal ions compared with the wild-type laccase.
[0061] (6) Effect of organic solvents on enzyme activity
[0062] The effects of different organic solvents on laccase activity are shown in Fig.11 and Fig.12 As shown in the figure, after adding organic solvents such as DMSO, butanol, isopropanol, acetonitrile and DMF, the activities of wild-type and mutant laccases decreased with the increase of organic solvent concentration, indicating that these five organic solvents have obvious inhibitory effects on wild-type and mutant laccases. In the presence of organic solvents, the activity of mutant laccases is basically higher than that of wild-type laccases. In the presence of 40% DMSO and butanol, the relative activity of mutant laccase Q275P is 16% and 23% higher than that of wild-type laccase, respectively.
[0063] (7) Laccase kinetic parameters:
[0064] The results of enzyme kinetic parameters of mutant and wild-type laccases are shown in Table 2. The Km value of mutant laccase Q275P is smaller than that of wild-type laccase, indicating that the mutant laccase has better affinity with the ABTS substrate. The Kcat value of mutant laccase Q275P is larger than that of wild-type laccase, indicating that the catalytic efficiency of mutant laccase Q275P for ABTS substrate is significantly improved compared with that of wild-type laccase, and the catalytic efficiency of mutant laccase Q275P for substrate ABTS is 1.7 times that of wild-type; the Kcat / Km value of mutant laccase Q275P is larger than that of wild-type laccase, indicating that the specificity of mutant laccase Q275P for substrate ABTS is enhanced compared with wild-type laccase, and the specificity of mutant laccase Q275P for substrate ABTS is 1.8 times that of wild-type.
[0065] Table 2 Comparison of kinetic parameters of laccase using ABTS as substrate
[0066]
[0067] (8) Application effect of mutant laccase in pulping process:
[0068] Add 5g of poplar pulp to 10ml of pure water and disperse the slurry by hand, mix evenly, put it in a 55℃ oven to dry the water to obtain slurry, weigh 3g of slurry and put it into a 500mL shake flask, add 100mL pH 7 buffer, 60μg enzyme dosage, enzyme concentration is 0.21mg / mL, the enzyme solution and slurry are mixed in the shake flask, and placed in a 50℃ shaker for reaction for 12h. After reaching the reaction time, immediately put it in an 80℃ water bath for inactivation for 5 minutes, then rinse the treated slurry with tap water, and put it in a 55℃ oven to dry the water. Weigh 2.88g of the enzyme-treated slurry, add pure water, and use a fiber standard disintegrator to comb the pulp. After reaching 20,000 revolutions, take it out for subsequent experiments. Use Kaiser fast paper former to make paper with a quantitative of 80g / m 2 The hand-copied paper was taken out and dried under high temperature and high pressure at 105°C for 10 minutes. The paper sample can be used for subsequent measurements.
[0069] The effects of different laccases on pulp treatment are shown in Table 3. Compared with the wild-type laccase, the mutant Q275P alone treated the pulp, and the kappa value decreased by 0.82 and the brightness increased by 2.00% ISO, respectively. This indicates that the mutant laccase Q275P has stronger delignification ability and better pulp bleaching effect than the wild-type laccase.
[0070] Table 3 Effects of different laccases on pulp treatment
[0071]
[0072] At the same time, the effects of different laccase treatments on the physical properties of pulp were detected. The results are shown in Table 4. Compared with the wild-type laccase acting on poplar pulp, the tensile index and breaking length of the pulp treated with the mutant laccase Q275P increased by 7.8% and 7.2%, respectively, indicating that compared with the wild-type laccase, the mutant laccase Q275P can improve the physical strength of pulp fibers after treating poplar pulp. This is because more fine fibers are exposed under the action of the mutant laccase, and the bonding force between the fibers is further strengthened.
[0073] Table 4 Effects of different laccase treatments on the physical properties of pulp
[0074]
[0075] In summary, the specific enzyme activity of the mutant laccase Q275P obtained in this embodiment is 453.9U / mg, which is 2.29 times that of the wild-type laccase; the temperature stability of the mutant laccase Q275P is significantly improved, and the residual enzyme activity after incubation at 40°C, 50°C, and 70°C for 4 hours is more than 20% higher than that of the wild-type laccase; the residual enzyme activity of the mutant laccase Q275P after incubation at 80°C for 2 hours is 9.90509%, while the residual enzyme activity of the wild-type laccase is 0, indicating that the heat resistance of the mutant laccase Q275P is significantly improved compared with the wild-type laccase. The tolerance of the mutant Q275P to various metal ions and organic solvents is enhanced compared with the wild-type laccase. The catalytic efficiency of the mutant Q275P for the substrate ABTS is significantly improved, which is 1.7 times that of the wild-type laccase. It can be seen that the enzymatic properties of the mutant laccase Q275P are significantly improved compared with the wild-type laccase.
[0076] In addition, in the application of pulp treatment, the mutant laccase Q275P reduced the Kappa value by 0.82, increased the brightness by 2% ISO, and increased the tensile index and breaking length by 7.8% and 7.2%, respectively, compared with the wild-type laccase treatment, indicating that the mutant laccase Q275P has a better effect on degrading poplar pulp lignin than the wild-type laccase.
Claims
1. A laccase mutant with high catalytic activity, characterized in that: The amino acid sequence of the laccase mutant is obtained by mutating glutamine at position 275 of the wild-type laccase amino acid sequence shown in SEQ ID NO: 2 to proline. The amino acid sequence of the laccase mutant is shown in SEQ ID NO:
1.
2. A gene encoding the laccase mutant according to claim 1, characterized in that: The base sequence of the laccase mutant gene is shown in SEQ ID NO:
4.
3. A recombinant expression plasmid, characterized in that: The recombinant expression plasmid is obtained by recombining the gene shown in SEQ ID NO: 4 into the vector pPICZαA.
4. A recombinant expression strain, characterized in that: The host bacteria of the recombinant expression strain is Pichia pastoris X33. The genome sequence of the recombinant expression strain includes a recombinant expression plasmid. The recombinant expression plasmid is obtained by recombining the gene shown in SEQ ID NO: 4 into a vector pPICZαA.
5. A method for preparing the laccase mutant according to claim 1, characterized in that: Includes steps: S1. Obtaining and amplifying the gene of the laccase mutant as shown in SEQ ID NO: 4; S2. Construction of recombinant expression vector: The laccase mutant gene was inserted into the empty plasmid pPICZαA using double restriction enzyme digestion technology to obtain the recombinant expression vector pPICZαA-Q275P; S3. Obtaining recombinant expression strains: The recombinant expression vector pPICZαA-Q275P was integrated into the host strain Pichia pastoris X33 by Pichia pastoris electroporation technology to obtain the recombinant expression strain X33-pPICZαA-Q275P. S4. Expression and purification of laccase mutants: The recombinant expression strain X33-pPICZαA-Q275P was induced to express, and the crude enzyme solution was collected and purified using a nickel column to obtain the laccase mutant protein.
6. The method for preparing a laccase mutant according to claim 5, characterized in that: The primers for amplifying the laccase mutant in step S1 are: Lac-F: GCTGAATTCATGAACCTAGAAAAATTTG; Lac-R:GTTCTAGAGAAATAATATCCATCGGCCG.
7. A use of the laccase mutant according to claim 1, characterized in that: The laccase mutant is applied to a pulp bleaching process. The laccase mutant is added to a pulp system, the pH of the pulp system is adjusted to 5-7, the temperature is 45-60°C, the pulp concentration is 10-50 g / L, the protein concentration of the laccase mutant is 0.2-0.3 mg / mL, the concentration of the laccase mutant added to the pulp system is 500-700 μg / L, and the reaction time is 10-14 hours.