An abnormal Wickham yeast with aroma enhancement function and its application

Abstract

The invention discloses an abnormal Wickham yeast with a flavor enhancement function and its application in fermented food, belonging to the fields of fermentation engineering and biotechnology. The invention screens an abnormal Wickham yeast W23087 from sourdough, which is preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC No. 29669. The strain has a strong flavor enhancement function and excellent fermentation performance, can enhance the quality of fermented food and improve the flavor characteristics of fermented food, and has broad application prospects.

Description

Technical Field

[0001] The invention relates to an abnormal Wickham yeast with a flavor enhancement function and application thereof in fermented food, belonging to the fields of fermentation engineering and biotechnology. Background Art

[0002] Sourdough is a traditional starter obtained by mixing wheat flour and other cereal powder with water and then naturally fermenting with microorganisms such as yeast and lactic acid bacteria. The sourdough system is complex and consists of a rich microbial flora structure. During the fermentation process, yeast and lactic acid bacteria are the main fermentation microorganisms. Aroma yeast, also known as aroma yeast, can produce metabolic byproducts such as esters, higher alcohols and lower fatty acids during the fermentation process, which constitute a unique fermentation aroma. In recent years, aroma yeast has been widely used in fermented foods such as aged vinegar, fruit wine brewing, liquor flavoring, and condiment flavoring, and is closely related to the formation of the product's flavor. Among them, the mixed fermentation of aroma yeast and brewing yeast can not only increase the content of ester aroma substances in the fermented wine, but also ensure the high fermentation efficiency of the fermented wine.

[0003] Aroma yeast plays a vital role in improving food flavor, and the exploration of new aroma yeast has broad application prospects. Isolating and screening aroma yeast from food is a research trend. Ye Mengqi et al. separated and screened microorganisms in apple samples and fruit warehouse air, purified a strain of abnormal Vickers-Hansen yeast with the strongest ester production performance, and artificially inoculated it into apple cider for fermentation. The volatile aroma substances of apple cider changed significantly, and its content increased to 2 times the original. Shen Guanghui et al. screened out 5 aroma yeasts with high ester production and low alcohol production from liquor koji, of which 1 strain was abnormal Vickers-Hansen yeast and 4 strains were button capsule complex membrane yeast. Inoculating the strain abnormal Vickers-Hansen yeast Z133 into watermelon juice for fermentation helps to increase the types and contents of alcohol and ester aroma components in watermelon wine. Wang Xiaodan et al. isolated 40 yeast strains from the fermented grains of Maotai-flavor liquor, and screened out 2 flavor bacteria with the strongest alcohol production ability. After identification, it was determined that the two yeast strains were Candida vulgaris and Pichia pastoris, and they had strong ester production ability.

[0004] Patent CN109456904B discloses the saccharification power of abnormal Wickham yeast, which reaches 174U; Patent CN109266562B discloses abnormal Wickham yeast with high ester production (especially ethyl acetate), and the ethyl acetate production reaches 17.31g / L; Patents CN105861346B, CN114134055B, etc. disclose the flavor production ability of abnormal Wickham yeast, such as high production of phenylethanol and low production of urea. However, the abnormal Wickham yeast disclosed in the existing patents has the problem of relatively single function and insufficient performance. Therefore, providing a strain of abnormal Wickham yeast with multiple performances and outstanding performance at the same time has extremely high practical value and can further broaden the application field of abnormal Wickham yeast. Summary of the invention

[0005] In order to solve the above technical problems, the present invention screened out an abnormal Wickham yeast W23087 from sourdough and preserved it in the China General Microbiological Culture Collection Center with a preservation number of CGMCC No.29669. The strain has a strong flavor enhancement function and excellent fermentation performance, can enhance the quality of fermented food and improve the flavor characteristics of fermented food, and has broad application prospects.

[0006] The abnormal Wickerhamomyces anomalus W23087 of the present invention is a yeast strain with excellent fermentation performance, obvious flavor enhancement function or high ester production, which solves the problems of uneven fermentation performance and unstable flavor substances in fermented flour products, wine, beverages, condiments and feed products; the abnormal Wickerhamomyces anomalus W23087 has the following advantages:

[0007] (1) High ester production capacity. The abnormal Wickham yeast W23087 of the present invention was fermented in YPD medium for 12 hours, and the total ester production reached (19.25±0.35) g / L;

[0008] (2) High saccharification capacity. The saccharification capacity of the abnormal Wickham yeast W23087 of the present invention is 821.8U;

[0009] (3) Excellent flavor production ability. The abnormal Wickham yeast W23087 of the present invention has the ability to produce high amounts of ethyl acetate and phenylethanol in the preparation of flour products, wine, fermented fruit juice, condiments and feed, and the effect is more than 20% higher than that of the existing abnormal Wickham yeast and commercially available bacterial agents.

[0010] The first object of the present invention is to provide an abnormal Wickerham yeast (Wickerhamomycesanomalus) W23087, which has been deposited in the Institute of Microbiology, Chinese Academy of Sciences on January 18, 2024, with a deposit number of CGMCC No.29669.

[0011] In one embodiment, the colony morphology of the abnormal Wickham yeast is milky white, 1.0-2.0 mm in diameter, spherical, with protrusions, smooth surface, neat edges, and opaque. Under an optical microscope, the strain cells are spherical or ellipsoidal, with obvious conidia around them.

[0012] The present invention also provides a microbial preparation, which contains the abnormal Wickham yeast W23087, its metabolites or fermentation liquid.

[0013] In one embodiment, the microbial preparation is in the form of a solid preparation or a liquid preparation.

[0014] In one embodiment, the number of abnormal Wickham yeast per gram or per milliliter of the microbial preparation is not less than 1.0×10 8 CFU.

[0015] In one embodiment, the microbial preparation contains living cells or freeze-dried dry bacteria or immobilized cells of the above-mentioned Wickham's yeast W23087, or a strain containing Wickham's yeast W23087 in any other form.

[0016] In one embodiment, the preparation of the microbial agent is as follows: two loops of activated abnormal Wickham yeast W23087 are picked with an inoculation loop and inoculated into YPD medium, cultured in a shaker at 28.0°C and 200.0g for 20.0h, then enriched and cultured under the same conditions, centrifuged at high speed for 15.0min, washed twice with sterile water after taking the precipitate, washed with sterile distilled water and prepared into a yeast suspension for standby use. Add trehalose as a protective agent, first prepare a trehalose solution of 1.5 to 2.0 times the required concentration, sterilize at 121°C for 20.0min, and then mix with an equal volume of the yeast suspension. Place the bacterial suspension in a -80°C ultra-low temperature refrigerator for pre-freezing for 3.0h, then transfer it to a freeze dryer for freeze drying, and store the freeze-dried powder at -20°C.

[0017] The invention also provides a microbial bran, wherein the microbial preparation contains the abnormal Wickham yeast W23087 or its metabolites.

[0018] In one embodiment, the microbial preparation is in the form of a solid preparation.

[0019] In one embodiment, the number of abnormal Wickham yeast per gram or per milliliter of the microbial preparation is not less than 1.0×10 8 CFU.

[0020] In one embodiment, the microbial bran contains living cells of the above-mentioned abnormal Wickham yeast W23087 or dry bacteria obtained by freeze-drying or immobilized cells, or a strain containing abnormal Wickham yeast W23087 in any other form.

[0021] In one embodiment, the preparation of the microbial bran is as follows: Activate the abnormal Wickham yeast W23087 into a certain concentration of bacterial liquid for standby use. Weigh 20g of bran, add 20mL of distilled water and stir evenly, shake the triangular flask to mix the material and water evenly, sterilize at 121°C for 40min, cool in a sterile room and shake the material blocks, then inoculate 5‰ to 10% of the abnormal Wickham yeast W23087 into the shaking flask; shake them one by one after inoculation to mix evenly, culture at a constant temperature of 28.0°C in an incubator, and after mycelium grows for about 18h, shake the flask for the first time to loosen the lumps, shake evenly and spread them on the bottom of the flask and continue to culture; culture for another 5h to 6h until the material caking is obvious, then culture the flask for 72h to make the upper and lower parts of the bacteria grow uniformly. When capping the bottle, be gentle and put it down with care to prevent the koji cake from breaking; after capping the bottle, continue to culture for about 36 hours, place the conical bottle horizontally to facilitate water storage, continue to culture at a constant temperature of 25-32℃, shake the bottle regularly to ensure that the part of the koji cake close to the bottle wall gets sufficient oxygen to facilitate the growth and reproduction of the strain; after the culture is completed, crush the koji cake in a sterile environment, and then pack it into sealed bags sterilized at 121℃ for 30 minutes, seal them, add the date of production, and store them in a refrigerator at 4℃ for later use.

[0022] The third object of the present invention is to provide the use of the abnormal Wickham yeast W23087 or any of the above microbial preparations in fermented flour products.

[0023] In one embodiment, the fermented food includes but is not limited to bread, steamed buns, etc.

[0024] In one embodiment, the application is for bread fermentation, using the abnormal Wickham yeast W23087 as a starter.

[0025] In one embodiment, the bread fermentation is performed by using the abnormal Wickham yeast W23087 and a commercially available abnormal Wickham yeast starter as starters, adding them to the dough in amounts of 0.25 mL to 3.0 mL and 0.05 g to 0.25 g, respectively, with high-gluten flour, sucrose, sodium chloride and drinking water as main raw materials, mixing them in a ratio of 10:0.6:0.2:0.6, and subjecting them to fermentation and baking processes.

[0026] In one embodiment, the application is for steamed bread fermentation, using the abnormal Wickham yeast W23087 as a starter.

[0027] In one embodiment, the steamed bread fermentation is to use the abnormal Wickham yeast W23087 and the commercially available abnormal Wickham yeast starter as starters, both of which are added to the dough in an amount of 1.0g, add 100.0g of wheat flour and 50.0mL of water in a dough mixer, first slowly stir for 3.0min and then quickly stir for 3.0min, divide into dough, knead until the surface is smooth, place in a proofing box at a temperature of 38.0°C and a relative humidity of 85% for proofing for 50.0-80.0min, steam for 20.0min, and simmer in a pot for 5.0min after turning off the heat.

[0028] The present invention also provides the use of the abnormal Wickham yeast W23087 or any of the above microorganisms in fermenting wine.

[0029] In one embodiment, the fermented food includes but is not limited to Xiaoqu wine and wine.

[0030] In one embodiment, the application is for Xiaoqu wine fermentation.

[0031] In one embodiment, the Xiaoqu wine fermentation is obtained by using the abnormal Wickham yeast W23087 as a starter, inoculating 1.0% w / w of the abnormal Wickham yeast W23087 bacterial agent, and soaking grains, initially steaming, steaming, re-steaming, cooling, fermenting and distilling wine.

[0032] In one embodiment, the use is for wine fermentation.

[0033] In one embodiment, the Xiaoqu wine fermentation is performed by using the abnormal Wickham yeast W23087 and commercial yeast as fermentation agents, with an inoculation amount of 5.0% each, selecting fully ripe grape fruits, crushing them into a tank, the raw materials cannot exceed 3 / 4 of the container, adding 30.0 mg / L of sulfur dioxide, adding 0.02 g / L of pectinase, and cold soaking for 48.0 hours to obtain the wine.

[0034] The present invention also provides the use of the abnormal Wickham yeast W23087 or any of the above microbial preparations in fermented beverages.

[0035] In one embodiment, the fermented beverage includes but is not limited to mango juice, apple cider vinegar, etc.

[0036] In one embodiment, the application is for mango juice fermentation.

[0037] In one embodiment, the mango juice fermentation is performed by using the abnormal Wickham yeast W23087 as a fermentation agent, inoculating abnormal Wickham yeast W23087 bacteria agent and commercially available abnormal Wickham yeast fermentation agent at an inoculation rate of 4.0%, fermenting at 25.0°C to 30.0°C for 24.0h to 48.0h, and then filling after pasteurization to obtain the mango juice.

[0038] In one embodiment, the application is for apple cider vinegar fermentation.

[0039] In one embodiment, the apple cider vinegar fermentation is to use the abnormal Wickham yeast W23087 as a fermentation agent, inoculate acetic acid bacteria after the alcohol fermentation is completed to perform acetic acid fermentation, and then centrifuge to obtain the supernatant and pasteurize to obtain the finished apple cider vinegar product.

[0040] The present invention also provides the use of the abnormal Wickham yeast W23087 or any of the above microorganisms in fermented seasonings.

[0041] In one embodiment, the fermented beverage includes but is not limited to sweet bean paste and soy sauce.

[0042] In one embodiment, the application is to use the abnormal Wickham yeast W23087 as a fermentation agent for sweet noodle sauce fermentation, inoculate 2.0% to 5.0% w / w abnormal Wickham yeast W23087 bacterial agent and commercially available abnormal Wickham yeast fermentation agent into steamed flour, and obtain the sweet noodle sauce product after primary fermentation and secondary fermentation in a ventilated environment.

[0043] In one embodiment, the application is to use the abnormal Wickham yeast W23087 as a fermentation agent for soy sauce fermentation, soak the soy sauce in warm water at a ratio of 1:2 for 5.0 hours, then steam and cook, add abnormal Wickham yeast W23087 bran at a ratio of 5.0% after cooling, and then add salt water of about 1.5 to 2.5 times the mass of the material, so that the final water content of the soy sauce is about 45 to 55%, and after the fermentation of the soy sauce is completed, the soy sauce is poured, squeezed, the soy sauce is removed, filtered and sterilized.

[0044] The present invention also provides the use of the abnormal Wickham yeast W23087 or any of the above microorganisms in fermented feed.

[0045] In one embodiment, the fermented beverage includes but is not limited to feed and the like.

[0046] In one embodiment, the application is to use feed fermentation by using the abnormal Wickham yeast W23087 as a starter, inoculating abnormal Wickham yeast W23087 bran at a ratio of 10% w / w, stirring evenly, and naturally fermenting.

[0047] Beneficial Effects

[0048] The invention screens out an abnormal Wickham yeast W23087 from sourdough, and preserves it in the China General Microbiological Culture Collection Center with a preservation number of CGMCC No.29669. The strain has a strong flavor enhancement function and excellent fermentation performance, can enhance the quality of fermented food, and improve the flavor characteristics of fermented food, and has broad application prospects.

[0049] Specific:

[0050] (1) The present invention provides an abnormal Wickham yeast strain W23087, which has a high OD value of the bacterial liquid after cultivation, and has a good growth condition within a certain temperature range, which is suitable for the different temperature requirements of fermentation products.

[0051] (2) The present invention provides an abnormal Wickham yeast W23087 with a flavor enhancement function. After being cultured at 28°C for 12.0 hours, the total ester content reaches a maximum of (19.25±0.35) g / L, and the saccharification power is 821.8 U, which can enhance the flavor characteristics of the fermented product.

[0052] (3) The abnormal Wickham yeast W23087 with high ester production provided by the present invention was used to ferment bread and steamed buns. The content of ethyl acetate and phenylethanol in the bread was increased by 190% compared with the control group; the total content of volatile flavor substances in the steamed buns was 82.3% higher than that in the control group, so the steamed buns had a pleasant aroma.

[0053] (4) The ester-producing abnormal Wickham yeast W23087 provided by the present invention was used to ferment Xiaoqu wine and wine. The content of total ester and ethyl acetate in the abnormal Wickham yeast W23087 Xiaoqu wine was high, which was 36.8% and 86.9% higher respectively. The total amount of volatile flavor substances in the abnormal Wickham yeast W23087 wine was 23% higher than that of the control group, and the fruity aroma was more intense.

[0054] (5) The ester-producing abnormal Wickham yeast W23087 provided by the present invention was used to ferment mango juice and apple cider vinegar. The total sugar content of mango juice was 21.3% lower than that of the control group, indicating that W23087 has a higher utilization rate of sugar and a stronger fermentation ability. The total volatile aroma component content was 27.8% higher than that of the control group, much higher than that of other mango juices made with the same type of yeast. The content of phenylacetaldehyde and other volatile flavor substances in apple cider vinegar was significantly higher than that of the control group by more than 35.1%, making the apple cider vinegar rich in fruit flavor and sweet and sour.

[0055] (6) The ester-producing abnormal Wickham yeast W23087 provided by the present invention is used to ferment sweet noodle sauce. The total content of volatile flavor substances in the sweet noodle sauce is 24.5% higher than that in the control group, making the sweet noodle sauce sweet and mellow in taste.

[0056] (7) The ester-producing abnormal Wickham yeast W23087 provided by the present invention is used to ferment feed. The obtained fermented feed has a special aroma and is rich in nutrition. The volatile phenylethanol content is 0.31 μg / L, the ethanol content is 0.28 μg / L, the acetic acid content is 0.15 μg / L, and the total volatile flavor substances are 23.4% higher than that of the control group.

[0057] Biological deposit materials

[0058] The abnormal Wickerhamomyces anomalus provided by the present invention is classified and named as abnormal Wickerhamomyces anomalus W23087, which has been deposited in the China General Microbiological Culture Collection Center on January 18, 2024, with a deposit number of CGMCC No. 29669, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 It is the Gram staining picture of abnormal Wickham yeast W23087 of the present invention.

[0060] Figure 2 It is a growth curve diagram of abnormal Wickham yeast W23087 of the present invention.

[0061] Figure 3 It is a fermentation power curve diagram of abnormal Wickham yeast W23087 of the present invention.

[0062] Figure 4 This is a curve diagram of ester production by abnormal Wickham yeast W23087 of the present invention.

[0063] Figure 5 This is the flavor radar diagram of the abnormal Wickham yeast W23087 of the present invention DETAILED DESCRIPTION

[0064] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0065] Detection of physical and chemical indicators of fermented food: pH value determination is determined in accordance with the method of GB 5009.237-2016. The total colony count is determined in accordance with the method of GB 4789.2-2022 National Food Safety Standard Food Microbiology Test Total Colony Count Determination. Organic acid content is determined by high performance liquid chromatography (HPLC). The texture of fermentation is determined by texture analyzer. Physical and chemical indicators such as total acid (measured in tartaric acid), volatile acid (measured in acetic acid), total sugar (measured in glucose), alcohol content, total SO2, free SO2 and pH value in wine are determined in accordance with the method of GB / T15038-2006 General Analysis Method for Wine and Fruit Wine. The physical and chemical indicators of apple cider vinegar are determined in accordance with GB / T 30884-2014 Apple Cider Vinegar Beverage. Volatile flavor substances are determined by gas chromatography-mass spectrometry (GC-MS).

[0066] Experimental raw materials

[0067] Sourdough was purchased from Dezhou, Shandong;

[0068] Abnormal Wickham yeast YF1503, with the accession number of CGMCC No.1416, was purchased from China General Microbiological Culture Collection Center.

[0069] Example 1: Isolation and Identification of Abnormal Wickham Yeast W23087

[0070] 1. Separation and purification

[0071] Weigh 5.0 g of sourdough sample and add it to 45.0 mL of sterile saline (0.85%, w / v). Vortex until the sample is evenly suspended. Take 1.0 mL of the suspension and dilute it 10-fold to 10. -1 ~10 -7 . Use a sterilized pipette tip to draw 100.0μL of the dilution solution and apply it to the YPD plate culture medium. After culturing in a shaker incubator at 28.0℃ for 48.0h, carefully observe the colony morphology and pick out single colonies with good growth. Inoculate the picked single colony into liquid YPD culture medium, culture it at 28.0℃ for 24.0h, and then streak it on solid YPD culture medium to observe its colony purity. Repeat this process three times until there are no foreign bacteria under microscopic examination. The strain with obvious spores was preliminarily identified as yeast through microscopic examination. After culturing the final single colony in YPD liquid culture medium for 48h, it was divided into packages, added to sterilized 25.0% v / v glycerol protective agent and stored at -80.0℃.

[0072] 2. Morphological characteristics of abnormal Wickham yeast W23087

[0073] Streak the strain on a YPD solid plate and culture it at 28.0℃ for 24.0h. Observe the colony morphology of the aroma-producing yeast strain and take photos. When observing its cell morphology under a microscope, dilute 1.0mL of the bacterial solution appropriately, take 1 drop on a glass slide, and place it on the stage of an optical microscope for microscopic examination. Perform a preliminary classification based on the colony morphology and cell morphology of the strain.

[0074] On the YPD plate, cultured at 28.0℃ for 24.0h, the colonies of aroma yeast W23087 were milky white, 1.0-2.0mm in diameter, spherical, with protrusions, smooth surface, neat edges, and opaque. Observed under an optical microscope, Figure 1 As shown, the cells of this strain are spherical or ellipsoidal, surrounded by obvious conidia, which can be clearly seen to be in line with the typical characteristics of yeast. Therefore, W23087 was preliminarily determined to be a yeast.

[0075] 3. Strain identification

[0076] A DNA extraction kit (purchased from Qingdao Haibo Biological, model HBIG11) was used to extract yeast genomic DNA, and its OD value (A260) and concentration were determined. The qualified purity samples were diluted to about 100 ng / μL for PCR amplification.

[0077] ITS rDNA universal primers were: ITS1 (5′-TCCTCCGCTTATTGATATGC-3′SEQ ID NO. 1), ITS4 (5′-TCCGTAGGTGAACCTGCGG-3′SEQ ID NO. 2);

[0078] The PCR amplification system (50 μL) was: 25 μL 2×Phanta Max Buffer, 0.5 μL 10 mM dNTP Mix, 0.5 μL upstream primer (10 μM) and downstream primer (10.0 μM), 0.4 μL high-fidelity DNA polymerase, 5.0 μL template DNA, and sterile water to a total volume of 50.0 μL; the PCR amplification program was: pre-denaturation at 95.0°C for 3.0 min, denaturation at 95.0°C for 15.0 s, annealing at 58.0°C for 15.0 s, extension at 72.0°C for 90.0 s, 35 cycles, and complete extension at 72.0°C for 5.0 min.

[0079] After 1% agarose gel electrophoresis detection, the product was purified with a product purification kit, and the purified amplified product was sent to the company for sequencing. The obtained sequencing results were compared with the NCBI database for homology analysis to find the sequence of the closest known species. The homology of 99% or more can directly identify the strain to be tested to the species. By constructing a phylogenetic tree, the yeast was identified as abnormal Wickham yeast and named abnormal Wickham yeast W23087.

[0080] 4. Determination of total ester content of abnormal Wickham yeast W23087

[0081] The activated bacterial solution was inoculated at 2.0% v / v in 10 mL YPD liquid medium (bacterial concentration was 10 5 CFU / mL), cultured at 28.0℃ for 12.0h. The total ester content was determined by saponification reflux method. The strain culture was centrifuged to obtain 1.0mL of the fermentation supernatant, diluted with water to an appropriate concentration, and then an appropriate amount of phenolphthalein was added. It was titrated with 0.1mol / L NaOH until it turned slightly red, and then an excess of 0.1mol / L NaOH solution was added. The mixture was saponified and refluxed in a boiling water bath for 30min. After cooling to room temperature, it was immediately titrated with 0.1mol / L HCl solution until the red color just disappeared. The volume of HCl consumed was recorded, and each group was repeated 3 times. After determination, the total ester content of abnormal Wickham yeast W23087 cultured for 12.0h was (19.25±0.35)g / L.

[0082] 5. Strain preservation

[0083] The abnormal Wickerhamomyces W23087 strain was deposited in the China General Microbiological Culture Collection Center on January 18, 2024, with a deposit number of CGMCC No. 29669, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. The abnormal Wickerhamomyces ITS rDNA sequence provided by the present invention is shown in SEQ ID NO.3.

[0084] Example 2. Growth characteristics of abnormal Wickham yeast W23087

[0085] 1. Growth curve

[0086] The abnormal Wickham yeast W23087 strain preserved in glycerol in Example 1 was inoculated on YPD solid medium for activation, and then a single colony was picked and inoculated into 25.0 ml of liquid YPD medium for cultivation, and finally inoculated into 300.0 mL of YPD broth medium at a 2.0% inoculum (v / v), and placed in a 28°C constant temperature incubator for static cultivation for 48.0 h, with three groups of biological replicates. Samples were taken every 2.0 h to measure the pH value and the number of colonies was calculated by gradient dilution. The results are shown in FIG. Figure 2 As shown, the abnormal Wickham yeast W23087 entered the logarithmic growth phase at 20.0h-40.0h, and OD 620 The value increases rapidly, and then enters a stable period, and the number of viable bacteria reaches 10 9 CFU / mL and maintain dynamic equilibrium for a long time.

[0087] 2. Temperature curve

[0088] The activated Wickham yeast W23087 was inoculated into YPD liquid medium at a ratio of 2.0% (v / v), and cultured at 20.0℃, 24.0℃, 28.0℃, 32.0℃, and 36.0℃ for 12.0h. The blank YPD liquid medium was used as a control, and the OD620 value of the culture medium after fermentation was measured. The results showed that Wickham yeast W23087 could grow in all temperature ranges, and the OD value of the bacterial liquid was high within 24.0℃ to 32.0℃, indicating that the strain grew well within this temperature range, and its optimal growth temperature was 28℃.

[0089] 3. Fermentation capacity

[0090] Take 0.25g yeast, soak in 5.0mL warm water for 30.0min, 25.0g high-gluten flour, 1.0% w / w abnormal Wickham yeast W23087, 2.0% w / w sugar, 1.0% w / w sodium chloride, 50.0% w / w water, water temperature 40℃. Pour into a 250mL conical flask, cover with plastic wrap and pierce holes, weigh, place in a 35℃ proofing box for static culture, start timing, weigh every 20.0min, subtract the next weight from the previous weight to get the weight of CO2 lost within 20.0min. This test measures the CO2 weight loss from 0h to 5.0h. The greater the CO2 weight loss, the stronger the fermentation power of the baking powder. The results are as follows Figure 3 As shown, the CO2 overflow amount increased linearly from 0 to 4 hours, tended to be flat after 4 hours, and the maximum overflow amount was 0.63g.

[0091] Example 3: Determination of saccharification capacity of abnormal Wickham yeast W23087

[0092] 1. Preparation of Daqu

[0093] The activated abnormal Wickham yeast W23087 was inoculated into YPD liquid medium at a ratio of 2.0% (v / v) and cultured at 28°C for 48 hours to make the bacterial solution concentration reach 10 8 CFU / mL for later use. Add 2.0mL of the solution to 10g of wheat and inoculate it into the prepared wheat. Incubate it in an incubator at 28℃ and 80% humidity for 3 days, and dry it at 40℃ to obtain Daqu for later use.

[0094] 2. Preparation of crude enzyme solution:

[0095] Take 20.0 mL of the Daqu prepared above, add it to 40 mL of 0.1 mol / L (pH 4.5) acetic acid-sodium acetate buffer solution, place it at a low temperature of 4.0°C overnight, then filter the mixture with 4 layers of gauze, centrifuge the filtrate at 5000 r / min for 10.0 min, and the supernatant is the crude enzyme solution sample of abnormal Wickham yeast W23087.

[0096] 2. Determination of saccharification capacity

[0097] Refer to QB / T4257-2011 "General Analysis Method for Brewing Daqu" and make modifications. Add sodium acetate-acetic acid buffer and 1.0mL of 0.5% soluble starch solution to the test tube in turn. After preheating in a 40℃ water bath for 10.0min, add 5.0mL of appropriately diluted Daqu crude enzyme solution. After keeping warm in a water bath for 5.0min, add 1.0mL of 0.1mol / L H2SO4 to terminate the reaction. After the reaction is terminated, draw 2.0mL of the reaction solution and add 0.5mL of 0.5% dilute iodine solution for color development, and measure OD 620 Calculate the enzyme activity.

[0098] The results showed that the saccharification power of abnormal Wickham yeast W23087 was 821.8U.

[0099] Example 4: Analysis of aroma production characteristics of abnormal Wickham yeast W23087

[0100] 1. Ester production curve

[0101] The activated abnormal Wickham yeast W23087 bacterial solution was inoculated at a 2.0% (v / v) volume in 10.0 mL YPD liquid medium (bacterial concentration was 10 5 CFU / mL), cultured at 28.0℃ for 18h, and samples were taken every two hours to determine the total ester content.

[0102] The total ester content was determined by the saponification reflux method. The culture broth of the strain was centrifuged to obtain 1.0 mL of the fermentation supernatant, which was diluted with water to an appropriate concentration, and then an appropriate amount of phenolphthalein was added. It was titrated with 0.1 mol / L NaOH until it turned slightly red. Then an excess of 0.1 mol / L NaOH solution was added, and the mixture was saponified and refluxed in a boiling water bath for 30 min. After cooling to room temperature, it was immediately titrated with 0.1 mol / L HCl solution until the red color just disappeared. The volume of HCl consumed was recorded, and each group was repeated 3 times in parallel.

[0103] The results are as follows Figure 4As shown, the ester production of abnormal Wickham yeast W23087 tended to be stable from 6.0 hours. At 12 hours, the maximum ester production was (19.25±0.35) g / L, which was higher than the ester production disclosed in the prior art (CN109266562B; ester production 17.31 g / L).

[0104] 2. Analysis of volatile flavor substances

[0105] (1) Sample preparation

[0106] The activated abnormal Wickham yeast W23087 bacterial liquid was inoculated in 10.0 mL YPD liquid medium at a concentration of 2.0% (v / v), and cultured at 28.0° C. for 48 h to obtain a fermentation liquid;

[0107] Take 5.0mL of the fermentation broth supernatant into the headspace bottle, cover it tightly and mix it evenly. Use 50 / 30 / μmDVB / CAR / PDMS extraction head to extract the volatile flavor substances in the sample, the extraction time is 40.0min, the extraction temperature is 60.0℃, the thermal desorption time is 5.0min, and then GC-MS analysis is performed.

[0108] (2) GC conditions

[0109] The injection was carried out in splitless mode, the carrier gas was helium, the flow rate was 1.0 mL / min, the injection port temperature was 250°C, the capillary column was SH-Rtx-Wax column (30.0 m×0.25 mm, 0.25 μm), and the column oven temperature program was an initial temperature of 40°C, maintained for 1.0 min, then heated to 160°C at 6.0°C / min, and then heated to 250°C at 3.0°C / min, and retained for 5.0 min.

[0110] (3)MS conditions

[0111] The electron energy was 70.0 eV, the injection hole temperature was 250.0 °C, the emission current was 200.0 μA, the ion source temperature was 200.0 °C, the solvent delay time was 2.0 min, the detection method was full ion scanning, and the mass scanning range was m / z 33-495. Shimadzu software was used for flavor data collection and qualitative and quantitative analysis, and the compound comparison used the NIST11 database.

[0112] The results showed that there were 46 volatile flavor substances in the bacterial liquid of abnormal Wickham yeast W23087, including 14 alcohols, 12 esters, 5 acids, 5 ketones, 4 hydrocarbons, 2 phenols, 2 pyrazines and 2 pyrroles. The main flavor substances were alcohols and esters, and the total peak area of ​​the two accounted for more than 90% of the total flavor substances, that is, the total relative content of alcohols and esters was as high as more than 90%, among which the content of ethyl acetate was 230.0μg / L, the content of isoamyl acetate was 94.0μg / L, the content of phenylethanol was 50.5μg / L, the content of ethanol was 26.8μg / L, and the content of acetic acid was 13.87μg / L.

[0113] 3. Electronic nose analyzes its aroma characteristics

[0114] The chromatographic program was as follows: the initial temperature was 60°C, increased to 80°C at 1.0°C / s, then increased to 250°C at 2.0°C / s and maintained for 60s. Helium was used as the carrier gas with a flow rate of 1.0 mL / min, and the detector temperature was 260°C.

[0115] Figure 5 The odor radar diagram of abnormal Wickham yeast W23087 is shown in FIG. Figure 5 As shown in Table 1.

[0116] Table 1 Sensors corresponding to sensitive material types

[0117] Serial number Sensor Name Sensitive substance type 1 LY2 / LG Chlorine, fluorine, nitrogen oxides, sulfides 2 LY2 / G Ammonia, amine compounds, nitrogen oxides 3 LY2 / AA Ethanol, acetone, ammonia 4 LY2 / GH Ethanol, acetone, ammonia 5 LY2 / gCTL Sulfide 6 LY2 / gCT Propane, Butane 7 T30 / 1 Polar compounds, hydrogen chloride 8 P10 / 1 Non-polar; hydrocarbons, ammonia, chlorine 9 P10 / 2 Non-polar; methane, ethane 10 P40 / 1 Fluorine, Chlorine 11 T70 / 2 Toluene, xylene, carbon monoxide 12 PA / 2 Ethanol, ammonia, amine compounds

[0118] The results show:

[0119] Table 1 lists the 12 sensors corresponding to the sensitive material types, combined with Figure 1 It can be seen that the sensors T30 / 1, P10 / 1, P10 / 2, P40 / 1, T70 / 2 and PA / 2 are sensitive to polar substances, non-polar substances (hydrocarbons, ammonia, chlorine), aromatic substances (toluene, xylene), alcohols, amines and chlorine, indicating that the samples are significantly different in terms of the above substances. The remaining sensors are sensitive to nitrogen oxides, sulfides, acetone, propane and butane, indicating that the samples are not significantly different in terms of the above substances.

[0120] Example 5: Preparation of Abnormal Wickham Yeast W23087 Inoculant

[0121] 1. Enrichment culture

[0122] The activated abnormal Wickham yeast W23087 was inoculated into YPD medium by picking two loops with an inoculation loop, and cultured in a shaker at 28°C and 200.0 rpm for 20.0 h; 100.0 μL of the culture solution was transferred into YPD fermentation medium, and cultured for a second time in a shaker at 28°C and 200 g for 48.0 h.

[0123] 2. Centrifugal washing

[0124] The fermentation liquid of abnormal Wickham yeast W23087 obtained by enrichment culture was poured into a centrifuge tube, centrifuged at 3000r / min for 15.0min, the supernatant was poured out and washed twice with sterile water, the obtained precipitate was washed with sterile distilled water and prepared into a yeast suspension for later use.

[0125] 3. Add freeze-drying protective agent

[0126] Trehalose was selected as a protective agent. A 10% v / v trehalose solution was first prepared, sterilized at 121°C for 20.0 min, and then mixed with an equal volume of the yeast suspension.

[0127] 4. Freeze-drying

[0128] The yeast suspension with trehalose protective agent added was mixed evenly and poured into the plate. The plate was sealed with plastic wrap and quickly placed in a -80℃ ultra-low temperature refrigerator for pre-freezing for 3.0 hours. The pre-frozen plate was quickly transferred to a freeze dryer for freeze drying. The freeze-dried plate was quickly transferred to an ultra-clean workbench and sealed with plastic wrap and sealing film. The freeze-dried powder was stored at -20℃. The number of viable bacteria of abnormal Wickham yeast W23087 in the freeze-dried powder was not less than 1×10 8 CFU / mL.

[0129] Example 6: Preparation of abnormal Wickham yeast W23087 bran

[0130] Take the abnormal Wickham yeast W23087 bacterial solution and adjust the concentration to 1×10 6 CFU / mL, used for bran culture.

[0131] (1) Weigh 20 g of bran, add 20 mL of distilled water and stir evenly, shake the flask to mix the material and water evenly, sterilize at 121° C. for 40 min, cool in a sterile room and shake to disperse the material blocks, then inoculate 5% v / v of abnormal Wickham yeast W23087 into the shake flask;

[0132] (2) After inoculation, shake each bottle to mix evenly, and culture at a constant temperature of 28.0°C in an incubator. After mycelium grows for about 18 hours, shake the bottle for the first time to loosen the clumps, shake it evenly, and spread it on the bottom of the bottle before continuing to culture;

[0133] (3) Cultivate for another 5 hours until the material cakes are obvious, then close the bottle and cultivate for 72 hours to make the growth of the upper and lower parts of the bacteria uniform. Be gentle when closing the bottle to prevent the cake from breaking;

[0134] (4) After the bottle is closed, continue to culture for about 36 hours. Place the conical bottle horizontally to facilitate water storage. Continue to culture at a constant temperature of 28°C. Shake the bottle regularly to ensure that the part of the koji cake close to the bottle wall receives sufficient oxygen to facilitate the growth and reproduction of the strain.

[0135] (5) After the culture is completed, the koji cake is crushed under a sterile environment, and then packaged into sealed bags sterilized at 121°C for 30 minutes, sealed, and marked with the date of production, and stored in a refrigerator at 4°C for later use.

[0136] The yeast spores prepared by the above method are on the order of 10 15 CFU / g of pure bran koji.

[0137] Example 7: Application of abnormal Wickham yeast W23087 in fermented bread

[0138] Dough fermentation and bread preparation method: high-gluten flour, sucrose, sodium chloride and drinking water are used as the main raw materials, and mixed in a ratio of 10:0.6:0.2:0.6 by mass. 0.25g of the abnormal Wickham yeast W23087 bacterial agent prepared in Example 5 and 0.25g of commercial fermentation agent (Angel Yeast) are taken, soaked in warm water for 30.0min, and the dough is made and placed in a 35.0℃ proofing box for 3.0h. After the fermentation is completed, the dough is baked in an oven at 190.0℃ on the upper fire and 200.0℃ on the lower fire for 25.0min. After the baking is completed, the bread is placed at 25.0℃ for equilibrium and sealed for further analysis.

[0139] The control group CK was added with the same amount of abnormal Wickham yeast YF1503 (whose deposit number is CGMCC No.1416) and commercial starter (Angel Yeast) as the experimental group. The fermentation capacity was measured by CO2 weight loss meter method with reference to Example 2; the bread texture characteristics were measured by texture analyzer; and the volatile flavor substances in bread were measured with reference to Example 4.

[0140] After measurement, the physical and chemical indicators of the experimental group were normal, the fermentation capacity of the experimental group was 2.2g, and the fermentation capacity of the control group was 1.6g, indicating that the abnormal Wickham yeast W23087 has a strong fermentation capacity. The determination of volatile flavor substances showed that the main flavor substances were alcohols and esters. The contents of ethyl acetate and phenylethanol were 2.33μg / L and 2.15μg / L, respectively, the content of isopentyl acetate was 0.24μg / L, and the content of ethanol was 0.15μg / L. Ethyl acetate and phenylethanol contributed more to the overall flavor of bread, with a relative content of more than 91.9%, which was more than 190% higher than the ethyl acetate content of 0.76μg / L and phenylethanol content of 0.74μg / L in the control group.

[0141] Example 8: Application of abnormal Wickham yeast W23087 in fermenting steamed bread

[0142] 100.0 g of wheat flour, 1.0 g of the abnormal Wickham yeast W23087 bacterial agent prepared in Example 5, 1.0 g of a commercially available starter (Angel Yeast), and 50.0 mL of water were placed in a dough mixer, first slowly stirred for 3 min and then quickly stirred for 3.0 min, divided into dough, kneaded until the surface was smooth, placed in a proofing box at a temperature of 38.0 ° C and a relative humidity of 85.0% for 60.0 min, steamed for 20.0 min, and simmered in a pot for 5.0 min after stopping the fire. The steamed buns were taken out and placed at room temperature for 1.0 h as the sample to be tested, and the abnormal Wickham yeast YF1503 (whose preservation number is CGMCC No. 1416) and the commercial starter (Angel Yeast) were used as the control group.

[0143] The fermentation power was measured by the CO2 weight loss meter method in Example 2; the texture characteristics of steamed bread were measured by a texture analyzer; and the volatile flavor substances in steamed bread were measured by reference to Example 4. The texture results are shown in Table 2. Compared with the control group, the abnormal Wickham yeast W23087 has a stronger ability to utilize sugar, and produces 35.0% more gas than the control group during fermentation to expand the dough, making it have a lower hardness, a larger specific volume, a higher cohesion, and a lower chewiness, and a more suitable taste.

[0144] The volatile substances in the dough were detected according to the method of Example 4. The results showed that a total of 48 volatile compounds were found, including 13 alcohols, 15 aldehydes, 7 ketones, 6 acids, 6 esters and 1 other compound. The ethyl acetate content was 1.98 μg / L, the isopentyl acetate content was 1.43 μg / L, the ethanol content was 0.21 μg / L, and the total content of volatile substances was 82.3% higher than that of the control group. Therefore, the steamed bread had a pleasant aromatic smell.

[0145] Table 2 Texture characteristics of steamed bread fermented by abnormal Wickham yeast W23087

[0146] index Control group Abnormal Wickham yeast W23087 Hardness / g 356.44±12.54 321.104±13.45 elasticity 0.92±0.08 0.91±0.03 Resilience 0.35±0.03 0.34±0.02 Cohesion 0.73±0.02 1.43±0.03 Chewability 275.10±10.12 242.01±13.54

[0147] Example 9: Application of abnormal Wickham yeast W23087 in Xiaoqu liquor

[0148] Soak the washed rice in 80.0℃ warm water for 2.0h, so that the water content of the rice after soaking is 45.0%, and then steam it. After the steam comes up, pour the soaked rice into the steamer, cover it and steam it for 30.0min, so that the grain can expand and absorb water further when heated. After the initial steaming, flood the rice with water, and simmer the grain in 95℃ water for 2.0h to make the grain absorb water further. The grain is required to have no white heart. Steam the rice again with high heat, wait for the steam to come out of the grain surface, cover it and steam it again for 60.0min. The moisture content of the grain is required to reach 110%, the grain is soft and cooked, and it is soft when pinched by hand. Break the grain, cool it to about 30℃, add 1.0%w / w abnormal Wickham yeast W23087 bran prepared in Example 6 and mix it well, and cultivate and saccharify it at 30.0℃ for 24.0h until a sweet fragrance is smelled. First, a layer of preparation groove is placed at the bottom of the jar, and the sweet dregs that have been cultured and saccharified are poured into the jar and pressed tightly. Then, the preparation dregs are covered on the sweet dregs and pressed tightly. The fermentation jar is sealed with a plastic bag and placed in a 30°C incubator for fermentation for 7.0 days. A certain amount of tap water is added to the distilling pot, heated to steam, and then the fermented dregs are loaded into the distilling pot to make the dregs uniformly loose, adjust the firepower and condensation water speed, and ensure that the wine temperature is not too high. 1.0 kg of dregs is distilled into 150.0 mL. With abnormal Wickham yeast YF1503 (whose deposit number is CGMCC No.1416) as a control, the operation is the same as above. The alcohol content is measured with an alcohol meter and converted to the alcohol content at a temperature of 20°C. The determination of total ester content is the same as in Example 1. The determination of volatile flavor substances is the same as in Example 4.

[0149] The results are shown in Table 3. The physical and chemical indicators of abnormal Wickham yeast W23087 Xiaoqu liquor are normal. Compared with the control group, it has stronger high temperature resistance and ethanol fermentation ability, and the contents of total ester and ethyl acetate are high, which are 36.8% and 86.9% higher respectively. The contents of isoamyl acetate and phenylethanol are 85% and 15% higher than those of the control group. The high proportion of ethyl acetate will make the aroma more coordinated and the taste better.

[0150] Table 3 Abnormal Wickham yeast W23087 fermentation Xiaoqu liquor index

[0151] index Control group Abnormal Wickham yeast W23087 Alcohol content (%) 43 44 Ethyl acetate (g / L) 0.25 0.57 Isoamyl acetate (g / L) 0.20 0.37 Phenylethanol(g / L) 0.24 0.27 Total esters (g / L) 1.121 1.533

[0152] Example 10: Application of abnormal Wickham yeast W23087 in wine fermentation

[0153] Fully ripe grapes were selected and crushed into a tank. The raw material could not exceed 3 / 4 of the container. Example 5 Preparation of Abnormal Wickham Yeast W23087 Bacterial Agent and Commercial Starter (Angel Yeast) The inoculation amount was 5.0% w / w, the sulfur dioxide addition amount was 30.0 g / L, the pectinase addition amount was 0.02 g / L, and the cold soaking was 48.0 hours. Abnormal Wickham Yeast YF1503 (whose deposit number is CGMCC No.1416) and the commercial starter were used as the control group CK. During the fermentation process, the sugar content and specific gravity were measured every day, and the cap was pressed three times. When the sugar content dropped to 4.0 g / L and the specific gravity dropped to 0.8 g / mL, the fermentation was completed, and the juice was taken for clarification and bottle storage. The physical and chemical indicators such as total acid (calculated as tartaric acid), volatile acid (calculated as acetic acid), total sugar (calculated as glucose), alcohol content, total SO2, free SO2 and pH value in wine were determined using "GB / T15038-2006 General Analytical Method for Grape and Fruit Wine". The determination of volatile flavor substances was performed in the same manner as in Example 4.

[0154] The total sugar content of abnormal Wickham yeast W23087 wine was 23% lower than that of the control wine sample, indicating that abnormal Wickham yeast W23087 had a higher sugar utilization rate and a more thorough fermentation. The ethanol volume fraction in the fermentation liquid was 7.2% higher than that of the control group, and it had good alcohol tolerance. The total acid and volatile acid contents were 15% and 21% higher than those of the control group, making abnormal Wickham yeast W23087 produce a refreshing taste, and the other physical and chemical indicators were normal.

[0155] Among the volatile flavor substances, there are 11 alcohol aroma substances, 13 ester substances, and 5 other types of aroma compounds. The content of ethyl acetate is 0.23μg / L, the content of isoamyl acetate is 0.21μg / L, and the content of ethanol is 0.20μg / L. The content of ethyl acetate, isoamyl acetate, and ethanol in the control group is 0.18μg / L, 0.16μg / L, and 0.18μg / L. The total amount of volatile flavor substances is 23% higher than that of the control group, and the fruity aroma is more intense.

[0156] Example 11: Application of abnormal Wickham yeast W23087 in fermenting mango juice

[0157] Fresh mangoes were peeled and pitted, and then 40% (w / w) sterile water was added. The mango pulp was beaten with a wall breaking machine for 2.0 min. The mango pulp was divided into conical bottles according to the ratio of 20.0% mango pulp, 6.0% sucrose and 50.0% water. The mango pulp was blanched at 90.0°C for 15.0 min, and then taken out and placed in ice water for cooling. The abnormal Wickham yeast W23087 bacterial agent prepared in Example 5 and the commercial starter (Angel Yeast) were inoculated at an inoculum amount of 4.0% w / w, fermented at 28°C for 48h, and then pasteurized and filled to obtain the abnormal Wickham yeast YF1503 (whose deposit number is CGMCC No.1416) and the commercial starter (Angel Yeast) as the control group CK. The physical and chemical indicators such as total acid (calculated as tartaric acid), volatile acid (calculated as acetic acid), total sugar (calculated as glucose), total SO2, free SO2 and pH value in mango juice were determined using "GB / T15038-2006 General Analytical Method for Grape and Fruit Wine", and the determination of volatile flavor substances was the same as in Example 4.

[0158] The results showed that the total sugar content of mango juice produced by abnormal Wickham yeast W23087 was 21.3% lower than that of the control group, indicating that abnormal Wickham yeast W23087 had a higher utilization rate of sugar and stronger fermentation ability, and the other physical and chemical indicators were normal. The content of ethyl acetate, isoamyl acetate, phenylethanol and acetic acid in mango juice produced by abnormal Wickham yeast W23087 was 1.27μg / L, 1.38μg / L, 0.49μg / L and 0.44μg / L, respectively. The content of total volatile aroma components was 27.8% higher than that of the control group, which was much higher than that of mango juice produced by other yeasts of the same type, indicating that fermentation by abnormal Wickham yeast W23087 could effectively improve the flavor of mango juice.

[0159] Example 12: Application of abnormal Wickham yeast W23087 in fermentation of apple cider vinegar

[0160] Wash fresh apples and cut them into pieces, add the same mass of pH 4.0 citric acid solution and 0.1% v / v pectinase, soak for 10.0min and crush them into apple puree, enzymolysis at 40°C for 2h, inactivate the enzyme at 75°C for 10.0min, cool and squeeze the juice for later use. Adjust the initial sugar content of the original pulp to 15°Brix, inoculate 2%w / w abnormal Wickham yeast W23087 bacterial agent prepared in Example 5 and commercial fermentation agent for alcohol fermentation for 48.0h. After the alcohol fermentation is completed, inoculate acetic acid bacteria for acetic acid fermentation to obtain acetic acid fermentation liquid. Centrifuge for 10min in a high-speed centrifuge to take the supernatant and pasteurize for 20.0min to obtain the finished apple vinegar product, with abnormal Wickham yeast YF1503 (whose deposit number is CGMCC No.1416) and commercial fermentation agent as the control group CK. The physical and chemical indicators of abnormal Wickham yeast W23087 apple cider vinegar are determined in accordance with "GB / T 30884-2014 Apple Cider Vinegar Beverage".

[0161] The results showed that the physical and chemical indicators were normal. Among them, phenylacetaldehyde accounted for 21.2% of the total volatile flavor substances (floral flavor), ethyl isovalerate accounted for 20.1% (fruity flavor), phenylethyl acetate accounted for 10.9% (fruity flavor), and phenylethanol accounted for 9.6% (floral flavor). The content of these four flavor substances was significantly higher than that of the control group by 35.1% to 42.4%, making apple cider vinegar rich in fruit flavor and sweet and sour.

[0162] Example 13: Application of abnormal Wickham yeast W23087 in fermentation of sweet noodle sauce

[0163] The steamed flour was inoculated with 2.0% w / w of the abnormal Wickham yeast W23087 bacterial agent prepared in Example 5 and a commercial starter culture medium, respectively. After koji making for 2.0 days under a ventilated environment, 10.0% brine was added according to a brine: flour mass ratio of 1:1, and the mixture was evenly stirred and sealed. The flour was first fermented in an incubator at 20° C. for 5.0 days. After the fermentation was completed, the flour was placed in an incubator at 35.0° C. for secondary fermentation for 20.0 days to obtain a sweet noodle sauce product. The abnormal Wickham yeast YF1503 (whose accession number is CGMCC No. 1416) and the commercial starter culture medium were used as the control group CK.

[0164] Determination of organic acids: Chromatographic column: Agilent XDB-C18 (5μ, 250×4.6mm), mobile phase: 100% acetonitrile, 1.0% phosphoric acid aqueous solution (pH 2.8), flow rate 1.0 mL / min, injection volume 10.0 μL, UV detection wavelength 210.0 nm, column temperature 35.0°C.

[0165] The determination of volatile flavor substances was the same as in Example 4. The results showed that the acetic acid content in the abnormal Wickham yeast W23087 sweet noodle sauce was 27.0% higher than that in the control group. Acetic acid is obtained by oxidation of ethanol and has the effect of blending taste and flavor. A total of 47 volatile flavor substances were detected in the abnormal Wickham yeast W23087 sweet noodle sauce matrix, including 15 esters, 11 alcohols, 9 aldehydes, 6 acids, 2 phenols, 1 ketone, 1 hydrocarbon, 1 pyrazine, and 1 pyrrole. The ethyl acetate content was 1.41 μg / L, the isoamyl acetate content was 1.12 μg / L, the phenylethanol content was 0.45 μg / L, and the acetic acid content was 0.37 μg / L. The total content was 24.5% higher than that in the control group, making the sweet noodle sauce sweet and mellow in taste.

[0166] Example 14: Application of abnormal Wickham yeast W23087 bran in soy sauce fermentation

[0167] The abnormal Wickham yeast W23087 bran was prepared by the method in implementation case 6. The soy sauce brewing adopts a solid-state fermentation process, and the process flow is as follows: the soybeans are soaked in warm water at a ratio of 1:2 for 5.0 hours, and then steamed. After cooling, the abnormal Wickham yeast W23087 bran prepared in Example 6 is added at a ratio of 5.0%, and then about 1.5 times the mass of the material is added. The brine makes the final water content of the sauce mash about 50.0%, the salt content is about 5% w / v, and the pH is about 7.0; the fermentation of the sauce mash: the temperature of the early fermentation is controlled at about 40°C, and the duration is about 10 days. After the early fermentation is completed, an appropriate amount of concentrated brine is added to make the salt content of the sauce mash reach about 15.0%, and the temperature of the sauce mash is maintained at 30-32°C, and the fermentation is continued for 20 days. After the fermentation is completed, the sauce mash is poured, squeezed, the sauce mash is removed, filtered and sterilized. The experimental group was the fermentation group of bran koji with abnormal Wickham yeast W23087; the fermentation sample without inoculation was used as the control group.

[0168] The results showed that the ethyl acetate content in the fermentation group of abnormal Wickham yeast W23087 was 0.31μg / L, isoamyl acetate content was 0.24μg / L, phenylethanol content was 0.18μg / L, and acetic acid content was 0.16μg / L. The total content was 24.5% higher than that of the control group, making the soy sauce have a strong flavor.

[0169] Example 15: Abnormal Wickham yeast W23087 bran improves nutrient conversion rate in feed fermentation

[0170] The biological feed fermentation process is as follows: rice bran, straw and soybean meal are mixed evenly in a ratio of 1:1:2, and crushed to make a fermented product. Water is added at a material-water ratio of 1:0.5, and the abnormal Wickham yeast W23087 bran prepared in Example 5 is inoculated at a ratio of 10% w / w, stirred evenly, and naturally fermented at a fermentation temperature of 35.0°C and a fermentation time of 8 days. After the fermentation is completed, it is dried to a moisture content of less than 15.0%, and the biological fermented feed is obtained.

[0171] Analysis of the quality of the fermented feed showed that the fermented feed had a special aroma, was rich in nutrition, and had balanced amino acids. The content of organic acids, amino acids, and crude protein increased by 27.87%, 31.04%, and 36.13% compared with the control group. The content of phenylethanol was 0.31 μg / L, the content of ethanol was 0.28 μg / L, the content of acetic acid was 0.15 μg / L, and the total volatile flavor substances were 23.4% higher than those of the control group.

[0172] ITS rDNA sequence of Wickham's yeast W23087:

[0173] SEQ ID NO.3

[0174] CCTGCGGAAGGATCATTATAGTATTCTATTGCCAGCGCTTAATTGCGCGGCG

[0175] ATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGGTGA

[0176] GCCTGGCTTACTGCCCAAAGGTCTAAACACATTTTTTTTAATGTTAAAACCT

[0177] TTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTT

[0178] CAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGC

[0179] GATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCA

[0180] CATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTC

[0181] TCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTG

[0182] AAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGT

[0183] ATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAG

[0184] GCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGAC

[0185] TACCCGCTGAACTTAAGCATATC

Claims

1. An abnormal Wickham yeast ( Wickerhamomyces anomalus )W23087, characterized in that, The abnormal Wickham yeast was deposited in the China General Microbiological Culture Collection Center on January 18, 2024, with the deposit number CGMCC No.29669.

2. A microbial preparation, characterized in that: The microbial preparation contains the abnormal Wickham yeast W23087 according to claim 1 or the fermentation broth of abnormal Wickham yeast W23087.

3. The microbial preparation according to claim 2, characterized in that The number of abnormal Wickham yeast W23087 per gram or per milliliter of the microbial preparation is not less than 1×10 8 CFU.

4. The microbial preparation according to claim 2 or 3, characterized in that: The microbial preparation contains living cells, freeze-dried dry bacteria or immobilized cells of the abnormal Wickham yeast W23087 according to claim 1.

5. Use of the abnormal Wickham yeast W23087 according to claim 1 in fermented flour products, alcoholic beverages, fermented beverages, condiments or fermented feed.

6. The use according to claim 5, characterized in that: The flour product includes bread or steamed bread.

7. The use according to claim 5, characterized in that: The alcoholic beverages include Xiaoqu liquor or grape wine.

8. The use according to claim 5, characterized in that: The fermented beverage includes mango juice or apple cider vinegar.

9. The use according to claim 5, characterized in that: The condiments include sweet bean paste or soy sauce.

10. Use of the microbial preparation according to any one of claims 2 to 4 in fermented flour products, alcoholic beverages, fermented beverages, condiments or fermented feed.

11. The use according to claim 10, characterized in that: The flour product includes bread or steamed bread.

12. The use according to claim 10, characterized in that: The alcoholic beverages include Xiaoqu liquor or grape wine.

13. The use according to claim 10, characterized in that: The fermented beverage includes mango juice or apple cider vinegar.

14. The use according to claim 10, characterized in that: The condiments include sweet bean paste or soy sauce.

15. A method for enhancing the flavor of a fermented product, characterized in that: The method comprises adding the abnormal Wickham yeast W23087 of claim 1 or the microbial preparation of any one of claims 2 to 4 during the preparation of the fermented product; and the flavor is esters and alcohols.

Images