Application of tomato SGR1 gene in breeding low temperature tolerant tomatoes and method for breeding low temperature tolerant tomatoes

Abstract

The invention belongs to the technical field of genetic engineering and relates to tomato SGR1 The invention provides an application of a gene in cultivating low temperature resistant tomatoes and a method for cultivating low temperature resistant tomatoes. SGR1 Gene editing or tomato SGR1 Application of a gene editing agent in cultivating low temperature resistant tomatoes, the tomatoes SGR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. SGR1 Gene editing can produce tomatoes with stronger resistance to low temperatures. It is time-saving and efficient, and can be applied to the creation of materials and variety improvement of low-temperature-tolerant tomatoes.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to tomato SGR1 The invention relates to the application of genes in breeding cold-tolerant tomatoes and the method for breeding cold-tolerant tomatoes. Background Art

[0002] tomato( Solanum lycopersicum ) is the world's largest vegetable crop, originating from tropical and subtropical regions of South America. The optimum temperature for the entire growth period is 18~25℃, and it is extremely sensitive to low temperatures. Low temperatures can have adverse effects on tomato vegetative growth and fruit development at all stages, resulting in serious restrictions on its growth, development, yield and quality. In recent years, with the frequent occurrence of extreme climate phenomena around the world, low temperatures have become one of the bottlenecks restricting the development of tomato production. In the Yangtze River Basin of my country, the use of greenhouses, greenhouses and other protected facilities can alleviate the chilling and freezing damage of tomatoes in early spring and delayed autumn cultivation to a certain extent, but it requires a lot of investment and energy consumption, and the risk of being harmed by low temperatures is still very high. In addition, the selection of low-temperature resistant tomato varieties is also a solution, but the low-temperature resistant varieties available on the market and the resistance resources available in the breeding process are limited. Moreover, the current method of creating low-temperature resistant tomato materials is mainly to discover natural variation materials through field screening, and then transfer the target traits into the recipient material through hybridization. This process is highly random and unpredictable, and requires a large workload and screening time, and faces the risk of losing the target traits and introducing linkage drag. Therefore, obtaining low-temperature-resistant tomato resources through bio-breeding technology has important scientific significance and application value for off-season vegetable production and ensuring the year-round supply of vegetables. Summary of the invention

[0003] The object of the present invention is to provide a tomato SGR1 The invention discloses an application of a gene in cultivating low temperature resistant tomatoes and a method for cultivating low temperature resistant tomatoes. SGR1 Gene editing can obtain tomatoes with stronger low-temperature resistance, and it is time-saving and efficient. The present invention can be used for material creation and variety improvement of low-temperature resistant tomatoes.

[0004] The present invention provides a method for treating tomato SGR1 Gene editing or tomato SGR1 Application of a gene editing agent in cultivating low temperature resistant tomatoes, the tomatoes SGR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0005] The present invention also provides a method for treating tomato SGR1 Gene editing or tomato SGR1The use of a gene editing reagent in any one or more of ① to ⑥:

[0006] ①Inhibit the increase of MDA content in tomato leaves caused by low temperature stress;

[0007] ②Increase the proline content in tomato leaves under low temperature stress;

[0008] ③ Delay the decrease in water content of tomato leaves caused by low temperature stress;

[0009] ④Inhibit the ROS burst in tomato leaves caused by low temperature stress;

[0010] ⑤Inhibit the increase of catalase activity and peroxidase activity caused by low temperature stress;

[0011] ⑥ Improve the activity of antioxidant enzymes under low temperature stress; the antioxidant enzymes include CAT, SOD and POD.

[0012] Preferably, the gene editing comprises SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 Gene expression.

[0013] The present invention also provides a method for cultivating low-temperature resistant tomatoes, comprising the following steps:

[0014] Tomato SGR1 Gene editing was performed to obtain cold-tolerant tomatoes.

[0015] Preferably, the gene editing comprises SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 Gene expression.

[0016] Preferably, the gene editing comprises gene editing using the CRISPR / Cas9 system.

[0017] Preferably, the target sequence for gene editing using the CRISPR / Cas9 system includes tomato SGR1 Nucleotides 30-48 in exon 3 of the gene and tomato SGR1 The nucleotides 265 to 283 of the 4th exon region of the gene; the tomato SGR1 The sequence of nucleotides 30 to 48 in the third exon region of the gene is shown in SEQ ID NO.10; the tomato SGR1 The sequence of nucleotides 265 to 283 in the 4th exon region of the gene is shown in SEQ ID NO.11.

[0018] The present invention also provides a set of expression cassettes for cultivating low-temperature resistant tomatoes, the expression cassettes comprising an sgRNA01 expression cassette and an sgRNA02 expression cassette; the sgRNA01 expression cassette targets tomatoes SGR1 The 30th to 48th nucleotides of the 3rd exon region of the gene, the sgRNA02 expression cassette targets tomato SGR1 The nucleotides 265 to 283 of the 4th exon region of the gene; the tomato SGR1 The sequence of nucleotides 30 to 48 in the third exon region of the gene is shown in SEQ ID NO.10; the tomato SGR1 The sequence of nucleotides 265 to 283 in the 4th exon region of the gene is shown in SEQ ID NO.11.

[0019] The present invention also provides a plasmid for cultivating low-temperature-resistant tomatoes, wherein the plasmid comprises the expression cassette described in the above technical solution.

[0020] The present invention also provides a recombinant microbial strain for cultivating low-temperature-resistant tomatoes, wherein the recombinant microbial strain comprises the plasmid described in the above technical solution.

[0021] The present invention provides tomato SGR1 The application of genes in cultivating low-temperature resistant tomatoes. The present invention uses gene editing to improve the low-temperature resistant tomato germplasm resources. SGR1 Directed gene editing can produce tomatoes with stronger cold tolerance, with short time consumption and high efficiency. SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 The expression of the gene can delay the senescence of tomato leaves under low temperature stress, increase the content of lycopene, chlorophyll and β-carotene in tomatoes under low temperature stress, and improve the low temperature tolerance of tomato plants; inhibit the increase of MDA content in tomato leaves caused by low temperature stress, increase the proline content in tomato leaves under low temperature stress, delay the decrease of water content in tomato leaves caused by low temperature stress, inhibit the ROS outbreak in tomato leaves caused by low temperature stress, inhibit the increase of catalase activity and peroxidase activity caused by low temperature stress, and increase the activity of antioxidant enzymes under low temperature stress; make the damage to tomatoes under low temperature less, and improve the low temperature tolerance of tomatoes.

[0022] Biological deposit information

[0023] Tomato seeds ( Solanum lycopersicum L.) T069, deposited in China Center for Type Culture Collection, referred to as CCTCC, on August 5, 2024. The address is Wuhan University, Wuhan, China, and the deposit number is CCTCCNO: P202422. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The present invention provides SlSGR1 Gene structure and target site sequence analysis results of homozygous edited strains;

[0026] Figure 2 A diagram showing the analysis results of the genotype translation process of different edited plants provided by the present invention;

[0027] Figure 3 The wild-type plant T048 provided by the present invention and sgr1 Figure 1 shows the performance of mutant plants in the greenhouse during winter;

[0028] Figure 4 The low temperature stress provided by the present invention is sgr1 The results of the mutant and wild type T048; A is the phenotype of tomato seedlings on the 5th day of cold stress treatment, B is the MDA content, C is the proline content, and D is the relative water content;

[0029] Figure 5 The low temperature stress provided by the present invention is sgr1 The results of the mutant and wild type T069; A is the phenotype of tomato seedlings on the 5th day of cold stress treatment, B is the MDA content, C is the relative water content, and D is the proline content;

[0030] Figure 6 The present invention provides SlSGR1 The mutation of the gene causes the changes of H2O2 and O2 in T048 tomato material under low temperature stress - The results of the decrease in content and the increase in antioxidant enzyme activity; A is the DAB and NBT staining picture, B is the H2O2 and O2 - content graph, C is the antioxidant enzyme activity graph;

[0031] Figure 7 The present invention provides SlSGR1 The mutation of the gene causes the T069 tomato material to have H2O2 and O2 - The results of the decrease in content and the increase in antioxidant enzyme activity; A is the DAB and NBT staining picture, B is the H2O2 and O2 - The content graph is shown in Figure 2, and C is the antioxidant enzyme activity graph. DETAILED DESCRIPTION

[0032] The present invention provides a method for treating tomato SGR1 Gene editing or tomato SGR1 Application of a gene editing agent in cultivating low temperature resistant tomatoes, the tomatoes SGR1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1. STAY-GREEN1 , SGR1 ) is a key factor in chlorophyll degradation and organ senescence during plant growth and development. Its functional loss leads to the stay-green phenotype in green plants. However, for the tomato stay-green gene 1 ( Solanum lycopersicumSTAY-GREEN1, SlSGR1 ) research focuses on improving fruit quality. This invention first discovered SlSGR1 The gene plays a regulatory role in tomato low temperature stress. SlSGR1 Gene editing, specifically, SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 The expression of the gene can produce low-temperature tolerant tomatoes.

[0033] The present invention also provides a method for treating tomato SGR1 Gene editing or tomato SGR1 The use of a gene editing reagent in any one or more of ① to ⑥:

[0034] ①Inhibit the increase of MDA content in tomato leaves caused by low temperature stress;

[0035] ②Increase the proline content in tomato leaves under low temperature stress;

[0036] ③ Delay the decrease in water content of tomato leaves caused by low temperature stress;

[0037] ④Inhibit the ROS burst in tomato leaves caused by low temperature stress;

[0038] ⑤Inhibit the increase of catalase activity and peroxidase activity caused by low temperature stress;

[0039] ⑥ Improve the activity of antioxidant enzymes under low temperature stress; the antioxidant enzymes include CAT, SOD and POD.

[0040] In the present invention, the gene editing preferably includes SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 Gene expression. The present invention does not specifically limit the method of gene editing, and conventional gene editing methods may be used, such as using the CRISPR / Cas9 system for gene editing.

[0041] The present invention also provides a method for cultivating low-temperature resistant tomatoes, comprising the following steps:

[0042] Tomato SGR1 Gene editing was performed to obtain cold-tolerant tomatoes.

[0043] In the present invention, the gene editing includes SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 The present invention can obtain low-temperature tolerant tomatoes by constructing transgenic tomato plants with lost SlSGR1 protein function. In the present invention, the gene editing preferably includes gene editing using the CRISPR / Cas9 system. In the present invention, the target sequence for gene editing using the CRISPR / Cas9 system preferably includes tomato SGR1 Nucleotides 30-48 in exon 3 of the gene and tomato SGR1 The nucleotides 265 to 283 of the 4th exon region of the gene; the tomato SGR1 The sequence of nucleotides 30 to 48 in the third exon region of the gene is shown in SEQ ID NO.10; the tomato SGR1 The sequence of nucleotides 265 to 283 in the 4th exon region of the gene is shown in SEQ ID NO. 11. In the present invention, the tomato varieties preferably include tomato large-fruit material T048 and cherry-fruit material T069. Using the method of the present invention, four different types of edited low-temperature tolerant tomatoes were obtained, namely, tomato material T048 gene-edited strains sgr1- 4 # -10 , sgr1-12 # -1 and sgr1-22 # -12 and tomato material T069 gene-edited strain sgr1-7 # -7 . sgr1-4 # -10 The strain had a 564 bp sequence inversion between the two editing sites of sgRNA01 and sgRNA02; sgr1-12 # -1 The strain had an insertion of 1 A base at the sgRNA01 target site and a deletion of 4 bases at the sgRNA02 target site; sgr1-22 # -12A 26-base deletion occurred at the sgRNA01 target site, and an 11-base deletion occurred at the sgRNA02 target site; sgr1-7 # -7 A 552-bp deletion occurred between the two editing sites of sgRNA01 and sgRNA02. SGR1 Gene editing inhibits or reduces the activity of SGR1 protein in tomatoes or SGR1 The expression of genes was significantly increased, and the low temperature tolerance of the four tomato edited lines was significantly improved compared with the wild type.

[0044] The present invention also provides a set of expression cassettes for cultivating low-temperature resistant tomatoes, the expression cassettes comprising an sgRNA01 expression cassette and an sgRNA02 expression cassette; the sgRNA01 expression cassette targets tomatoes SGR1 The 30th to 48th nucleotides of the 3rd exon region of the gene, the sgRNA02 expression cassette targets tomato SGR1 The nucleotides 265 to 283 of the 4th exon region of the gene; the tomato SGR1 The sequence of nucleotides 30 to 48 in the third exon region of the gene is shown in SEQ ID NO.10; the tomato SGR1 The sequence of nucleotides 265 to 283 in the 4th exon region of the gene is shown in SEQ ID NO.11.

[0045] The present invention also provides a plasmid for cultivating low-temperature tolerant tomatoes, the plasmid comprising the expression cassette described in the above technical solution. The present invention has no special limitation on the construction method of the plasmid, and the plasmid can be constructed by a conventional recombinant vector construction method. In the present invention, the basic plasmid for constructing the plasmid preferably comprises a pKSE401 vector.

[0046] The present invention also provides a recombinant microbial strain for cultivating low-temperature resistant tomatoes, wherein the recombinant microbial strain comprises the plasmid described in the above technical solution. In the present invention, the host bacteria for constructing the recombinant microbial strain preferably comprises Escherichia coli or Agrobacterium.

[0047] To further illustrate the present invention, the tomato provided by the present invention is described below in conjunction with the accompanying drawings and embodiments. SGR1 The application of the gene in breeding low-temperature tolerant tomatoes and the method for breeding low-temperature tolerant tomatoes are described in detail, but they should not be understood as limiting the scope of protection of the present invention.

[0048] Tomato materials "T048" and "T069" are both excellent high-generation inbred lines with unlimited growth. "T048" large-fruit tomato pink fruit, average single fruit weight 164 g, no green shoulders, vigorous growth, strong fruiting ability. "T069" cherry tomato, pink fruit, soluble solids up to 9.72%, vigorous growth, strong fruiting ability. The article "Using CRISPR / Cas9 technology to create high lycopene tomato new materials" based on "T048" material has been published in "Acta Horticulturae Sinica" 2024 Issue 51 Volume 2. Tomato materials are planted in the Modern Agricultural Science and Technology Innovation Demonstration Garden of Sichuan Academy of Agricultural Sciences, with normal water and fertilizer management.

[0049] CRISPR / Cas9 system related vector pKSE401 and intermediate vector pCBC-DT1T2 were purchased from Addgene (https: / / www.addgene.org / ). Escherichia coli ) DH5α competent cells and Agrobacterium tumefaciens GV3101 competent cells were purchased from Chengdu Qingke Zixi Biotechnology Co., Ltd.

[0050] The present invention SlSGR1 The DNA sequence of the gene is shown in SEQ ID NO.1:

[0051] ATGGGAACTTTGACTACTTCTCTAGTGGTTCCATCTAAGCTCAACAATGAACAACAGAGCTCTATTTTTATACACAAAACTAGAAGGAAATGCAAGAAGAATCAATCCATAGTACCTGTGGCAAGGTTATTTGGACCAGCTATATTTGAAGCTTCAAAAT TGAAGGTACTTTTTTTGGGAGTTGATGAAGAAAAGCATCCAGGAAAGTTGCCAAGAACATATACACTGACTCATAGTGATATTACTTCTAAACTTACTTTGGCTATCTCCCAAACCATCAATAATTCTCAGTTGCAAGGTTGGTATAACAGACTTCAAAG AGATGAAGTTGTTGCAGAGTGGAAGAAAGTAAAAGGGAAGATGTCACTTCATGTCCATTGCCACATTAGTGGAGGCCATTTTATGTTAGACTTATTTGCTAGACTCAGAAACTACATCTTCTGCAAAGAACTCCCTGTGGTTCTCAAGGCTTTTGTTCATGGAGATGAGAATTTACTAAGGAATTATCCAGAGTTACAAGAAGCTTTAGTT TGGGTATATTTTCATTCAAACATTCAAGAATTCAACAAAGTAGAATGTTGGGGTCCACTCAGAGATGCAACTTCCCCCTCATCTTCTTCTGGTGGGGTAGGTGGGGTGAAGAGTACAAGTTTTACAAGCAATAGCAACAAAAAATGGGAATTACCAAAGCCTTGTGAAGAGGCTTGTGCCTGTTGCTTTCCC CCAGTGAGTGTTATGCCTT GGCTTTCTTCAAATCTTGATGGGGTAGGTGAGGAAAATGGGACCATCCAACAAGGCTTGCAAGAGCAGCAAAGTTGA, the underlined part is the target site sequence.

[0052] Example 1

[0053] tomato SlSGR1 Obtaining gene-edited strains.

[0054] (1) Target site design and CRISPR / Cas9 expression vector construction

[0055] The tomato stay-green gene was tagged with the plant genome editing target site online design software CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). SlSGR1(Gene_ID: Solyc08g080090) was used for target site design. Several target sites with predicted On-score scores greater than 0.5 and located in the CDS (Coding sequence) region were selected, and the selected target sites were compared with the tomato genome BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to exclude non-specific targets. The nucleotide sequence of the sgRNA01 target site is 5'-AGATGAAGTGTTGCAGAG-3' (SEQ ID NO.10), corresponding to nucleotides 321 to 339 in SEQ ID NO.1; the nucleotide sequence of the sgRNA02 target site is 5'-CCAGTGAGTGTTATGCCTT-3' (SEQ ID NO.11), corresponding to nucleotides 724 to 742 in SEQ ID NO.1, respectively, and the nucleotide sequence of the sgRNA02 target site is 5'-CCAGTGAGTGTTATGCCTT-3' (SEQ ID NO.11), corresponding to nucleotides 724 to 742 in SEQ ID NO.1, respectively. Bsa I endonuclease recognition sequence, and a PCR overlapping sequence was added to the 3' end to form the primer pair SGR1-target1-F (SEQ ID NO.2) and SGR1-target2-R (SEQ ID NO.3) (Table 1), which was synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.

[0056] Using the pCBC-DT1T2 intermediate vector as a template, PCR amplification was performed using PrimeSTAR HS DNA polymerase (TaKaRa, Dalian) and the SGR1-target1-F and SGR1-target2-R primer pairs. Bsa I enzyme digestion, and the digestion product is connected to the same Bsa The recombinant vector was transformed into E. coli DH5α competent cells by heat shock method. M13-F (SEQ ID NO.4) and SGR1-target2 (SEQ ID NO.5) primers (Table 1) were used for PCR positive clone detection, and the positive bacterial solution was sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for first-generation sequencing verification. The successfully constructed vector was named pKSE401- SGR1 The cells were transformed into Agrobacterium tumefaciens GV3101 competent cells by heat shock method. After positive verification, 85% glycerol was added and stored in a -80 ℃ refrigerator for later use.

[0057] Table 1 Primers used in the present invention

[0058]

[0059] (2) Agrobacterium-mediated genetic transformation of tomato

[0060] Tomato genetic transformation was carried out using the Agrobacterium-mediated cotyledon transformation method. Tomato seeds were sterilized with sodium hypochlorite solution and sown in 1 / 2MS medium. They were cultured at 25°C for 6-7 days under long-day conditions. When the cotyledons were fully expanded, the middle section of the cotyledons was spread on the pre-culture medium and cultured in the dark for 1 day. Agrobacterium containing the pKSE401-SGR1 plasmid was activated overnight, and the Agrobacterium infection solution was prepared. The OD was adjusted. 600 = 0.1, and after infecting the cotyledons for 20 min, the bacterial solution was aspirated and cultured in the dark for 2 d; then the cotyledons were transferred to the screening medium for culture, and the medium was replaced every 3 to 4 weeks for subculture; finally, the resistant adventitious buds were cut off and transferred to the rooting medium for rooting induction. When the tomato seedlings grew to about 10 cm, a small amount of leaves were taken for testing.

[0061] (3) Identification of transgenic positive plants and detection of target sites

[0062] The genomic DNA of the leaves of the transgenic plants to be tested was extracted by the CTAB method. The extracted genomic DNA was used as a template to amplify the Cas9 gene by PCR using Cas9-F (SEQ ID NO.6) and Cas9-R primers (SEQ ID NO.7) (Table 1) to identify the transgenic positive lines. Subsequently, the DNA of the positive transgenic lines was used as a template to amplify the genomic sequence containing two target sites using the DNA high-fidelity polymerase TransStart® FastPfu DNA Polymerase (Quanshijin, Beijing) and SGR1-Seqtarget-F (SEQ IDNO.8) and SGR1-Seqtarget-R (SEQ ID NO.9) primers (Table 1). The PCR product was sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for first-generation sequencing, and the sequencing results were analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ) and Geneious software. The results showed that the target gene was mutated using the CRISPR-Cas9 editing system using large-fruited tomato T048 and cherry tomato T069 as materials. SlSGR1 Directed editing was performed separately to obtain edited plants of different genotypes. The T0 generation gene-edited plants were self-pollinated for 2 generations to obtain T2 generation gene-edited plants. After testing, a total of 3 homozygous edited strains were obtained using tomato T048 as the material: sgr1-4 # -10 , sgr1-12 # -1 and sgr1-22 # -12 . sgr1-4 # -10The strain had a 564bp sequence inversion on the genome between the two editing sites of sgRNA01 and sgRNA02, corresponding to the sequence between nucleotides 329 to 733 of SEQ ID NO.1; sgr1- 12 # -1 The strain had an insertion of one A base at the sgRNA01 target site and a deletion of four bases at the sgRNA02 target site, corresponding to the insertion of one A base between nucleotides 336 and 337 and the deletion of nucleotides 730 to 733 of SEQ ID NO.1; sgr1-22 # -12 A deletion of 26 bases occurred at the sgRNA 01 target site, and a deletion of 11 bases occurred at the sgRNA02 target site, corresponding to the deletion of nucleotides 313-338 and 728-738 of SEQ ID NO.1, respectively; using tomato T069 as material, a homozygous editing strain was obtained, namely sgr1-7 # -7 A 552-bp deletion occurred between the two editing sites of sgRNA01 and sgRNA02, corresponding to the deletion of nucleotides 337 to 727 of SEQ ID NO.1. The above results show that in different tomato cultivars, SlSGR1 The gene can be edited in a targeted manner, and different genotype edited plants can be obtained. In addition, through continuous self-pollination, homozygous edited plants without exogenous DNA can be obtained. Figure 1 for SlSGR1 Figure 2. Gene structure and target site sequence analysis results of homozygous edited strains.

[0063] Through SGR1 Analysis of the protein structures generated by translation of four different types of gene editing found that sgr1 # -4-10 After the two sites of the strain were inverted, the translation of SGR1 was terminated prematurely. sgr1-12 # -1 and sgr1-22 # -12 The edited strains had a 1 bp insertion and a 26 bp deletion at the sgRNA01 editing site, both of which caused the premature termination of SGR1 translation ( Figure 2 ); and sgr1-7 # -7 In the edited plants, a polypeptide lacking 130 amino acids is encoded ( Figure 2 ), and also caused the premature termination of SGR1 translation. These mutations all led to the destruction of the CRM domain (Cysteine ​​Rich Motif), the key domain of SGR1 protein that catalyzes the removal of chlorophyll a magnesium ion, and thus led to the inactivation of SGR1 protein function.

[0064] Example 2

[0065] SlSGR1 Testing the low temperature tolerance of gene-edited plants

[0066] Compared with wild-type tomato T048, edited plants sgr1-4 # -10 Leaf senescence was delayed, the peel of mature fruits was rusty red, the flesh and pectin were rusty and green, respectively. Compared with the wild-type tomato T048, the lycopene, chlorophyll and β-carotene contents of the edited strain increased by 3.2 times, 6.88 times and 8.65 times, respectively. sgr1- 4 # -10 The wild-type plants (T048) were sown at the end of August 2022, and planted in the research greenhouse of the Horticulture Research Institute of Sichuan Academy of Agricultural Sciences (Jinjiang District, Chengdu, Sichuan Province) at the end of September. Normal fertilizer and water management was carried out, and photos were taken in mid-December. In mid-December, the average daytime temperature in the greenhouse was about 12°C, and the average nighttime temperature was about 5°C. Figure 3 The results showed that when the temperature in the greenhouse was low, the leaves of the wild-type plants turned yellow and the whole plant wilted, while the gene-edited plants sgr1-4 # -10 Normal growth can still be carried out. Figure 3 The wild-type plant T048 and sgr1 Performance of mutant plants in greenhouse during winter.

[0067] T3 gene-edited plants sgr1-4 # -10 , sgr1-12 # -1 , sgr1-22 # -12 and sgr1-7 # -7Seeds of wild-type plants (T048 and T069) were sown, and four weeks later, they were treated at 25°C and 4°C in an artificial incubator. After 6 days of low-temperature treatment, the low-temperature stress treatment group was compared with the control group that was not treated with low temperature under the same conditions to observe the phenotypes of wild-type and gene-edited plants. The results showed that after low-temperature treatment, the wild-type tomato plants had a higher degree of leaf curling than the gene-edited plants, indicating that the wild-type tomatoes were more wilted at low temperatures ( Figure 4 A and Figure 5 A in the figure).

[0068] Example 3

[0069] Determination of physiological indexes of plants after low temperature stress test

[0070] The physiological parameters of tomato leaves after 5 days of low temperature treatment at 4°C were measured, including the content of malondialdehyde (MDA), proline (Proline) content, the leaf relative water content (RWC), superoxide anions (O2 - ), hydrogen peroxide (H2O2), catalase activity (CAT), peroxidase activity (POD) and superoxide dismutase activity (SOD). The results of MDA content, proline content and relative water content are as follows Figure 4 and Figure 5 shown. Figure 4 Low temperature stress sgr1 The results of the mutant and wild-type T048; (A) after 5 days of low temperature treatment at 4°C, sgr1 Phenotypes of mutants and wild type; (BD) After 5 days of low temperature treatment at 4℃, the sgr1 Malondialdehyde (MDA) and proline contents in leaves of mutants and wild type, as well as relative water content (RWC) in leaves; sgr1-4 # - 10 , sgr1-12 # -1 , sgr1-22 # -12 : sgr1 Mutant. Figure 5 Low temperature stress sgr1 The results of the mutant and wild-type T069; (A) after 5 days of low temperature treatment at 4°C, sgr1Phenotypes of mutants and wild type; (BD) After 5 days of low temperature treatment at 4℃, the sgr1 Malondialdehyde (MDA) and proline contents in leaves of mutants and wild type, as well as relative water content (RWC) in leaves; sgr1-7 # -7 : sgr1 Mutant.

[0071] The results showed that the MDA content in sgr1 The mutant had a significantly lower proline content than the wild type, while the mutant had a significantly higher proline content than the wild type. The mutant leaf RWC was significantly higher than the wild type ( Figure 4 B- Figure 4 D in Figure 5 B- Figure 5 The above results show that compared with the wild type, sgr1 The mutants were less damaged at low temperatures.

[0072] sgr1 The mutation caused the plant to have H2O2 and O2 - The content decreased and the activity of antioxidant enzymes increased, such as Figure 6 and Figure 7 shown. Figure 6 for SlSGR1 Gene mutation leads to a decrease in ROS content in T048 tomato material under low temperature stress and the effect of cold stress on the antioxidant enzyme system; (A) DAB (upper) and NBT (lower) staining show SlSGR1 The mutation of inhibited the ROS burst caused by low temperature stress; (B) H2O2 and O2 before and after low temperature treatment - Content detection; (C) CAT, SOD and POD enzyme activity detection before and after low temperature treatment; sgr1-4 # -10 , sgr1-12 # -1 , sgr1-22 # -12 : sgr1 Mutant. Figure 7 SlSGR1 Gene mutation leads to a decrease in ROS content in T069 tomato material under low temperature stress and the effect of cold stress on the antioxidant enzyme system; (A) DAB (upper) and NBT (lower) staining show SlSGR1 The mutation of inhibited the ROS burst caused by low temperature stress; (B) H2O2 and O2 before and after low temperature treatment - Content detection; (C) CAT, SOD and POD enzyme activity detection before and after low temperature treatment; sgr1-7 #-7 : sgr1 Mutant.

[0073] After low temperature treatment, sgr1 H2O2 and O2 in mutant plants - The harmful substance content was significantly lower than that of wild type tomatoes, sgr1 The activities of catalase (CAT) and peroxidase (POD) in mutant plants were increased ( Figure 6 A and Figure 6 B in Figure 7 A and Figure 7 The activity of superoxide dismutase (SOD) was also significantly increased ( Figure 6 C in Figure 7 These results show that SlSGR1 The mutation of the gene can alleviate the accumulation of ROS in tomatoes after low temperature stress, and stimulate the increase of antioxidant enzyme activity in tomatoes, thereby improving the low temperature tolerance of tomatoes.

[0074] In addition, it has been verified that after the gene mutation, indicators such as soluble solids and VC that affect the taste of tomatoes did not change significantly.

[0075] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creative work, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Tomato SGR1 Gene editing or tomato SGR1 Application of a gene editing agent in cultivating low temperature resistant tomatoes, the tomatoes SGR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the gene editing is SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 Gene expression.

2. Tomato SGR1 Gene editing or tomato SGR1 The use of a gene editing reagent in any one or more of ① to ⑥: ①Inhibit the increase of MDA content in tomato leaves caused by low temperature stress; ②Increase the proline content in tomato leaves under low temperature stress; ③ Delay the decrease in water content of tomato leaves caused by low temperature stress; ④Inhibit the ROS burst in tomato leaves caused by low temperature stress; ⑤Inhibit the increase of catalase activity and peroxidase activity caused by low temperature stress; ⑥ Improve the activity of antioxidant enzymes under low temperature stress; the antioxidant enzymes include CAT, SOD and POD; The tomato SGR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The gene editing is SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 Gene expression.

3. A method for cultivating low temperature resistant tomatoes, characterized in that: The following steps are involved: Tomato SGR1 Gene editing was performed to obtain cold-tolerant tomatoes; The gene editing is SGR1 Gene editing can inhibit or reduce the activity of SGR1 protein in tomatoes or SGR1 Gene expression.

4. The method according to claim 3, characterized in that: The gene editing includes using the CRISPR / Cas9 system to perform gene editing.

5. The method according to claim 4, characterized in that The target sequences for gene editing using the CRISPR / Cas9 system include tomato SGR1 Nucleotides 30-48 in exon 3 of the gene and tomato SGR1 The nucleotides 265 to 283 of the 4th exon region of the gene; the tomato SGR1 The sequence of nucleotides 30 to 48 in the third exon region of the gene is shown in SEQ ID NO.10; the tomato SGR1 The sequence of nucleotides 265 to 283 in the 4th exon region of the gene is shown in SEQ ID NO.11.

Images