A genetic locus marker of immune infiltration function associated with colorectal cancer susceptibility and prognosis and its application

Abstract

The present invention relates to an immune infiltration function genetic locus associated with susceptibility and prognosis of colorectal cancer and its application, wherein the marker is rs1360948. The rs1360948 locus has the most significant colorectal cancer immunQTL effect value, and individuals carrying the rs1360948 [G] genotype are more likely to bind to the transcription factor PRDM1, thereby causing the target gene CCL2 to express more, promoting cancer cell proliferation, leading to an increased risk of individual colorectal cancer and a poor prognosis for colorectal cancer patients. By cleverly designing primers and probes for the rs1360948 locus, the rs1360948 risk locus can be detected in normal people or colorectal cancer patients by fluorescent quantitative PCR, and the high-risk population for colorectal cancer can be identified, the prognosis of colorectal cancer patients can be predicted, and the high-risk population for colorectal cancer and the population with the possibility of poor prognosis of colorectal cancer patients can be screened as an auxiliary method.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and tumor medicine, and in particular to an immune infiltration functional site marker associated with colorectal cancer susceptibility and prognosis and an application thereof. Background Art

[0002] As a common malignant digestive tract tumor, colorectal cancer seriously threatens the health of the Chinese people. Its incidence ranks third among malignant tumors in my country, and its mortality ranks second. With the development of the country's economic level, changes in lifestyle, and the aging of the population, the burden of colorectal cancer in my country is becoming increasingly serious, becoming one of the key diseases that threaten people's health. At the same time, since colorectal cancer usually develops insidiously, most patients are already in the advanced stage when they present symptoms. In recent years, despite the continuous improvement of comprehensive tumor treatment methods, the prognosis of patients with advanced colorectal cancer is still not optimistic, with an overall 5-year survival rate of less than 20%, and 25% to 50% of colorectal cancer patients will continue to develop metastatic colorectal cancer (mCRC) during diagnosis or subsequent treatment. The increasing incidence rate and poor prognosis in the late stage make it a key issue that needs to be urgently addressed in the field of public health in my country. At present, in the clinical treatment of colorectal cancer patients, patients with early colorectal cancer are usually treated with colorectal resection, while patients in the middle and late stages need molecular targeted or immunotherapy drugs based on patient specificity and disease specificity, and chemotherapy is the main treatment method. As the concept of precision treatment and individualized treatment is truly implemented in tumor treatment, tumor treatment, which used to have poor efficacy and poor survival, has made "qualitative" progress. Precision treatment of tumors should be based on in-depth exploration of the nature of tumors, and the search for driver genes and molecular markers related to tumor occurrence, development, metastasis and prognosis, to promote the development and application of innovative drugs and technologies, so that more patients can benefit, and it can effectively improve the treatment rate of tumors in patients, and save a lot of medical expenses for the country.

[0003] In recent years, individualized screening programs based on molecular genetics have become the focus of screening high-risk populations for colorectal cancer, analyzing the direction of colorectal cancer tumor development, and predicting patient prognosis. At the same time, colorectal cancer is a complex disease caused by the long-term interaction of multiple risk factors in the environment and genetic background, and most of the specific pathogenic genes of colorectal cancer have not yet been fully elucidated. With the in-depth description of the genetic mutation map of colorectal cancer, we found that the mutation characteristics of tumor cells alone cannot accurately classify tumor types or predict patient prognosis. Studies have shown that inflammatory response is an important part of the host immune defense system. The risk of colorectal cancer in patients with inflammatory bowel disease is 1.7 times that of the general population, indicating that inflammation plays a core role in resolving pathogenic infections, maintaining normal intestinal function, or promoting tumorigenesis. The development of sequencing technology has provided more and more sufficient evidence that the occurrence and development of tumors depends not only on the genetic mutations of tumor cells, but also on the close interaction between tumor cells and their tumor microenvironment (TME). The tumor microenvironment is a complex system composed of cancer-associated fibroblasts, vascular cells, and infiltrating immune cells, which plays an important role in all stages of the development of colorectal cancer. Therefore, describing the cellular composition of the colorectal cancer tumor microenvironment and exploring its influencing factors will help to analyze the mechanism of colorectal cancer development and prognosis.

[0004] Previous studies have found that the body's immune response to tumors is affected by a variety of factors, among which the study of germline genetic variation on immune response is not sufficient. The risk loci obtained from the Genome-Wide Association Study (GWAS) of various cancers were finely located and functionally annotated, and it was found that genetic variation can mediate cancer risk through immune response, and can even cause changes in the content of immune cells by regulating key genes, causing changes in the immune system's response to tumors, thereby affecting the occurrence and development of cancer and patient prognosis. Therefore, systematically identifying genetic variations that affect tumor immune cell infiltration within the genome, and identifying biomarkers of immune infiltration functional genetic loci that can affect tumor progression and treatment prognosis through the colorectal cancer immunQTL (immunity Quantification Trait Loci, immunQTL) map, is a key entry point for revealing tumor immune response and patient prognosis, which helps guide patient stratification, personalized precision medicine, and prediction of patient prognosis in colorectal cancer. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and to provide a genetic locus marker for immune infiltration function associated with colorectal cancer susceptibility and prognosis and its application.

[0006] A marker for an immune infiltration function genetic locus associated with colorectal cancer susceptibility and prognosis, the marker being rs1360948.

[0007] Specifically, it is the application of detection reagents for the immune infiltration function genetic locus rs1360948, which is related to colorectal cancer susceptibility and prognosis, in the preparation of colorectal cancer high-risk population screening and colorectal cancer patient prognosis prediction kits.

[0008] The above-mentioned colorectal cancer high-risk population screening and colorectal cancer patient prognosis prediction kit includes rs1360948 specific amplification primers and the above-mentioned functional genetic site marker specific probes, the specific amplification primer sequences are SEQ ID NO: 1 and SEQ ID NO: 2, and the probe sequences are SEQ ID NO: 3 and SEQ ID NO: 4.

[0009] The beneficial effects of the present invention are as follows: from the molecular biology and gene diagnosis level, a technical method for screening high-risk groups susceptible to colorectal cancer and predicting the prognosis of colorectal cancer patients is provided. This method is based on our previous research showing that the rs1360948 site is related to the susceptibility and prognosis of colorectal cancer in the Chinese population. By cleverly designing primers and probes for the rs1360948 site and relying on fluorescent quantitative PCR, the rs1360948 mutation can be detected in the normal population or the colorectal cancer patient population, thereby identifying the high-risk population for colorectal cancer, assisting in the early screening and diagnosis of colorectal cancer patients, and predicting the survival outcome of colorectal cancer patients. The technical method is cleverly designed, simple and feasible, and the results are accurate and reliable. It can be promoted in hospitals at all levels, and provides help for assessing the risk of colorectal cancer and predicting patient outcomes, and is helpful for clinical colorectal cancer screening and early intervention for this type of population. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Flow chart for screening immune infiltration genetic locus rs1360948 for immunQTL mapping;

[0011] Figure 2 This is a schematic diagram of the results of the study on the association between the immune infiltration function genetic locus rs1360948 and colorectal cancer susceptibility and prognosis;

[0012] Figure 3 AUC curve diagram of the colorectal cancer risk prediction model based on the SNP site rs1360948;

[0013] Figure 4 Schematic diagram of the results of the dual luciferase reporter gene experiment of the immune infiltration function genetic locus rs1360948;

[0014] Figure 5This is a schematic diagram of the binding results of immune infiltration function genetic locus rs1360948 and transcription factor PRDM1;

[0015] Figure 6 Schematic diagram of the regulation of immune infiltration function genetic locus rs1360948 on the expression level of target gene CCL2;

[0016] Figure 7 This is a schematic diagram of the cancer-promoting effect of the immune infiltration function genetic locus rs1360948 target gene CCL2 and target cell Treg in colorectal cancer;

[0017] Figure 8 Schematic diagram of the effect of overexpression or knockdown of the target gene CCL2 on subcutaneous tumor growth and prognosis in mice. DETAILED DESCRIPTION

[0018] The principles and features of the present invention are described below. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention. The technical solution of the present invention is as follows:

[0019] Combining the immunQTL map of colorectal cancer in the Chinese population and a multicenter case-control study, an immune infiltration functional genetic locus marker associated with early screening of colorectal cancer and prediction of patient outcomes was identified. The immune infiltration functional genetic locus marker is rs1360948.

[0020] The specific amplification primer sequences of rs1360948 are SEQ ID NO: 1 and SEQ ID NO: 2.

[0021] The probe sequences of rs1360948 are SEQ ID NO: 3 and SEQ ID NO: 4.

[0022] The above-mentioned detection reagents for marking genetic loci of immune infiltration function related to susceptibility and prognosis of colorectal cancer are used in the preparation of a kit for screening high-risk populations for colorectal cancer and predicting the prognosis of colorectal cancer patients.

[0023] A kit for screening high-risk populations for colorectal cancer and predicting the prognosis of colorectal cancer patients, wherein the kit is used to detect rs1360948 in peripheral blood DNA.

[0024] The kit for screening high-risk populations of colorectal cancer and predicting the prognosis of colorectal cancer patients comprises specific amplification primers and specific probes of the immune infiltration function genetic site rs1360948 marker.

[0025] The technical solutions to the problems of the present invention include: (1) Establishing a specimen library and database with unified standards: Collecting blood samples of subjects that meet the standards according to standard operating procedures (SOPs) and systematically collecting complete demographic and clinical data. (2) Genotype detection: Selecting colorectal cancer cases and healthy controls to explore the association between significant immunQTL sites and the incidence of colorectal cancer or patient prognosis in the Chinese population; (3) Verifying the screened positive associated functional site markers in independent samples to determine the stability of their association. (4) Development of a kit for screening high-risk populations for colorectal cancer and predicting the prognosis of colorectal cancer patients: Developing a kit for screening high-risk populations for colorectal cancer and predicting the prognosis of colorectal cancer patients based on genetic functional site markers with significant differences in genotype distribution frequencies between colorectal cancer cases and healthy controls.

[0026] Specifically, the experimental method of the present invention mainly includes the following contents:

[0027] First, we performed quality control, dimensionality reduction clustering, and annotation on the single-cell RNA sequencing data of colorectal cancer patients in public databases, and identified a total of 25 cell types. We then deconvolved the RNA-seq of 379 cases in the TCGA database and 154 collected tumor tissues of Chinese colorectal cancer patients to obtain the relative content of various cells in colorectal cancer tissues. We further combined the genotype data to perform immunQTL calculations on TCGA and Chinese colorectal cancer samples, respectively, and screened sites that were significantly associated in both data. We found that rs1360948, as the most significant site in the TCGA colorectal cancer rs1360948 site results, also has a high significance in colorectal cancer samples in the Chinese population. Therefore, we regard the rs1360948 site as a key site related to colorectal cancer. The specific process is as follows: Figure 1 shown.

[0028] Next, we analyzed the association between the rs1360948 locus and colorectal cancer susceptibility. We sorted out all colorectal cancer cases in the UK Biobank and matched each patient with 5 healthy controls, including a total of 5231 cases and 26179 controls. In addition, we recruited 16616 colorectal cancer patients with complete medical records and clear typing and 21304 normal controls with no history of tumors in three independent centers in China, and performed genotyping on these people. Patients were diagnosed by histopathology without age restrictions; normal controls had no history of tumors and no signs of tumors after physical examination. Each subject gave informed consent to participate in this study and donated 2mL of peripheral venous blood for the isolation and preparation of lymphocyte genomic DNA. The basic information of the above subjects from European and Chinese populations, such as gender, age, etc., is shown in Table 1:

[0029] Table 1. Basic information of the case-control study samples of European and Chinese populations

[0030]

[0031] We used an unconditional logistic regression additive model to calculate the association between SNP locus rs1360948 and colorectal cancer susceptibility, and adjusted for gender, age, smoking and drinking. The results showed that after adjusting for confounding factors, individuals carrying the rs1360948 risk genotype had a 15% and 25% increased risk of colorectal cancer in European and Chinese populations, respectively, compared with normal people (OR = 1.15, 95% CI: 1.08-1.22, P = 7.22 × 10 -6 ; OR=1.25, 95% CI: 1.19-1.33, P=2.34×10 -15 ). The association results of rs1360948 with colorectal cancer risk are detailed in Figure 2 .

[0032] Given that the risk allele of the rs1360948 locus is associated with Treg cell infiltration, and Treg cells can inhibit anti-tumor immune response and promote immune escape, which is usually associated with poor prognosis, we explored the association between this locus and the prognosis of patients with colorectal cancer. We performed a survival analysis of the rs1360948 locus and patient prognosis in the TCGA database. In this data set, there were 346 colorectal cancer samples with genotype, clinical data and prognosis information, and 76 people died of colorectal cancer. The results were further verified in the UK Biobank database, and 4,692 colorectal cancer samples with both genotype and prognosis information were screened, of which 1,158 people died of colorectal cancer. In addition, we collected new colorectal cancer patients diagnosed in hospitals in Wuhan from 2004 to 2010 and followed up until 2022. Finally, 907 samples with complete follow-up data and clear typing were obtained, and a total of 383 patients died of colorectal cancer. Patients were diagnosed by histopathology, with no age limit; each subject gave informed consent to participate in this study and donated 2 mL of peripheral venous blood for the isolation and preparation of lymphocyte genomic DNA. The basic information of the subjects in the follow-up population from Europe and China, such as gender and age, is shown in Table 2.

[0033] Table 2. Basic information of the European and Chinese follow-up populations

[0034]

[0035] Based on the additive model, we used Cox regression analysis to correct for the effects of confounding factors such as age, gender, and cancer stage in the TCGA follow-up population, UK Biobank follow-up population, and Chinese follow-up population. We found that the prognosis of colorectal cancer patients was worse after rs1360948 mutated from A to G (TCGA follow-up population: HR = 1.62, 95% CI = 1.08-2.4, P = 1.96 × 10 -2 UK Biobank follow-up population: HR = 1.20, 95% CI = 1.07-1.34, P = 1.24 × 10 -3 ; Chinese follow-up population: HR = 1.18, 95% CI = 1.01-1.38, P = 3.91 × 10 -2 ), the result is as follows Figure 2 shown.

[0036] Previous multicenter population association analysis verified that this site is a risk site for colorectal cancer, so we further used this SNP site to establish a risk prediction model for colorectal cancer. We used the European UK Biobank database data and the Chinese multicenter population data to construct formulas, taking into account the three genotypes of SNP and gender, age, smoking and drinking conditions. Among them, for SNP typing, wild homozygous type = "1", heterozygous type = "2", and mutant homozygous type = "3"; for gender, male is "1" and female is "0"; for age, greater than or equal to 60 years old is "1" and less than 60 years old is "0". During the analysis, the multivariate logistic regression coefficient β was used as the weight, and the formula for the risk score based on rs1360948 typing was obtained as follows:

[0037] The risk score for the Chinese population = (0.0864 × gender score) + (-0.0328 × age score) + (0.1088 × smoking score) + (0.0071 × drinking score) + (0.1113 × rs1360948 typing score).

[0038] The risk score for the European population = (-0.0062 × gender score) + (0.1053 × smoking score) + (-0.1527 × drinking score) + (0.1354 × rs1360948 typing score).

[0039] By plotting the AUC curve, we can find that the area under the curve of this model is 0.537 for European and 0.538 for Chinese populations, see Figure 3 .

[0040] To functionally analyze the colorectal cancer risk association of the rs1360948 functional site marker, we used eQTL analysis to explore the target genes regulated by this site and found that different alleles of this pathogenic site were significantly associated with the expression of the adjacent gene CCL2. Subsequently, dual luciferase reporter gene experiments were used to confirm that the reporter gene activity of the recombinant plasmids transfected with rs1360948[G] allele or rs1360948[A] allele was significantly higher than that of the pGL3-Promoter empty vector group in two colorectal cancer cell lines HCT116 and SW480, indicating that the DNA fragment where the target site is located has enhancer activity. Compared with the rs1360948[A] genotype group, the reporter gene activity of the rs1360948[G] genotype group increased significantly. The above experimental results show that the region where rs3094296[T] is located has enhancer activity, and the transcriptional activation effect of the enhancer of rs1360948[G] at this site is stronger than that of rs1360948[A]. Figure 4 Mechanistically, we found that the rs1360948[G] allele has a stronger ability to bind to the transcription factor PRDM1, as shown in Figure 5 In TCGA colorectal cancer samples and Chinese colorectal cancer samples, it was found that the expression levels of the transcription factor PRDM1 and the target gene CCL2 were significantly positively correlated, and the expression was genotype-specific, that is, the positive correlation was more significant in individuals with the AG or GG genotype. The specific results are shown in Figure 6 In three colorectal cancer cell lines, SW480, HCT116, and DLD1, we verified that the enhancer region where the rs1360948 locus is located has the ability to specifically bind to the transcription factor PRDM1. The mutation of the A allele to the G allele can enhance the binding of this region to PRDM1, increase the activity of the enhancer, and ultimately cause the target gene CCL2 to be expressed. The specific results are shown in Figure 6 .

[0041] Next, we analyzed the relationship between the expression level of CCL2 and the content of Treg cells in 154 colorectal cancer tissue samples from the Chinese population and 369 samples from TCGA, and found that the two showed a significant positive correlation (Chinese population: r = 0.473, P < 0.001; TCGA: r = 0.278, P < 0.001). Using the expression data of 154 pairs of cancer and adjacent tissue samples from Chinese colorectal cancer patients, it was found that the expression level of CCL2 in colorectal cancer tissue was significantly upregulated (P = 0.010), and Treg cells also infiltrated more in colorectal cancer tissue (P < 0.001). The same conclusion was obtained in 559 colorectal cancer tissues and 51 adjacent tissues from TCGA, suggesting that CCL2 expression and Treg cell content have a consistent change process in the pathogenesis of colorectal cancer, and may play a role in promoting the progression of colorectal cancer. Further analysis of the correlation between CCL2 expression level and Treg cell content and the prognosis of colorectal cancer patients in TCGA samples showed that high CCL2 expression was significantly correlated with poor prognosis of patients (HR=1.80, 95%CI=1.13-2.87, P=0.014), and more Treg cell infiltration could significantly reduce the survival rate of patients (HR=1.63, 95%CI=1.01-2.57, P=0.035). Figure 7 shown.

[0042] After obtaining the statistical association of CCL2 in the population, we then tested the biological function of CCL2 in vivo by using a mouse subcutaneous tumor formation experiment. The MC38 stable cell lines overexpressing or knocking down CCL2 were injected subcutaneously into C57BL / 6J mice to construct a subcutaneous tumor model of colorectal cancer. From the perspective of tumor size and growth curve, the tumor volume of mice injected with the CCL2 overexpressing cell line was significantly larger, while the tumor volume of mice injected with the CCL2 knockdown cell line was the smallest. After further peeling off the mouse subcutaneous tumor for H&E and immunohistochemical staining, it was found that compared with the control group tumor, the CCL2 protein level in the tumor of the CCL2 overexpressing group was significantly increased, and the tumor cell proliferation was higher, while the CCL2 protein level in the tumor of the CCL2 knockdown group was reduced, and the tumor cell proliferation was also lower. At the same time, it can be observed that the survival of the control group mice was significantly better than that of the CCL2 overexpressing group mice (P < 0.001), while the survival of the CCL2 knockdown group mice was significantly better than that of the control group mice (P = 0.005). The above in vivo experimental results prove that the CCL2 gene can promote the growth of colorectal cancer and is related to the prognosis of colorectal cancer. The mouse tumor tissue was separated into a single cell suspension and then flow cytometry was performed to analyze the effect of CCL2 on Treg cells in the tumor microenvironment. Compared with the control group, the Treg infiltration in the tumor tissue of the CCL2 overexpression group was significantly increased, while the Treg infiltration in the CCL2 knockdown group was significantly reduced, which is consistent with the results of the above bioinformatics analysis. Based on the above results, this study found that CCL2 can cause an increase in the infiltration of Treg cells in colorectal cancer tissues, forming an inhibitory immune microenvironment, thereby promoting the development of tumors. The results are as follows Figure 8 shown.

[0043] The above large-scale population data and biological function experimental results show that the rs1360948 (G>A) site increases the expression of the target gene CCL2 by enhancing the binding of the region to the transcription factor PRDM1, promotes cancer cell proliferation, and ultimately leads to poor prognosis in colorectal cancer patients. Therefore, testing the rs1360948 mutation in the population is helpful to screen high-risk populations for colorectal cancer and predict the prognosis of colorectal cancer patients.

[0044] Experimental methods:

[0045] 1. DNA extraction from peripheral blood:

[0046] We used the conventional phenol-chloroform method to extract DNA. The specific steps are as follows:

[0047] 1) Take about 3 mL of anticoagulated blood, centrifuge at 5000×g for 15 min at room temperature, discard the upper layer, and keep about 0.3 mL of blood cells. Add 0.5 mL of freshly prepared extraction buffer with a final concentration of 20 μg / mL RNase, mix well, and incubate at 37°C for 1 hour.

[0048] 2) Add proteinase K at a final concentration of 100 μg / mL, mix well and incubate at 37°C overnight.

[0049] 3) Add 0.7 mL of phenol (pH = 7.0) equilibrated with Tris buffer to each tube, mix thoroughly, and centrifuge at 8,000 × g for 15 min at room temperature.

[0050] 4) Transfer the upper layer of liquid to another 1.5 mL centrifuge tube, add an equal volume of 0.7 mL of phenol-chloroform (1:1), mix thoroughly for 15 min; and centrifuge at 8,000 × g for 15 min at room temperature.

[0051] 5) Transfer the upper layer of liquid to another clean 1.5 mL centrifuge tube, add 10% volume of 10 M ammonium acetate solution, add 2 volumes of pre-cooled anhydrous ethanol, and let stand at -20°C for 2 h to precipitate DNA.

[0052] 6) The precipitated DNA was washed with 75% ethanol, centrifuged at 12000×g for 15 min, and the supernatant was discarded; then washed with 75% ethanol, centrifuged at 12000×g for 15 min, and the supernatant was discarded.

[0053] 7) Place the tube upside down on absorbent paper, and after the ethanol has evaporated, add appropriate TE buffer to each tube, place at 4°C for one week, and then store at -20°C for future use.

[0054] 2. Genotyping

[0055] The typing platform used was TaqMan genotyping technology (ABI 7900HT Real Time PCR system, Applied Biosystems), and the 5 μL PCR reaction system was shown in Table 3:

[0056] Table 3. TaqMan genotyping PCR reaction system

[0057]

[0058] The reaction conditions were: pre-denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min, and cooling to 4°C.

[0059] The primers and probes used in the reaction are as follows:

[0060] rs1360948 Primers:

[0061] Forward primer: GCAGAGCTAGAGTGAACCATGTTG (SEQ ID NO: 1)

[0062] Reverse primer: CTTGAGTAATGACCTCAGCATTCCT (SEQ ID NO: 2)

[0063] rs1360948 probe:

[0064] Forward probe: FAM-CCATTGTGAAAGTGCAA-MGB (SEQ ID NO: 3)

[0065] Reverse probe: VIC-CCATTGTGAAAGTACA-MGB (SEQ ID NO: 4)

[0066] 3. Dual luciferase reporter gene assay

[0067] 1) Reporter gene plasmid vector

[0068] In this study, the pGL3-Promoter vector was selected to construct a reporter gene plasmid to verify whether the region where the target site is located is a key site associated with the risk of colorectal cancer in the immunQTL. The pGL3-Promoter vector contains a firefly luciferase gene and its upstream SV40 promoter, which can efficiently express firefly luciferase in a variety of cell lines. Inserting the target fragment upstream or downstream of the SV40 promoter can detect whether the region has a transcriptional regulatory effect. In addition, we selected the pRL-SV40 vector as an internal reference control. The pRL-SV40 vector contains a Renilla luciferase gene and early enhancer and promoter elements, which can efficiently express Renilla luciferase in a variety of cell lines. In this study, pRL-SV40 and pGL3-Promoter plasmids were co-transfected into cells to normalize the firefly luciferase activity to eliminate the inherent changes in the experiment and improve the accuracy of the results.

[0069] For the reporter gene plasmid of rs1360948, we downloaded the DNA sequence centered on the site and 500 bp upstream and downstream from NCBI, conventionally synthesized DNA fragments containing different alleles of the site, and cloned the target sequence in the forward direction (adding MluI restriction site at the 5' end and XhoI restriction site at the 3' end) into the pGL3-Promoter vector, thus constructing two recombinant reporter gene plasmids, such as Figure 4 The plasmid was commissioned to Qingke Biotechnology Co., Ltd. (Wuhan) for construction and prepared in the form of puncture bacteria. The accuracy of the fragment was verified by DNA sequencing and restriction endonuclease digestion.

[0070] 2) Plasmid amplification and extraction

[0071] ①Prepare liquid culture medium in advance: take 5g LB culture medium powder and thoroughly shake it with 200ml deionized water to dissolve, sterilize it by high pressure, seal it with sealing film after cooling, and store it in a refrigerator at 4℃;

[0072] ② Add 15 ml LB liquid medium and 30 μl ampicillin to a 50 ml centrifuge tube and gently shake to mix;

[0073] ③ Use a sterile gun tip to gently select the puncture bacteria and inject them into the centrifuge tube;

[0074] ④Fix the centrifuge tube on a constant temperature shaker, set the temperature to 37°C, the speed to 220 rpm, and shake for 12 to 16 hours (preferably 14 hours). Collect the bacterial solution when the liquid becomes turbid to the naked eye;

[0075] ⑤ Collect the fresh bacterial solution after plasmid amplification, centrifuge at 5000g for 15min at room temperature, and discard the supernatant;

[0076] ⑥Use Omega's endotoxin-free plasmid extraction kit to extract the plasmid, use NanoDrop 1000 to detect the plasmid concentration and purity, and package the qualified plasmid and store it in a -20℃ refrigerator.

[0077] 3) Transient transfection of reporter gene plasmid

[0078] ① The day before transfection, cells were plated onto 96-well culture plates and cultured in a constant temperature incubator for 16 to 24 hours. Transfection was performed when the cells reached 70% to 90% confluence.

[0079] ② Replace the culture medium with fresh one 30 minutes before transfection and place the cells back into the constant temperature incubator for incubation, during which time the transfection system is prepared;

[0080] ③The ratio of transfection reagent for each well is as follows:

[0081] a. Prepare solution A in a 1.5 ml EP tube: add 5 μl Opti-MEM and 0.3 μl Lipofectamine 3000 reagent respectively, and mix by gently pipetting;

[0082] b. Prepare solution B in another 1.5 ml EP tube: add 5 μl Opti-MEM, 2 ng pRL-SV40 internal reference plasmid, 200 ng rs1360948 reporter gene plasmid, and 0.2 μl P3000 reagent respectively, and mix by gently pipetting;

[0083] ④ Mix solution A and solution B thoroughly and let stand at room temperature for 5 to 10 minutes to obtain DNA-liposome complex;

[0084] ⑤ Add 10 μl of the prepared complex to each well, shake gently to mix, and return to the constant temperature incubator for continued cultivation.

[0085] 4) Dual luciferase reporter gene activity assay

[0086] This study used Promega's dual-luciferase reporter gene assay system to detect luciferase activity. Prepare LAR II starting solution and Stop&Glo termination solution according to the instructions, divide them into aliquots and store them in a -80℃ refrigerator. The specific steps are as follows:

[0087] ① Harvest cells 24-36 hours after reporter gene plasmid transfection, wash twice with PBS, and discard the remaining PBS;

[0088] ② Dilute PLB lysate (5×) with ultrapure water to the working concentration (1×), add 30 μl per well into a 96-well culture plate, and shake gently to mix;

[0089] ③ After sealing the culture plate, place it in a -80℃ refrigerator overnight (more than 8 hours) to allow the cells to fully lyse;

[0090] ④ Before measuring fluorescence, take out the cell plate and the required amount of fluorescence reagent from the -80℃ refrigerator and let them stand at room temperature to melt;

[0091] ⑤ Take a 1.5 ml colorless transparent EP tube, add 20 μl starting solution and 5 μl cell lysis solution respectively, mix gently by pipetting, be careful to avoid bubbles, and immediately put it into the instrument to detect firefly luciferase activity;

[0092] ⑥ Add 20 μl of stop solution, mix gently by pipetting, and immediately detect the activity of Renilla luciferase;

[0093] Calculation: Normalized luciferase activity = firefly luciferase activity / Renilla luciferase activity, relative luciferase activity = normalized luciferase activity of the experimental group / average normalized luciferase activity of the control group.

[0094] 4. Subcutaneous tumor formation experiment in C57BL / 6J mice

[0095] The mice were purchased from Beijing Weitonglihua Company and kept under constant temperature and humidity.

[0096] 1) Purchase 5-week-old female C57BL / 6J mice and acclimate them to the feeding environment for one week.

[0097] 2) Transfer the well-growing stably transfected MC38 cells to several 10 cm culture dishes, digest them with trypsin after they have grown completely, count them, resuspend the cells in PBS, and adjust the cell population to 1×10 8 / mL, keep on ice until use.

[0098] 3) C57BL / 6J mice were randomly divided into a control group and an experimental group, with 10 mice in each group, of which 5 mice were used to record the growth curves of the mice and the other 5 mice were used to monitor the survival status of the mice.

[0099] 4) After the distribution, the back skin of the mouse was disinfected with alcohol, and 100 μL of the homogenized cell suspension was aspirated and injected subcutaneously.

[0100] 5) When lumps begin to appear in the subcutaneous tissue, the longest axis (L) and shortest axis (W) of the tumor are measured weekly with a vernier caliper, and the tumor volume V = (L×W2)×0.5, and a tumor growth curve is drawn. The mice are fed until they show morbid characteristics, and then the mice are killed, and the dissected tumors are photographed and recorded. The tumor tissues are fixed with formalin, and hematoxylin-eosin staining (H&E) and Ki67 and CCL2 protein immunohistochemical analysis are performed in the company.

[0101] 6) For mice in the survival experiment, monitor the survival status of the mice for the next 60 days from the injection of tumor cells and draw a survival curve.

[0102] 5. Flow cytometry to detect changes in tumor immune microenvironment

[0103] 1) Tissue pretreatment: Take fresh tumor tissue, rinse with PBS, drain and weigh, put into 5 mL EP tube, add a little digestion solution, cut into minced meat in an ice bath, transfer to a centrifuge tube, and add digestion solution at a ratio of 50 mg / mL.

[0104] 2) Tissue dissociation: Place the centrifuge tube containing the tissue into a shaker and slowly digest at 37°C for 15 to 30 minutes. Check the dissociation status every 15 minutes to avoid over-digestion.

[0105] 3) Transfer and filtration: Filter the digestion solution through a 40 μm filter into a 50 mL centrifuge tube to obtain a single cell suspension.

[0106] 4) Lysis of red blood cells: Centrifuge at 350 g for 5 min, discard the supernatant, add an appropriate amount of red blood cell lysis buffer to the cell pellet, mix well and let stand at room temperature for 5 min, add PBS to wash twice and centrifuge.

[0107] 5) Antibody staining: Add PBS to resuspend the cells and transfer to a 1.5 mL EP tube. Add 2 μL of anti-mouse CD45-APC-Cy7 antibody, 2 μL of anti-mouse CD4-FITC antibody, and 2 μL of anti-mouse CD25-PE antibody to every 100 μL (106 cells) of the suspension and incubate in a refrigerator at 4°C away from light for 20 min.

[0108] 6) Washing and transfer: Add PBS to wash the cells, centrifuge at 300g for 5 minutes, repeat twice, and filter the cell suspension through a 300-mesh nylon mesh into a flow tube.

[0109] 7) On-machine detection: When performing flow cytometry for the first time, you need to prepare single-stained tubes for adjusting fluorescence compensation. After that, you need to prepare blank control tubes and sample tubes each time. Before the sample tube is put on the machine, add 5ul 7-AAD to stain for 5min and use BDLSRFortessa X20 for detection. First, circle the cells with FSC and SSC, then circle the live cells with 7-AAD, circle the immune cells with CD45, and finally circle the CD4 + CD25 + Set the Treg cell gate and detect the percentage of Treg cells in CD45 positive cells.

[0110] In summary, we deconvoluted the transcriptome data of colorectal cancer in European and Chinese populations to obtain the relative cell content, and then combined the genotype data for immunQTL analysis to identify genetic variations significantly associated with immune infiltration, and found that rs1360948 (G>A) had the most significant immunQTL effect value. Further combined with large-sample case-control studies and follow-up studies, it was found that compared with rs1360948[A] individuals, individuals carrying the [G] allele variant had a significantly increased risk of colorectal cancer and had a poor prognosis. Functionally, rs1360948[G] increases the expression of the target gene CCL2 by enhancing the specific binding of the region to the transcription factor PRDM1, promoting cancer cell proliferation, and ultimately leading to a poor prognosis in patients with colorectal cancer. For details of this pathogenic site screening process, see Figure 1 Therefore, individuals carrying rs1360948[G] can be considered as a high-risk group for colorectal cancer. The discovery of this risk genetic variation site is expected to be used clinically to assist in the early diagnosis of colorectal cancer patients and predict the survival outcomes of colorectal cancer patients.

[0111] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of detection reagents for the immune infiltration function genetic locus rs1360948, which is associated with colorectal cancer susceptibility and prognosis, in the preparation of a kit for screening high-risk populations for colorectal cancer and predicting the prognosis of colorectal cancer patients.

2. The use according to claim 1, characterized in that: The detection reagent comprises a specific amplification primer and a specific probe of the site rs1360948, wherein the sequences of the specific amplification primer are SEQ ID NO: 1 and SEQ ID NO: 2, and the sequences of the specific probe are SEQ ID NO: 3 and SEQ ID NO: 4.

Images